ID: 1035271130

View in Genome Browser
Species Human (GRCh38)
Location 7:157720570-157720592
Sequence CCGCGTGCACACCCATGCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035271130_1035271137 6 Left 1035271130 7:157720570-157720592 CCGATGCATGGGTGTGCACGCGG 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1035271137 7:157720599-157720621 AGGGAGTCACGTGAATCATGTGG 0: 1
1: 0
2: 0
3: 29
4: 690

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035271130 Original CRISPR CCGCGTGCACACCCATGCAT CGG (reversed) Intronic
907731297 1:57068714-57068736 TCGCCTTCACACCCATGCCTGGG + Intronic
918399281 1:184147375-184147397 CCCTGTGCTCACCCATGCTTGGG - Intergenic
1069071988 10:63998641-63998663 CAGACTGCACTCCCATGCATTGG - Intergenic
1077030595 11:464383-464405 CCGTGTGCCCACCACTGCATGGG + Intronic
1082075229 11:47971069-47971091 GGGCGTGCACTGCCATGCATGGG + Intergenic
1082224634 11:49689994-49690016 CAGCCTGCACTCCCATGGATAGG - Intergenic
1083933241 11:65857421-65857443 CTGCGTTCTCACCCGTGCATCGG - Intronic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1086624411 11:88929185-88929207 CAGCCTGCACTCCCATGGATAGG + Intronic
1086930932 11:92692214-92692236 CAGCTTTAACACCCATGCATTGG + Intronic
1091850479 12:3693122-3693144 CTGCCTGCACACACATGCACCGG + Intronic
1096258872 12:50078725-50078747 CCGCCTGCACCCCCAGGGATGGG + Intronic
1099963942 12:89424969-89424991 ACGTGTGCACACAAATGCATAGG + Intronic
1102205966 12:111091116-111091138 CCGTGTGCACATCCATGTAAGGG + Intronic
1104217284 12:126746628-126746650 CCAAGTGCACACCCATAGATTGG + Intergenic
1104919689 12:132284184-132284206 ACGTGTGCACACACATGCGTGGG - Intronic
1108166015 13:47693901-47693923 GTGCGTGCACACACATGCACAGG - Intergenic
1121931847 14:97979295-97979317 GGGCATGCACACCAATGCATGGG - Intergenic
1124441473 15:29689076-29689098 GCGCGTGCACACCCAAGCCTCGG - Intergenic
1129152807 15:73699660-73699682 CCACATGCACACCCATGCCAGGG - Exonic
1133285896 16:4690673-4690695 CCGAGTGCACACACATGCATGGG - Exonic
1133404584 16:5513057-5513079 AGGCGTGCACTACCATGCATAGG + Intergenic
1133511080 16:6457971-6457993 GCGTGTGCACACACATACATAGG + Intronic
1133770226 16:8863463-8863485 CTGAGTGCACACCAATGCAGTGG - Intronic
1135965827 16:27034232-27034254 CCTCAGACACACCCATGCATGGG - Intergenic
1138532892 16:57644624-57644646 ACACATGCACACTCATGCATGGG + Intronic
1138532921 16:57644992-57645014 ACACATGCACACTCATGCATGGG + Intronic
1140905090 16:79402817-79402839 CCCCATGGACACCCAGGCATGGG - Intergenic
1141675442 16:85515066-85515088 ACGTGTGCACACACATCCATAGG - Intergenic
1142187868 16:88703003-88703025 TGGCGTGCACACCCATGGAAAGG + Intronic
1148834995 17:50461318-50461340 CTGCATGAGCACCCATGCATAGG - Exonic
1165340981 19:35212027-35212049 CCGTGGGCACACCCAGGCAGAGG + Intergenic
925067386 2:938988-939010 CCATGTGCACACGCATGCATGGG + Intergenic
925160520 2:1680630-1680652 GCTTGTGCACACCCAGGCATCGG + Intronic
925658726 2:6179980-6180002 ATGCATGCACACACATGCATGGG + Intergenic
939268996 2:139913336-139913358 CCGACTGCACATCCATTCATAGG + Intergenic
945884695 2:215362865-215362887 CCGCGTGCCTTCCCATGCACTGG - Intronic
948501785 2:238399745-238399767 CGGTATGCACACCCATGCAAAGG - Exonic
1169241680 20:3986622-3986644 CTGCATGCACACTCATGCCTGGG - Intronic
1173793644 20:45843801-45843823 CAGTCTGCACACCCATGCACGGG - Intronic
1175234759 20:57502174-57502196 CCGGGGGCACACCCAGGCTTAGG + Intronic
1176369106 21:6051965-6051987 CCACGTCCCCACCTATGCATGGG - Intergenic
1179080937 21:38170168-38170190 CCACTTCCACTCCCATGCATAGG + Intronic
1179754413 21:43486576-43486598 CCACGTCCCCACCTATGCATGGG + Intergenic
1184127035 22:42494780-42494802 GCGTGCGCACACACATGCATAGG + Intergenic
1184241815 22:43214994-43215016 ACACGTGCACACACAGGCATGGG - Intronic
968442380 4:630389-630411 CCGAGTGCCCATCCATGCAAGGG + Intronic
976983329 4:91260305-91260327 ACACATACACACCCATGCATGGG + Intronic
985848138 5:2369341-2369363 ATGCATGCACACACATGCATGGG + Intergenic
997589750 5:135065438-135065460 CCACGAGCACAGACATGCATGGG - Intronic
997722740 5:136092828-136092850 AGGCGTGCACAACCATGCCTGGG + Intergenic
1006411652 6:33877433-33877455 CTGCATGCACACGCATGCAGTGG + Intergenic
1007775596 6:44222917-44222939 CCGCGCGCACACGCAAGCACAGG + Intronic
1010002565 6:70962480-70962502 TTGTGTGCACACGCATGCATGGG + Intergenic
1015305494 6:131701914-131701936 ACGCGTGCACACGTATACATAGG + Intronic
1019354418 7:571303-571325 CCCCGTGCACACCCCGTCATCGG - Intronic
1019601837 7:1888379-1888401 ACGCATGCACACACACGCATAGG - Intronic
1024580392 7:50796200-50796222 CCGCCTGCCCACCCCTGCAAGGG + Intergenic
1024761942 7:52609366-52609388 CAGTGTGCACACCGAGGCATTGG - Intergenic
1030606559 7:111644418-111644440 CTGTGTGCACAGGCATGCATGGG - Intergenic
1034092934 7:148381037-148381059 CCGCGTGCTTACCCCTGCAAGGG - Intronic
1034491048 7:151393285-151393307 CTGTGTGCACACACAGGCATAGG - Intronic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035399085 7:158553083-158553105 CTGCGTACACACACATGCTTGGG + Intronic
1048882192 8:138880335-138880357 GCGCGTGCACACACACGCACAGG - Intronic
1051370558 9:16355480-16355502 CAGCTGGCACACCCATGCGTCGG - Intergenic
1057995535 9:99819687-99819709 CCGTGCGCACACACATGCACGGG + Intergenic
1196010409 X:110880956-110880978 CTGTGTGCACACCCATGCCCTGG + Intergenic