ID: 1035271137

View in Genome Browser
Species Human (GRCh38)
Location 7:157720599-157720621
Sequence AGGGAGTCACGTGAATCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 720
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 690}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035271130_1035271137 6 Left 1035271130 7:157720570-157720592 CCGATGCATGGGTGTGCACGCGG 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1035271137 7:157720599-157720621 AGGGAGTCACGTGAATCATGTGG 0: 1
1: 0
2: 0
3: 29
4: 690
1035271128_1035271137 16 Left 1035271128 7:157720560-157720582 CCCGGCTGCACCGATGCATGGGT 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1035271137 7:157720599-157720621 AGGGAGTCACGTGAATCATGTGG 0: 1
1: 0
2: 0
3: 29
4: 690
1035271126_1035271137 17 Left 1035271126 7:157720559-157720581 CCCCGGCTGCACCGATGCATGGG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1035271137 7:157720599-157720621 AGGGAGTCACGTGAATCATGTGG 0: 1
1: 0
2: 0
3: 29
4: 690
1035271129_1035271137 15 Left 1035271129 7:157720561-157720583 CCGGCTGCACCGATGCATGGGTG 0: 1
1: 0
2: 2
3: 5
4: 92
Right 1035271137 7:157720599-157720621 AGGGAGTCACGTGAATCATGTGG 0: 1
1: 0
2: 0
3: 29
4: 690

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035271137 Original CRISPR AGGGAGTCACGTGAATCATG TGG Intronic
900771947 1:4552387-4552409 AGGGAGGTAATTGAATCATGGGG - Intergenic
900937840 1:5778026-5778048 TGGGAGGCAATTGAATCATGGGG + Intergenic
900943890 1:5818533-5818555 TGGGAGTTAATTGAATCATGGGG + Intergenic
901154472 1:7126146-7126168 TGGGAGATACCTGAATCATGGGG - Intronic
901252377 1:7790439-7790461 AGGGAGGTAATTGAATCATGGGG - Intronic
902102409 1:14002352-14002374 AGGGAGGTAATTGAATCATGGGG + Intergenic
903053279 1:20617463-20617485 TGGGAGGCAATTGAATCATGGGG + Intronic
903267269 1:22165338-22165360 TGGGAGACAATTGAATCATGGGG - Intergenic
904856606 1:33502502-33502524 TGGGAGGTACCTGAATCATGGGG + Intergenic
905752771 1:40480014-40480036 AGGAAGTCATGTGTCTCATGTGG + Intronic
905837120 1:41135367-41135389 TGGGAGGTAAGTGAATCATGGGG + Intronic
906762301 1:48387213-48387235 TGGGAGGCAATTGAATCATGGGG - Intronic
907280013 1:53341222-53341244 TGGGAGGGACGTGAATCATGGGG + Intergenic
908971014 1:69831613-69831635 AGGGAGGCAAGTGAAAAATGAGG - Intronic
909058289 1:70848230-70848252 TGGGAGGCAATTGAATCATGGGG - Intergenic
909177503 1:72379896-72379918 TGGGAGGCAATTGAATCATGGGG - Intergenic
909274547 1:73667050-73667072 AGGGAGGCAATTAAATCATGAGG + Intergenic
909371422 1:74886954-74886976 TGGGAGTTAAGTGAATTATGGGG + Intergenic
909694692 1:78453702-78453724 TGGGAGACAATTGAATCATGGGG + Intronic
909746326 1:79101995-79102017 TGGGAGGCAATTGAATCATGGGG + Intergenic
910064984 1:83141806-83141828 TGGGAGGCAAATGAATCATGGGG + Intergenic
910141623 1:84032655-84032677 TGGGAGTTAATTGAATCATGGGG - Intergenic
910417041 1:87012487-87012509 TGGGAGGCAACTGAATCATGGGG - Intronic
910500785 1:87888116-87888138 AGGAAGTCATGTGGATCAGGGGG - Intergenic
910706768 1:90139008-90139030 TGGGAGGCAATTGAATCATGGGG - Intergenic
911351331 1:96760050-96760072 TGGGAGTTAACTGAATCATGGGG - Intronic
911629421 1:100165781-100165803 TGGGAGACAATTGAATCATGGGG + Intronic
911838691 1:102654648-102654670 AGGGAGTTAAGTCAATGATGAGG + Intergenic
912138998 1:106698060-106698082 AGGGAGGTAATTGAATCATGAGG + Intergenic
912241516 1:107915062-107915084 AGGGACTCACTTGAATAGTGAGG + Intronic
913668502 1:121072311-121072333 TGGGAGGTAGGTGAATCATGGGG - Intergenic
914020246 1:143859754-143859776 TGGGAGGTAGGTGAATCATGGGG - Intergenic
914658746 1:149767666-149767688 TGGGAGGTAGGTGAATCATGGGG - Intergenic
917420140 1:174854826-174854848 AGAGAATCACTTGAATCCTGGGG - Intronic
917494169 1:175525056-175525078 TGGGAGGTACTTGAATCATGTGG + Intronic
918264919 1:182832881-182832903 TGGGAGTTAACTGAATCATGAGG - Intergenic
918337867 1:183538909-183538931 GCGGAGGCAGGTGAATCATGAGG + Intronic
918459681 1:184763844-184763866 TGGGAGGTACTTGAATCATGGGG - Intergenic
918787200 1:188776984-188777006 AGGGAGGTAATTGAATCATGGGG + Intergenic
919037975 1:192340882-192340904 AGGGAGATAATTGAATCATGTGG - Intronic
919064095 1:192670964-192670986 TGGGAGATAAGTGAATCATGGGG + Intergenic
919141953 1:193583580-193583602 TGGGAGGCAATTGAATCATGGGG - Intergenic
921275955 1:213520399-213520421 TGGGAGACAACTGAATCATGGGG - Intergenic
921276750 1:213528378-213528400 TGGGAGTTAATTGAATCATGGGG - Intergenic
922012469 1:221604492-221604514 AGGGAGGTAATTGAATCATGAGG + Intergenic
923411353 1:233713130-233713152 TGGGAGACAACTGAATCATGGGG + Intergenic
923427897 1:233890431-233890453 AGGGAGGTAATTGAATCATGGGG + Intergenic
923459438 1:234195775-234195797 TGGGAGACAACTGAATCATGGGG + Intronic
923502911 1:234581232-234581254 TGGGAGTTAATTGAATCATGGGG - Intergenic
923687227 1:236161640-236161662 AGGGAGGTAATTGAATCATGGGG + Intronic
924785834 1:247198475-247198497 AGGGAGGTAATTGAATCATGGGG + Intergenic
924860876 1:247921140-247921162 AGTGAATCAGGAGAATCATGAGG - Exonic
924890551 1:248273670-248273692 AGTGAATCAGGAGAATCATGAGG + Exonic
924892204 1:248295434-248295456 AGTGAATCAGGAGAATCATGAGG + Exonic
1063151326 10:3339288-3339310 AGGGTGTCTTGTGAATCATACGG - Intergenic
1063723605 10:8611995-8612017 TGGGAGTTAATTGAATCATGGGG - Intergenic
1064011365 10:11739184-11739206 TGGGAGACAATTGAATCATGGGG - Intergenic
1064515823 10:16146883-16146905 AGGGAGGTAACTGAATCATGGGG + Intergenic
