ID: 1035270523

View in Genome Browser
Species Human (GRCh38)
Location 7:157717204-157717226
Sequence CTAAAAAAAGCACATTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035270519_1035270523 14 Left 1035270519 7:157717167-157717189 CCAAAATCGATCCACGAGGCTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1035270523 7:157717204-157717226 CTAAAAAAAGCACATTTGGTGGG No data
1035270520_1035270523 3 Left 1035270520 7:157717178-157717200 CCACGAGGCTTTGAGAAAATGCA 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1035270523 7:157717204-157717226 CTAAAAAAAGCACATTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035270523 Original CRISPR CTAAAAAAAGCACATTTGGT GGG Intronic
No off target data available for this crispr