ID: 1035271130

View in Genome Browser
Species Human (GRCh38)
Location 7:157720570-157720592
Sequence CCGCGTGCACACCCATGCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035271130_1035271137 6 Left 1035271130 7:157720570-157720592 CCGATGCATGGGTGTGCACGCGG 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1035271137 7:157720599-157720621 AGGGAGTCACGTGAATCATGTGG 0: 1
1: 0
2: 0
3: 29
4: 690

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035271130 Original CRISPR CCGCGTGCACACCCATGCAT CGG (reversed) Intronic