1064777208 10:18792213-18792235 TGGGAGTCAATTGAATAATGGGG - Intergenic
1064879441 10:20033709-20033731 AGGGAGGTAATTGAATCATGGGG - Intronic
1065373034 10:25009700-25009722 TGGGAGGTAAGTGAATCATGGGG + Intronic
1065626921 10:27639205-27639227 TGGGAGACAATTGAATCATGGGG - Intergenic
1065654507 10:27933992-27934014 TGGGAGTTAATTGAATCATGGGG + Intronic
1065887748 10:30093770-30093792 AGAGAGTCACGGGAATCCCGGGG + Intronic
1066159094 10:32709600-32709622 AGGCAGTAATGTGAATGATGGGG + Intronic
1066237784 10:33503084-33503106 AGCGAGTCACGTGAATTTTTTGG + Intergenic
1066600343 10:37099113-37099135 AGGGAGGCAACTGAATCATGAGG - Intergenic
1067219051 10:44329252-44329274 TGGGAGGCAATTGAATCATGGGG + Intergenic
1067424490 10:46194875-46194897 TGGGAGACAATTGAATCATGGGG - Intergenic
1067782837 10:49221469-49221491 AGGAAGTCACCTGCATCAGGTGG - Intergenic
1068103061 10:52580823-52580845 TGGGAGGCAGTTGAATCATGGGG - Intergenic
1068215708 10:53979376-53979398 TGGGAGACAATTGAATCATGGGG - Intronic
1070150347 10:73801327-73801349 CAGGAGTCAGGTGAATCAAGCGG - Exonic
1070376152 10:75832881-75832903 TGGGAGACAACTGAATCATGGGG - Intronic
1070860908 10:79660290-79660312 TGGGAGACAATTGAATCATGGGG - Intergenic
1070861866 10:79675041-79675063 AAGGAGTCATGTGACTCATTTGG + Intergenic
1070876354 10:79815294-79815316 TGGGAGACAATTGAATCATGGGG + Intergenic
1071642205 10:87321696-87321718 AAGGAGTCATGTGACTCATTTGG - Intergenic
1071643284 10:87337468-87337490 TGGGAGACAATTGAATCATGGGG + Intergenic
1071671154 10:87610583-87610605 TGGGAGATAAGTGAATCATGGGG + Intergenic
1073776364 10:106790047-106790069 AGGGAGAGACCTGGATCATGGGG - Intronic
1073898545 10:108191626-108191648 TGGGAGATACTTGAATCATGGGG + Intergenic
1074417155 10:113276849-113276871 TGGGAGGCAGTTGAATCATGAGG + Intergenic
1074431048 10:113394956-113394978 TGGGAGGCAATTGAATCATGGGG + Intergenic
1074493127 10:113956488-113956510 TGGGAGACAATTGAATCATGGGG + Intergenic
1074965697 10:118489020-118489042 TGGGAGGCAACTGAATCATGGGG + Intergenic
1075543529 10:123336512-123336534 GGGGAGGTAAGTGAATCATGGGG - Intergenic
1075844517 10:125534705-125534727 TGGGAGTTAATTGAATCATGGGG - Intergenic
1078324381 11:10367724-10367746 TGGGAGGTACTTGAATCATGGGG + Intronic
1078365170 11:10700363-10700385 TGGGAGATAAGTGAATCATGGGG + Intergenic
1078601718 11:12738068-12738090 ATGGAGATAAGTGAATCATGGGG - Intronic
1078990007 11:16636710-16636732 TGGGAGGCAATTGAATCATGGGG + Intronic
1080778495 11:35408379-35408401 AGGGAGGTAATTGAATCATGGGG + Intronic
1080959169 11:37137800-37137822 TGGGAGGTAAGTGAATCATGGGG - Intergenic
1081047259 11:38291646-38291668 TGGGAGGCAATTGAATCATGGGG - Intergenic
1081101176 11:39004750-39004772 TGGGAGGCAGGTGGATCATGAGG + Intergenic
1081186124 11:40044503-40044525 AGTGAGTCACGTGAATTATTTGG + Intergenic
1081423483 11:42899669-42899691 TGGGAGGCAATTGAATCATGGGG + Intergenic
1081622122 11:44624847-44624869 TGGGAGATAAGTGAATCATGGGG - Intergenic
1082946238 11:58763771-58763793 AGGGAGACAATTGAATCATGAGG + Intergenic
1085004022 11:73068088-73068110 TGGGAGTTAACTGAATCATGGGG - Intronic
1085651667 11:78273803-78273825 TGGGAGGTAAGTGAATCATGGGG + Intronic
1085745486 11:79111046-79111068 TGGGAGACAATTGAATCATGGGG + Intronic
1085890049 11:80567789-80567811 AGGGAGGTAATTGAATCATGAGG + Intergenic
1086758907 11:90602716-90602738 AGGGAGGTAATTGAATCATGGGG + Intergenic
1086933965 11:92723833-92723855 TGGGAGGTACTTGAATCATGTGG - Intronic
1087606819 11:100387062-100387084 TGGGAGACAATTGAATCATGGGG + Intergenic
1088635301 11:111814355-111814377 AGGGAGTCTCCTGACTCCTGTGG - Intronic
1088705673 11:112462006-112462028 TGGGAGATACTTGAATCATGGGG + Intergenic
1089044249 11:115485519-115485541 TGGGAGACAACTGAATCATGGGG + Intronic
1092612545 12:10187663-10187685 ACAGAGGCAGGTGAATCATGAGG - Intronic
1093570902 12:20664571-20664593 TGGGAGACACTTGAATCATGAGG + Intronic
1094397487 12:30024212-30024234 TGGGAGTTAATTGAATCATGGGG - Intergenic
1094762447 12:33550275-33550297 TGGGAGTTAATTGAATCATGGGG + Intergenic
1095131721 12:38550171-38550193 TGGGAGGAAAGTGAATCATGGGG - Intergenic
1095343797 12:41124902-41124924 AGGGAGGTAATTGAATCATGGGG + Intergenic
1095689056 12:45067421-45067443 AGGGAGATAATTGAATCATGGGG - Intergenic
1097570674 12:61327233-61327255 TGGGAGGCAATTGAATCATGGGG - Intergenic
1098026872 12:66213261-66213283 TGGGAGTTAATTGAATCATGGGG - Intronic
1098115264 12:67169196-67169218 ATGGAGACAATTGAATCATGGGG - Intergenic
1098327491 12:69317534-69317556 TGGGAGGCAATTGAATCATGGGG - Intergenic
1098778664 12:74655100-74655122 AGGGAGGTAATTGAATCATGGGG - Intergenic
1099410888 12:82325729-82325751 AGTGAGTCACATGAATCTTTTGG + Intronic
1099589369 12:84567777-84567799 ATGGAGGTAAGTGAATCATGGGG + Intergenic
1099700077 12:86073084-86073106 TGGGAGACAATTGAATCATGGGG + Intronic
1099891778 12:88597808-88597830 AGGGAGGTAATTGAATCATGGGG + Intergenic
1100325060 12:93532618-93532640 TGGGAGATACTTGAATCATGGGG - Intergenic
1100898924 12:99216017-99216039 AGGGAGGTAATTGAATCATGAGG + Intronic
1101267500 12:103104671-103104693 TGGGAGGCAGGTGGATCATGAGG - Intergenic
1101337529 12:103809694-103809716 TGGGAGGCAATTGAATCATGGGG - Intronic
1102211914 12:111133542-111133564 AGGGAGGTAACTGAATCATGGGG - Intronic
1102891845 12:116565474-116565496 AGGGAGATAACTGAATCATGGGG - Intergenic
1103224470 12:119274907-119274929 AGGGAAGGACTTGAATCATGGGG - Intergenic
1103260312 12:119582511-119582533 TGGGAGTTAACTGAATCATGGGG + Intergenic
1103856888 12:123976844-123976866 TGGGAGGCAGGTGGATCATGAGG + Intronic
1104528755 12:129549130-129549152 TGGGAGGTAAGTGAATCATGGGG + Intronic
1104528795 12:129549393-129549415 TGGGAGATAAGTGAATCATGGGG + Intronic
1104566215 12:129886782-129886804 TGGGAGGTACCTGAATCATGAGG + Intronic
1105285641 13:19001267-19001289 TGGGAGTTAATTGAATCATGGGG - Intergenic
1106684452 13:32043224-32043246 TGGGAGATAAGTGAATCATGGGG - Intronic
1106715210 13:32381479-32381501 AGGGAGTGAGGTGAGGCATGTGG + Intronic
1106927562 13:34629555-34629577 AGGGGGTCAAGTGAATCAGTTGG - Intergenic
1107106397 13:36647926-36647948 AGGCAGTCATGTGAGTGATGGGG + Intergenic
1107741566 13:43455716-43455738 TGGGAGACACTTGAATCATGGGG + Intronic
1108100186 13:46946058-46946080 AGGGAGATAATTGAATCATGGGG - Intergenic
1109332652 13:60949063-60949085 TGGGAGGCAAGTGAATCATCAGG + Intergenic
1109475537 13:62876438-62876460 AGGGAGGTAATTGAATCATGGGG - Intergenic
1109496530 13:63178851-63178873 TGGGAGACAATTGAATCATGGGG + Intergenic
1110018648 13:70440740-70440762 TGGGAGGCAATTGAATCATGGGG - Intergenic
1110077711 13:71269799-71269821 AGGAAGTAACGTGAGTAATGGGG + Intergenic
1110250546 13:73376538-73376560 TGGGAGACAATTGAATCATGGGG - Intergenic
1110872819 13:80472291-80472313 AAGGAGGCAGGTGGATCATGAGG + Intergenic
1111067148 13:83107985-83108007 GGGGAGGCAATTGAATCATGGGG + Intergenic
1111179301 13:84640991-84641013 TGGGAGGCAATTGAATCATGGGG - Intergenic
1111457601 13:88505473-88505495 TGGGAGGTAAGTGAATCATGGGG + Intergenic
1111678322 13:91414177-91414199 TGGGAGGCAATTGAATCATGGGG + Intronic
1112089511 13:96068297-96068319 AGGGAGGTAATTGAATCATGGGG - Intergenic
1112660190 13:101499016-101499038 AGGGAGATAATTGAATCATGGGG - Intronic
1113238806 13:108313723-108313745 TGGGAGATACTTGAATCATGGGG + Intergenic
1113327412 13:109295353-109295375 TGGGAGGCAATTGAATCATGGGG - Intergenic
1113470866 13:110544895-110544917 AGGGAGGCAATTGAATCATGGGG + Intronic
1113502071 13:110783700-110783722 TGGGAGGCAATTGAATCATGGGG - Intergenic
1115055771 14:29124648-29124670 TGGGAGGTACTTGAATCATGGGG - Intergenic
1115157760 14:30359947-30359969 TGGGAGACAACTGAATCATGGGG - Intergenic
1115378995 14:32712140-32712162 AGCAAGTCACGTGAATCTTTTGG + Intronic
1115820450 14:37207180-37207202 TGGGAGATACTTGAATCATGGGG + Intronic
1115861036 14:37686784-37686806 TGGGAGATAAGTGAATCATGGGG - Intronic
1116024418 14:39497748-39497770 TGGGAGGCAATTGAATCATGGGG + Intergenic
1116088138 14:40267803-40267825 TGGGAGACAATTGAATCATGGGG - Intergenic
1116286797 14:42984947-42984969 TGGGAGGCAATTGAATCATGGGG - Intergenic
1116448219 14:45037051-45037073 AGGGAGGTAACTGAATCATGGGG - Intronic
1116655754 14:47651621-47651643 AGGGAGTTATATGAAGCATGAGG + Intronic
1116854370 14:49938622-49938644 TGGGAGTTAATTGAATCATGGGG + Intergenic
1117854321 14:60011328-60011350 TGGGAGGTAAGTGAATCATGGGG - Intronic
1118048697 14:62003023-62003045 AGGGAGGTAACTGAATCATGGGG - Intronic
1118599310 14:67460468-67460490 ACCGAGGCAGGTGAATCATGAGG + Intronic
1119040254 14:71268295-71268317 TGGGAGGCAATTGAATCATGGGG + Intergenic
1120315783 14:82890832-82890854 AGGGAGGTAACTGAATCATGAGG + Intergenic
1120485759 14:85111990-85112012 TGGGAGATAGGTGAATCATGGGG - Intergenic
1121063579 14:90939722-90939744 GGGGAGTTAACTGAATCATGGGG - Intronic
1122158096 14:99763011-99763033 TGGGAGGCAATTGAATCATGGGG + Intronic
1122197723 14:100101926-100101948 AGGGAATCACTTGAACCAGGAGG - Intronic
1124664846 15:31583501-31583523 TGGGAGACAATTGAATCATGGGG + Intronic
1124695970 15:31864576-31864598 AGGGAGGTAACTGAATCATGGGG - Intronic
1125230656 15:37451795-37451817 GGGAAGTCATTTGAATCATGAGG + Intergenic
1125233583 15:37485232-37485254 TGGGAGTTAATTGAATCATGGGG - Intergenic
1125406309 15:39355565-39355587 TGGGAGGTACTTGAATCATGGGG + Intergenic
1125977395 15:43966843-43966865 AGGGAGTCACATGATCCAAGTGG + Intronic
1126506712 15:49413200-49413222 TGGGAGATAAGTGAATCATGGGG + Intronic
1127097014 15:55522343-55522365 AGGGAGGTAATTGAATCATGGGG + Intergenic
1128008174 15:64265357-64265379 AGGGAGGTAACTGAATCATGGGG + Intronic
1128706939 15:69843382-69843404 CGTGAGTCAAGTGAATCAGGAGG + Intergenic
1128876986 15:71209789-71209811 TGGGAGGCAACTGAATCATGGGG + Intronic
1129286505 15:74529514-74529536 TCGGAGGCAGGTGAATCATGAGG - Intergenic
1130338516 15:82978646-82978668 AGGGAGGTAAATGAATCATGGGG + Intronic
1130778540 15:87010168-87010190 TGGGAGACAATTGAATCATGGGG + Intronic
1131659824 15:94501989-94502011 TGGGAGGTAAGTGAATCATGGGG + Intergenic
1133132653 16:3687144-3687166 TGGGAGATAAGTGAATCATGGGG + Intronic
1133702728 16:8324335-8324357 AGGGAGGTAACTGAATCATGGGG + Intergenic
1134045641 16:11098917-11098939 AGGGAGGCAGGTGACCCATGAGG + Intronic
1134233794 16:12449963-12449985 TGGGAGACAACTGAATCATGGGG + Intronic
1134342783 16:13360411-13360433 TGGGAGGCAATTGAATCATGGGG + Intergenic
1135136351 16:19887588-19887610 AGGGAGGTAATTGAATCATGGGG - Intergenic
1135149332 16:19991886-19991908 AGGGAGACACGAGAATCTAGTGG - Intergenic
1137027764 16:35495485-35495507 AGGGAGTAAAGTCAATCAAGTGG + Intergenic
1137776012 16:51054923-51054945 AGGGAGGTAATTGAATCATGGGG - Intergenic
1137842904 16:51656462-51656484 ACCGAGGCAGGTGAATCATGAGG - Intergenic
1138220701 16:55248047-55248069 TGGGAGGCAATTGAATCATGGGG - Intergenic
1138798988 16:60002700-60002722 TGGGAGACAATTGAATCATGGGG + Intergenic
1140356974 16:74314856-74314878 TGGGAGGCAATTGAATCATGGGG - Intergenic
1140873855 16:79132000-79132022 AGGGAGACAACTGAATCATGGGG - Intronic
1140902931 16:79386464-79386486 AGGAGGTCACGTGAGTGATGGGG + Intergenic
1140920330 16:79531705-79531727 AGGCAGTCATGTGAATGATGGGG + Intergenic
1141345700 16:83243452-83243474 AGAGAGGTAAGTGAATCATGGGG - Intronic
1145736210 17:27233585-27233607 TGGGAGGTACTTGAATCATGGGG - Intergenic
1145757755 17:27405182-27405204 TGGGAGGCAACTGAATCATGGGG - Intergenic
1146468401 17:33105238-33105260 TGGGAGGCAACTGAATCATGGGG + Intronic
1146476255 17:33164947-33164969 AGGGAGGCACGTGAATCAAAAGG - Intronic
1146673724 17:34758887-34758909 AGGAAGTCAAGTGAGTCCTGAGG + Intergenic
1146988953 17:37249871-37249893 TGGGAGATACTTGAATCATGGGG + Intronic
1148248916 17:46056898-46056920 AGGGAGGCACATGCACCATGAGG - Intronic
1149052841 17:52326766-52326788 TGGGAGGTACTTGAATCATGGGG - Intergenic
1149110358 17:53020500-53020522 GGGGAGGCAGTTGAATCATGGGG - Intergenic
1150310434 17:64124452-64124474 TGGGAGACAACTGAATCATGGGG + Intronic
1150474789 17:65466754-65466776 AGGGAGATAATTGAATCATGGGG - Intergenic
1150506371 17:65702905-65702927 AGGGGGTTAACTGAATCATGGGG - Intronic
1150874835 17:68959219-68959241 TGGGAGGCAACTGAATCATGAGG + Intergenic
1151002989 17:70400017-70400039 AGGGAGGTAATTGAATCATGGGG + Intergenic
1151112010 17:71689574-71689596 TGGGAGGCAATTGAATCATGGGG - Intergenic
1151195037 17:72425277-72425299 TGGGAGTTAATTGAATCATGGGG + Intergenic
1151248872 17:72818058-72818080 TGGGAGACAATTGAATCATGGGG - Intronic
1151515268 17:74590096-74590118 TGGGAGTTAATTGAATCATGGGG + Intronic
1152144480 17:78560060-78560082 AGGGAGTCAAGTGTATGATATGG - Intronic
1152959173 18:67985-68007 AGGGTGTCACGTGAGTCTTAGGG - Intronic
1153214962 18:2810909-2810931 TGGGAGATAAGTGAATCATGGGG - Intergenic
1153288295 18:3476690-3476712 AGGGAGATAAGTGAATCATGGGG - Intergenic
1153666879 18:7374453-7374475 TGGGAGTTAATTGAATCATGGGG - Intergenic
1153718764 18:7880113-7880135 TGGGAGTTAATTGAATCATGGGG - Intronic
1153812162 18:8761825-8761847 AGGGAGGTAATTGAATCATGGGG - Intronic
1155194524 18:23460757-23460779 AGGAAGTCAGGAGAGTCATGAGG + Intronic
1155479359 18:26268618-26268640 AGTGAATCACCTGAATCATGTGG + Intronic
1155521732 18:26675108-26675130 AGGGAGGTAATTGAATCATGGGG + Intergenic
1155538769 18:26844836-26844858 TGGGAGGCAATTGAATCATGGGG + Intergenic
1156131220 18:33977339-33977361 TGGGAGGCAACTGAATCATGGGG + Intronic
1156303185 18:35853431-35853453 TGGGAGACAATTGAATCATGGGG - Intergenic
1156382677 18:36578396-36578418 TGGGAGGTAAGTGAATCATGAGG - Intronic
1156583646 18:38408473-38408495 AGGGAGGTAATTGAATCATGGGG + Intergenic
1156969117 18:43133636-43133658 GGGGAGGTACTTGAATCATGGGG + Intergenic
1157078350 18:44493410-44493432 ACTGAATCAAGTGAATCATGGGG + Intergenic
1158173230 18:54622716-54622738 TGGGAGAAAAGTGAATCATGGGG - Intergenic
1158226644 18:55208127-55208149 TGGGAGGCAATTGAATCATGAGG - Intergenic
1158247192 18:55445564-55445586 TGGGAGGCAATTGAATCATGGGG - Intronic
1158727007 18:59982917-59982939 AGGGAGGCAATTGAATCATGAGG + Intergenic
1158833116 18:61302362-61302384 TGGGAGGCAATTGAATCATGGGG + Intergenic
1158875116 18:61726316-61726338 AGGGAGATAATTGAATCATGGGG - Intergenic
1159275443 18:66214749-66214771 GGGGAGTTAATTGAATCATGGGG + Intergenic
1159393476 18:67826395-67826417 TGGGAGGCAACTGAATCATGGGG + Intergenic
1159703608 18:71659981-71660003 AGTGAGGCACCTGAATCATGGGG - Intergenic
1159756459 18:72371533-72371555 TGGGAGTTAATTGAATCATGAGG + Intergenic
1159875024 18:73801049-73801071 TGGGAGTTAATTGAATCATGGGG + Intergenic
1159996766 18:74972073-74972095 AGGGAGGTAATTGAATCATGGGG - Intronic
1160282587 18:77506372-77506394 AGGGAGGTAATTGAATCATGGGG - Intergenic
1160382744 18:78473103-78473125 TGGGAGATAAGTGAATCATGGGG + Intergenic
1161366564 19:3883139-3883161 TGGGAGGCAGGTGGATCATGAGG + Intronic
1161401207 19:4066864-4066886 AGGGAGTCGCGAGCATCATACGG - Exonic
1161826120 19:6567041-6567063 TGGGAGGCAATTGAATCATGGGG - Intergenic
1162002877 19:7758560-7758582 ATGGAGACAATTGAATCATGGGG + Intergenic
1163388411 19:17014718-17014740 AGGGAGATAATTGAATCATGGGG - Intronic
1165168221 19:33872157-33872179 TGGGAGGCAATTGAATCATGGGG - Intergenic
1165386310 19:35512519-35512541 AGGGAGGCACGCGGAGCATGTGG + Intronic
1167479720 19:49722420-49722442 TGGGAGATACTTGAATCATGGGG + Intergenic
1167589577 19:50396712-50396734 TAGGAGGCAGGTGAATCATGAGG - Intronic
1168372603 19:55848828-55848850 TGGGAGATACTTGAATCATGGGG + Intronic
1168463929 19:56587012-56587034 AGGGAGGTAACTGAATCATGGGG - Intronic
925405948 2:3605525-3605547 GGGGAGTCACGTGGTTGATGAGG + Intronic
925405966 2:3605581-3605603 GGGGAGTCACGTGGGTCCTGAGG + Intronic
925443685 2:3909606-3909628 AGGGAGGTAATTGAATCATGAGG - Intergenic
925753597 2:7111391-7111413 TGGGAGGTACTTGAATCATGGGG + Intergenic
925879586 2:8340918-8340940 TGGGAGTTAATTGAATCATGGGG + Intergenic
926307294 2:11647513-11647535 TGGGAGACAACTGAATCATGGGG + Intergenic
926700134 2:15797993-15798015 AGGAAATCACATTAATCATGTGG - Intergenic
927245531 2:20954596-20954618 TGGGAGAAACTTGAATCATGGGG - Intergenic
927438346 2:23089782-23089804 AGGGAGATAACTGAATCATGGGG - Intergenic
927461603 2:23304149-23304171 TGGGAGACAACTGAATCATGGGG - Intergenic
927723045 2:25399279-25399301 AGCGAGGCAGGTGGATCATGAGG - Intronic
928245413 2:29622484-29622506 AGGGAGGTAAGTGAATCATGGGG - Intronic
928768071 2:34671489-34671511 TGGGAGGTAAGTGAATCATGGGG - Intergenic
929087689 2:38184500-38184522 TGGGAGATAGGTGAATCATGGGG - Intergenic
929621099 2:43354829-43354851 AGGGAGGTAATTGAATCATGGGG + Intronic
930440824 2:51403402-51403424 TGGGAGACAATTGAATCATGGGG - Intergenic
930448424 2:51503742-51503764 TGGGAGGCAACTGAATCATGGGG - Intergenic
930481226 2:51951132-51951154 TGGGAGATAAGTGAATCATGGGG - Intergenic
930765037 2:55076757-55076779 TGGGAGATAAGTGAATCATGGGG + Intronic
932805609 2:74780193-74780215 TGGGAGACAATTGAATCATGGGG + Intergenic
933064043 2:77772274-77772296 TGGGAGTTAATTGAATCATGGGG - Intergenic
934054839 2:88242905-88242927 AGGGAGATAATTGAATCATGGGG + Intergenic
934107054 2:88704520-88704542 TGGGAGACAATTGAATCATGAGG - Intronic
934299456 2:91768560-91768582 AGGGAGTCACATGATCCAGGAGG - Intergenic
935038899 2:99406466-99406488 TGGGATTCACGTGAATCAGTTGG - Exonic
935150333 2:100428357-100428379 TGGGAGTTAATTGAATCATGGGG - Intergenic
935246759 2:101225539-101225561 TGGGAGGCAACTGAATCATGGGG - Intronic
936289657 2:111211736-111211758 TGGGAGACAATTGAATCATGGGG + Intergenic
936333125 2:111565452-111565474 AGGGAGGTATTTGAATCATGGGG + Intergenic
937345044 2:121120284-121120306 TGGGAGACAACTGAATCATGGGG - Intergenic
938665285 2:133528709-133528731 AGGGTAACACGAGAATCATGGGG - Intronic
939315669 2:140546621-140546643 TGGGAGGTACTTGAATCATGAGG - Intronic
940028129 2:149230198-149230220 TGGGAGGCAACTGAATCATGGGG - Intergenic
940174215 2:150860794-150860816 AGGGAGATAATTGAATCATGGGG + Intergenic
940485123 2:154288252-154288274 TGGGAGGTACTTGAATCATGGGG - Intronic
941570138 2:167160646-167160668 TGGGAGGCAATTGAATCATGGGG - Intronic
942185430 2:173420807-173420829 TGGGAGACACATGAATCATGGGG - Intergenic
943112662 2:183625025-183625047 AGGGAGGTAATTGAATCATGGGG + Intergenic
943118716 2:183707789-183707811 TGGGAGACAATTGAATCATGGGG + Intergenic
943454978 2:188094823-188094845 AGGGAGTTAATTGAATCATGGGG + Intergenic
943781753 2:191831548-191831570 AGGAAGTAGAGTGAATCATGAGG - Intergenic
943859569 2:192843767-192843789 TGGGAGACAACTGAATCATGGGG - Intergenic
944087534 2:195866845-195866867 TGGGAGGCAATTGAATCATGGGG + Intronic
945114076 2:206393727-206393749 TGGGAGGTAAGTGAATCATGGGG + Intergenic
945327643 2:208501357-208501379 AGGCAGTAACGTGAGCCATGGGG + Intronic
945472769 2:210246443-210246465 TGGGAGTTAACTGAATCATGCGG - Intergenic
946600482 2:221355146-221355168 AGGGAGATAATTGAATCATGGGG - Intergenic
946757693 2:222963680-222963702 AGGGAGGTAATTGAATCATGGGG + Intergenic
946791643 2:223306683-223306705 AGGGAGATAATTGAATCATGGGG - Intergenic
946970813 2:225089107-225089129 TGGGAGATACTTGAATCATGGGG - Intergenic
947093599 2:226541613-226541635 GTGGAGACAAGTGAATCATGGGG - Intergenic
947096486 2:226572703-226572725 TAGGAGACACTTGAATCATGGGG + Intergenic
947109885 2:226707513-226707535 TGGGAGGCAACTGAATCATGGGG - Intergenic
947327976 2:228998896-228998918 TGGGAGGCAATTGAATCATGGGG + Intronic
947801330 2:232929861-232929883 TGGGAGGCAATTGAATCATGGGG + Intronic
947893580 2:233647169-233647191 AGGGAGATAATTGAATCATGGGG - Intronic
948038195 2:234876695-234876717 TGGGAGATACTTGAATCATGGGG + Intergenic
948110818 2:235454225-235454247 AGGGACTCAGCTGAATTATGTGG + Intergenic
948262192 2:236612765-236612787 AGGGAGTCCCGTGAAACCTCGGG + Intergenic
1169488854 20:6054781-6054803 AGGAAGGCAATTGAATCATGGGG + Intergenic
1170395744 20:15923403-15923425 AGGGAGGTAATTGAATCATGGGG - Intronic
1170642356 20:18165706-18165728 AGGGAGTCCTGGGAAACATGAGG + Intronic
1170802747 20:19603910-19603932 ACAGAGACACGTGAATGATGGGG - Intronic
1171118577 20:22548701-22548723 TGGGAGGCAATTGAATCATGGGG - Intergenic
1171485081 20:25480478-25480500 AGGGGCTCCTGTGAATCATGTGG - Intronic
1172169522 20:32920656-32920678 AGGGAGGTAACTGAATCATGGGG - Intronic
1172200324 20:33121532-33121554 AGGGAGGTAATTGAATCATGGGG + Intergenic
1172756888 20:37291690-37291712 TGGGAGACAATTGAATCATGGGG + Intronic
1173045429 20:39504894-39504916 TGGGAGATAAGTGAATCATGGGG + Intergenic
1173157456 20:40626401-40626423 TGGGAGGCAATTGAATCATGTGG - Intergenic
1173264012 20:41461425-41461447 AGGGAGGTAACTGAATCATGGGG + Intronic
1173329246 20:42060498-42060520 TGGGAGGTAAGTGAATCATGGGG + Intergenic
1173537490 20:43827268-43827290 AGGGAGGTAACTGAATCATGGGG - Intergenic
1174046649 20:47738572-47738594 TGGGAGACAGTTGAATCATGGGG + Intronic
1174212147 20:48888273-48888295 AGGGAGGTAATTGAATCATGGGG - Intergenic
1174639779 20:52033805-52033827 TGGGAGGTACTTGAATCATGGGG + Intergenic
1174795300 20:53517334-53517356 AGGCAGTCACGTGAGTGAAGGGG - Intergenic
1174837957 20:53876096-53876118 AGGGAGACAAGTGAAGCAGGGGG - Intergenic
1175144187 20:56883341-56883363 TGGGAGACAATTGAATCATGGGG + Intergenic
1175492449 20:59388434-59388456 AGGGGGTCACCTCCATCATGGGG + Intergenic
1175830697 20:61964098-61964120 TGGGAGGTACCTGAATCATGGGG - Intronic
1176331447 21:5552319-5552341 ATGGAGGCAGGTGGATCATGAGG + Intergenic
1176396310 21:6268632-6268654 ATGGAGGCAGGTGGATCATGAGG - Intergenic
1176440847 21:6720472-6720494 ATGGAGGCAGGTGGATCATGAGG + Intergenic
1176465109 21:7047541-7047563 ATGGAGGCAGGTGGATCATGAGG + Intergenic
1176488670 21:7429319-7429341 ATGGAGGCAGGTGGATCATGAGG + Intergenic
1176933815 21:14843579-14843601 AGGGAGGTAATTGAATCATGGGG + Intergenic
1176935230 21:14859990-14860012 AGGGAGGTAATTGAATCATGGGG - Intergenic
1177146200 21:17410027-17410049 TGGGAGGTAAGTGAATCATGGGG - Intergenic
1177334782 21:19708602-19708624 TGGGAGGCAAGTCAATCATGGGG + Intergenic
1177539355 21:22471577-22471599 TGGGAGGCAATTGAATCATGGGG + Intergenic
1177786152 21:25673875-25673897 TGGGAGATAAGTGAATCATGAGG + Intronic
1177822428 21:26046091-26046113 TGGGAGGCAATTGAATCATGGGG - Intronic
1178094485 21:29198960-29198982 TGGGAGACACTTGAATCATGGGG - Intronic
1178216354 21:30603558-30603580 AGGGAGATAATTGAATCATGCGG + Intergenic
1178396938 21:32250928-32250950 TGGGAGGCAATTGAATCATGGGG + Intergenic
1178675621 21:34629279-34629301 TGGGAGACAGTTGAATCATGGGG - Intergenic
1178691960 21:34757611-34757633 AGGGAGTCGCATGTATCTTGGGG - Intergenic
1179043539 21:37825909-37825931 AGGGAGGTAATTGAATCATGGGG - Intronic
1179540323 21:42079477-42079499 AGGGAGGGACGTGAGGCATGAGG + Intronic
1180135370 21:45858805-45858827 TGGGAGGTAAGTGAATCATGGGG + Intronic
1181556578 22:23674923-23674945 AGGGAGTCACATGATCCAGGAGG + Intergenic
1182834656 22:33332208-33332230 TGGGAGTTAACTGAATCATGGGG + Intronic
951626472 3:24669854-24669876 AGGGAGTCACCTGAATTTTTTGG - Intergenic
951801870 3:26604860-26604882 TGGGAGACAACTGAATCATGGGG - Intergenic
952096382 3:29959857-29959879 TGGGAGACAATTGAATCATGGGG - Intronic
952208805 3:31208114-31208136 TGGGAGGCAGTTGAATCATGGGG + Intergenic
952575696 3:34772152-34772174 TGGGAGACAATTGAATCATGAGG + Intergenic
954208155 3:49076007-49076029 AAGGAGGCAGGTGGATCATGAGG + Intronic
954258234 3:49420810-49420832 AGGGGGTCACATGAATCACCTGG + Intronic
954739004 3:52731866-52731888 CGGGAGGTAAGTGAATCATGGGG + Intronic
954923141 3:54209052-54209074 TGGGAGACAAATGAATCATGGGG - Intronic
956185547 3:66559116-66559138 AGGGAGGTAATTGAATCATGGGG - Intergenic
956255193 3:67275861-67275883 ATGGAGGTAAGTGAATCATGGGG + Intergenic
956558945 3:70552201-70552223 TGGGAGATACCTGAATCATGGGG - Intergenic
957113659 3:75996257-75996279 TGGGAGGCAATTGAATCATGTGG + Intronic
957221790 3:77391581-77391603 TGGGAGTTAATTGAATCATGGGG - Intronic
957275958 3:78092202-78092224 AGGGAGGTAATTGAATCATGAGG + Intergenic
957474554 3:80706426-80706448 TGGGAGGTAAGTGAATCATGGGG - Intergenic
957608462 3:82434928-82434950 TGGGAGGCAATTGAATCATGGGG + Intergenic
957621290 3:82595997-82596019 TGGGAGGCAATTGAATCATGGGG - Intergenic
957872937 3:86111269-86111291 TGGGAGACAATTGAATCATGGGG + Intergenic
958018535 3:87969851-87969873 AGGGAGGTAATTGAATCATGGGG + Intergenic
958050405 3:88336724-88336746 AGGGAGGTAACTGAATCATGAGG - Intergenic
958887314 3:99740606-99740628 TGGGAGGTAAGTGAATCATGGGG - Intronic
959297416 3:104554693-104554715 TGGGAGGCAACTGAATCATGAGG - Intergenic
959317219 3:104823102-104823124 AGGGAGATAATTGAATCATGGGG + Intergenic
959484410 3:106910304-106910326 TGGGAGTTAATTGAATCATGGGG - Intergenic
959788964 3:110333783-110333805 TGGGAGGTAAGTGAATCATGGGG - Intergenic
959893531 3:111582803-111582825 TGGGAGGCAATTGAATCATGAGG - Intronic
959923090 3:111891314-111891336 AGGCAGTAACGTGAGTGATGGGG - Intronic
960021684 3:112962954-112962976 TAGGAGGCACTTGAATCATGGGG + Intronic
960990872 3:123310366-123310388 AGGGAGTCCAGTGGAACATGTGG + Intronic
961395526 3:126585728-126585750 AGGGAGTCACATGAATTTTTTGG + Intronic
961938006 3:130605949-130605971 TGGGAGATAAGTGAATCATGGGG - Intronic
962351223 3:134657276-134657298 AGGAAGGCAATTGAATCATGGGG - Intronic
963547864 3:146684694-146684716 GGGGAGGTAAGTGAATCATGGGG - Intergenic
963834065 3:150038491-150038513 TGGGAGACAATTGAATCATGGGG + Intronic
964420938 3:156502001-156502023 AGGGAGGTAATTGAATCATGGGG - Intronic
964510801 3:157448881-157448903 TGGGAGATACTTGAATCATGAGG + Intronic
965072818 3:163937721-163937743 AGGGAGGTAATTGAATCATGGGG - Intergenic
965101821 3:164308839-164308861 TGGGAGGCAATTGAATCATGGGG - Intergenic
966466396 3:180234990-180235012 TGGGAGTTACTTGAATCATGGGG - Intergenic
966486293 3:180474770-180474792 TGGGAGTTAATTGAATCATGGGG - Intergenic
966675052 3:182576320-182576342 TGGGAGACAATTGAATCATGAGG + Intergenic
967634029 3:191779274-191779296 TGGGAGTTAATTGAATCATGAGG + Intergenic
969969512 4:11031456-11031478 TGGGAGGCAAATGAATCATGGGG - Intergenic
970135361 4:12916072-12916094 TGGGAGTTAATTGAATCATGGGG + Intergenic
970146802 4:13044460-13044482 TGGGAGTTAATTGAATCATGGGG - Intergenic
970443556 4:16105942-16105964 AGGGAGATAATTGAATCATGGGG - Intergenic
970864770 4:20745795-20745817 AGGGAGTCAGGGGAGTCAGGAGG - Intronic
970994426 4:22249048-22249070 TGGGAGGCAATTGAATCATGAGG + Intergenic
971000947 4:22321863-22321885 GGGGAGGCAACTGAATCATGGGG + Intergenic
971119779 4:23690305-23690327 TGGGAGGTACTTGAATCATGGGG + Intergenic
971506100 4:27367993-27368015 TGGGAGAGACTTGAATCATGGGG - Intergenic
971599419 4:28573100-28573122 GGGGAGGCAATTGAATCATGGGG + Intergenic
971600047 4:28581084-28581106 GGGGAGGCAATTGAATCATGGGG + Intergenic
971792979 4:31192947-31192969 TGGGAGTTAATTGAATCATGAGG + Intergenic
971901099 4:32658702-32658724 AGGGAGCCACGTGAAATATACGG - Intergenic
971958275 4:33452168-33452190 GGGGAGGCAATTGAATCATGGGG + Intergenic
972301091 4:37786354-37786376 TGGGAGGCAATTGAATCATGGGG + Intergenic
972646110 4:40968889-40968911 TGGGAGTTAATTGAATCATGGGG + Intronic
972749224 4:41972115-41972137 TGGGAGTCATTTGAATCATAGGG + Intergenic
972913029 4:43842094-43842116 AGGGAGATAATTGAATCATGGGG - Intergenic
973039220 4:45449805-45449827 TGGGAGGTAAGTGAATCATGGGG + Intergenic
974075869 4:57168085-57168107 AGCGAGGCAGGTGGATCATGAGG + Intergenic
974095966 4:57364504-57364526 AGGGAGATAATTGAATCATGAGG + Intergenic
974178623 4:58357919-58357941 AGGGAGATAATTGAATCATGGGG - Intergenic
974485230 4:62495164-62495186 AGGGAGGTAATTGAATCATGGGG + Intergenic
974495151 4:62616332-62616354 AGGGAGGTAATTGAATCATGGGG - Intergenic
974535807 4:63173652-63173674 GGGGAGGCAATTGAATCATGGGG - Intergenic
974853664 4:67433658-67433680 TGGGAGACAATTGAATCATGGGG + Intergenic
975200612 4:71583793-71583815 TGGGAGACAACTGAATCATGGGG + Intergenic
975311865 4:72912557-72912579 AGGGAGATAATTGAATCATGGGG + Intergenic
976003467 4:80400433-80400455 GGGGAGTTAATTGAATCATGGGG + Intronic
976056957 4:81080323-81080345 TGGGAGGCAATTGAATCATGGGG + Intergenic
976057225 4:81082248-81082270 TGGGAGGCAGTTGAATCATGGGG + Intergenic
976335331 4:83878930-83878952 TGGGAGACACTTGAATCATGGGG + Intergenic
976395623 4:84551955-84551977 TGGGAGGCAACTGAATCATGGGG - Intergenic
976581201 4:86739523-86739545 TGGGAGGTAAGTGAATCATGGGG - Intronic
977303949 4:95299783-95299805 TGGGAGTTAACTGAATCATGGGG - Intronic
977314424 4:95427720-95427742 AGTGAGTCACGTGAATTTTTTGG - Intronic
977739476 4:100460631-100460653 AGGGAGGTAACTGAATCATGAGG - Intronic
978201399 4:106027537-106027559 TGGGAGGCAATTGAATCATGGGG + Intergenic
979036422 4:115725444-115725466 TGGGAGGCAGGTGGATCATGAGG - Intergenic
979233638 4:118374985-118375007 TGGGAGTTAATTGAATCATGGGG + Intergenic
979367889 4:119847505-119847527 TGGGAGATAAGTGAATCATGGGG - Intergenic
979369090 4:119862316-119862338 TGGGAGACAACTGAATCATGGGG - Intergenic
979478238 4:121183608-121183630 AGGGAGTAATGTGAGCCATGGGG - Intronic
979795215 4:124838002-124838024 AGGGAGGTAATTGAATCATGGGG - Intergenic
979907448 4:126313409-126313431 TGGGAGACAATTGAATCATGGGG - Intergenic
980215198 4:129843733-129843755 AGTGAGACATGTGAATCTTGGGG + Intergenic
980442673 4:132868444-132868466 TGGGAGTTAACTGAATCATGGGG + Intergenic
980560139 4:134461191-134461213 GGGGAGTTAATTGAATCATGTGG + Intergenic
980720273 4:136686717-136686739 AGGGAGGTAATTGAATCATGGGG - Intergenic
981343186 4:143646473-143646495 AGGGAGATAATTGAATCATGGGG + Intronic
981370255 4:143951523-143951545 AGGGAGGTAATTGAATCATGGGG + Intergenic
981807935 4:148738626-148738648 TGGGAGGCAATTGAATCATGGGG + Intergenic
981818272 4:148856245-148856267 TGGGAGGTAAGTGAATCATGGGG - Intergenic
981837543 4:149072729-149072751 TGGGAGACAATTGAATCATGGGG + Intergenic
982389230 4:154846759-154846781 TGGGAGGCAATTGAATCATGGGG + Intergenic
983096420 4:163567535-163567557 TGGGAGTTAATTGAATCATGGGG + Intronic
983431927 4:167661028-167661050 TGGGAGGCAATTGAATCATGGGG - Intergenic
983967592 4:173831950-173831972 AGGGAGGTAACTGAATCATGGGG - Intergenic
984017472 4:174442854-174442876 AGGGAGGTAATTGAATCATGAGG - Intergenic
984115535 4:175675988-175676010 CGGGAGGTAGGTGAATCATGGGG + Intronic
984227695 4:177054749-177054771 ACCGAGGCACGTGAATCACGAGG - Intergenic
984234588 4:177141140-177141162 TGGGAGATAAGTGAATCATGGGG + Intergenic
984517160 4:180754468-180754490 TGGGAGAGAAGTGAATCATGTGG - Intergenic
985133151 4:186759211-186759233 AGGGAGGTAGTTGAATCATGGGG - Intergenic
985155850 4:186986753-186986775 AGGGAGGTAACTGAATCATGGGG - Intergenic
985178777 4:187233187-187233209 AGGGAGGTATTTGAATCATGGGG + Intergenic
985291232 4:188390304-188390326 TGGGAGTTAATTGAATCATGGGG + Intergenic
985374320 4:189317850-189317872 AGGCTGTCACGCGAATCGTGTGG + Intergenic
986113795 5:4749802-4749824 AGGGAGGTAATTGAATCATGAGG - Intergenic
987037660 5:14034627-14034649 TGGGAGGTACTTGAATCATGGGG - Intergenic
987787033 5:22513711-22513733 ACTGAGGCAGGTGAATCATGAGG + Intronic
987894481 5:23926691-23926713 AGGGAGATAACTGAATCATGGGG - Intergenic
988080785 5:26411629-26411651 AGGGAGGTAATTGAATCATGGGG + Intergenic
988091028 5:26541915-26541937 TGGGAGACAATTGAATCATGGGG - Intergenic
988362772 5:30256678-30256700 TGGGAGGTACTTGAATCATGAGG - Intergenic
988928315 5:36011388-36011410 AGGGAGGTAATTGAATCATGTGG + Intergenic
989218458 5:38928595-38928617 TGGGAGGCAATTGAATCATGGGG - Intronic
989750797 5:44890703-44890725 TGGGAGGCAATTGAATCATGGGG + Intergenic
990634882 5:57713593-57713615 TGGGAGTCAATTGAATCATGGGG + Intergenic
991650410 5:68847026-68847048 AGGGAGTCACGTGGTTCTTTAGG + Intergenic
993561519 5:89416801-89416823 TGGGAGGCAATTGAATCATGGGG + Intergenic
994409811 5:99392738-99392760 TGGGAGGCAACTGAATCATGAGG - Intergenic
994649208 5:102505140-102505162 TGGGAGATACTTGAATCATGGGG + Intergenic
994853315 5:105085028-105085050 TGGGAGTTAACTGAATCATGGGG + Intergenic
995073916 5:107959014-107959036 AGGAAGTGACTTGAATCATGTGG + Intronic
995389617 5:111626082-111626104 TGGGAGGCACTTGCATCATGGGG + Intergenic
996526732 5:124488402-124488424 AGGGAGGTAATTGAATCATGGGG - Intergenic
997052268 5:130397376-130397398 AGGGAGATAACTGAATCATGGGG + Intergenic
997193466 5:131961604-131961626 AGGGAATCACTTGAACCCTGGGG + Intronic
998597254 5:143545080-143545102 AGGGAGGTAATTGAATCATGGGG - Intergenic
1000083548 5:157869340-157869362 TGGGAGTTAATTGAATCATGGGG + Intergenic
1000367989 5:160508675-160508697 AGGGAGTCATGGGAATAAGGGGG - Intergenic
1000574871 5:162965212-162965234 TGGGAGGCAGGTGGATCATGAGG - Intergenic
1000609745 5:163360719-163360741 TGGGAGGCAATTGAATCATGGGG + Intergenic
1000611103 5:163375774-163375796 TGGGAGGCAGTTGAATCATGGGG + Intergenic
1000751249 5:165098689-165098711 AGGGAGGTAAGTGAATCATGGGG - Intergenic
1000751517 5:165101020-165101042 TGGGAGTCAATTGAATCATGGGG - Intergenic
1001360744 5:171083720-171083742 TGGGAGGTAAGTGAATCATGGGG + Intronic
1001684784 5:173585322-173585344 TGGGAGTGAATTGAATCATGGGG - Intergenic
1001860591 5:175051369-175051391 TGGGAGGCAATTGAATCATGGGG + Intergenic
1002464215 5:179397627-179397649 GGGGAGGTATGTGAATCATGGGG + Intergenic
1003986496 6:11441233-11441255 AGGGAGATAATTGAATCATGGGG + Intergenic
1004192015 6:13472152-13472174 GGGGAGTTAACTGAATCATGGGG - Intronic
1005138707 6:22601448-22601470 TGGGAGGCAACTGAATCATGGGG + Intergenic
1005153463 6:22778321-22778343 AGGGAGATAAATGAATCATGAGG + Intergenic
1006062827 6:31438119-31438141 TGGGAGTTAATTGAATCATGGGG + Intergenic
1008233511 6:49014471-49014493 TGGGAGGTAAGTGAATCATGGGG - Intergenic
1008558962 6:52704630-52704652 AGGGAGTCCCGGGAAGCATAGGG + Intergenic
1008859794 6:56134674-56134696 CGGGAGGCAATTGAATCATGGGG + Intronic
1009194522 6:60668049-60668071 TGGGAGACAATTGAATCATGTGG - Intergenic
1009559632 6:65222313-65222335 TGGGAGGCAATTGAATCATGGGG + Intronic
1010010635 6:71044084-71044106 AGGGAGTCACGTGGCTGGTGAGG + Intergenic
1010525782 6:76898866-76898888 GGGGAGCCAACTGAATCATGGGG - Intergenic
1010786535 6:80008396-80008418 AAGTAGTCACGTGCATCATCTGG - Exonic
1010810685 6:80295473-80295495 TGGGAGGTAAGTGAATCATGGGG - Intronic
1010872432 6:81059244-81059266 TGGGAGGCAATTGAATCATGGGG + Intergenic
1010972449 6:82277417-82277439 TGGGAGGCAATTGAATCATGGGG - Intergenic
1011136405 6:84105510-84105532 TGGGAGGTAAGTGAATCATGGGG - Intergenic
1011284419 6:85707804-85707826 AGGGAGGTAATTGAATCATGGGG - Intergenic
1011607699 6:89120132-89120154 AGGGAGATAACTGAATCATGGGG - Intergenic
1012670782 6:102044609-102044631 TGGGAGACAATTGAATCATGTGG - Intronic
1012706687 6:102539764-102539786 AGGGAGGTAATTGAATCATGGGG + Intergenic
1012768417 6:103397962-103397984 AGGGAGTTAATTGAATCATGGGG + Intergenic
1013067728 6:106699893-106699915 AGGAAATCAAGTGAATCAAGCGG + Intergenic
1013214429 6:108014816-108014838 AGGGAGGTAATTGAATCATGGGG - Intergenic
1013559605 6:111291231-111291253 TGGGAGGCAACTGAATCATGGGG - Intergenic
1013722581 6:113048661-113048683 AGTCAGTCAAGTGAATCATGAGG - Intergenic
1015173364 6:130279274-130279296 TGGGAGGTATGTGAATCATGGGG + Intronic
1015331873 6:131989353-131989375 AGAAATTCACGTGAATAATGAGG - Intergenic
1016244719 6:141968230-141968252 TGGGAGACAATTGAATCATGGGG - Intergenic
1016285156 6:142464159-142464181 TGGGAGGCAATTGAATCATGGGG - Intergenic
1016399243 6:143660453-143660475 TGGGAGGCAATTGAATCATGGGG - Intronic
1016474612 6:144413544-144413566 TGGGAGATAAGTGAATCATGGGG - Intronic
1016643623 6:146378813-146378835 AGGGAGGTAATTGAATCATGAGG + Intronic
1016700124 6:147044929-147044951 TGGGAGACAATTGAATCATGGGG + Intergenic
1016825786 6:148387350-148387372 TGGGAGGCAGGTGGATCATGAGG - Intronic
1016868006 6:148788222-148788244 AGGGAGACAATTGAATCTTGGGG - Intronic
1016879865 6:148900388-148900410 TGGGAGGCAATTGAATCATGAGG + Intronic
1017547687 6:155469407-155469429 AGGGAGGTAATTGAATCATGGGG - Intergenic
1017666412 6:156723930-156723952 TGGGAGTTAATTGAATCATGGGG - Intergenic
1017783003 6:157731225-157731247 AGCGAGGCACGTGGATCACGAGG - Intronic
1018048902 6:159990307-159990329 TGGGAGGCAATTGAATCATGGGG + Intronic
1018349005 6:162936202-162936224 TGGGAGACAATTGAATCATGGGG - Intronic
1018396724 6:163383503-163383525 TGGGAGACAAATGAATCATGGGG + Intergenic
1018862117 6:167718666-167718688 TGGGAGACAGTTGAATCATGGGG + Intergenic
1019115396 6:169757085-169757107 GGGGAGACAGCTGAATCATGGGG - Intronic
1019934182 7:4243670-4243692 TGGGAGGTACTTGAATCATGGGG - Intronic
1019954803 7:4405197-4405219 AGGGAGGTAATTGAATCATGGGG - Intergenic
1020456136 7:8375097-8375119 TGGGAGACAATTGAATCATGGGG + Intergenic
1020584901 7:10054141-10054163 TGGGAGATACTTGAATCATGGGG + Intergenic
1020637601 7:10715240-10715262 AGGGAGATAATTGAATCATGGGG - Intergenic
1021071187 7:16243098-16243120 AGGGAGGCAATTGAAACATGGGG + Intronic
1021480056 7:21105748-21105770 TGGGAGGAAAGTGAATCATGGGG - Intergenic
1022841484 7:34168194-34168216 TGGGAGGTAAGTGAATCATGGGG + Intergenic
1023300600 7:38766661-38766683 ATGGAGATACCTGAATCATGGGG + Intronic
1023386516 7:39663078-39663100 TGGGAGACAACTGAATCATGGGG - Intronic
1023784053 7:43687927-43687949 AGGGAGGTAACTGAATCATGGGG + Intronic
1024137787 7:46428944-46428966 AGGGAGGTAATTGAATCATGGGG - Intergenic
1024157633 7:46640776-46640798 TGGGAGGCACTTGGATCATGGGG - Intergenic
1026391882 7:69910999-69911021 TGGGAGGCAAATGAATCATGGGG - Intronic
1026519518 7:71104340-71104362 TGGGAGGTACTTGAATCATGGGG + Intergenic
1026688914 7:72535546-72535568 AGAGAATCACTTGAATCAGGAGG + Intergenic
1026900282 7:74033310-74033332 AGAGAGGCACGTGAAGAATGAGG + Intronic
1027279126 7:76592943-76592965 TGGGAGGCAACTGAATCATGGGG - Intergenic
1027937684 7:84631242-84631264 TGGGAGACAACTGAATCATGAGG + Intergenic
1027996887 7:85435444-85435466 TGGGAGTTAATTGAATCATGGGG + Intergenic
1028120555 7:87052402-87052424 TGGGAGTTAATTGAATCATGGGG - Intronic
1028123076 7:87078935-87078957 TGGGAGTTAATTGAATCATGGGG - Intergenic
1028189806 7:87833401-87833423 AGGGAGTCATGGGAAATATGGGG - Intergenic
1028614021 7:92744416-92744438 TGGGAGTTAAGTGAATCATGGGG - Intronic
1029851602 7:103466981-103467003 TGGGAGGCAATTGAATCATGGGG - Intergenic
1030790748 7:113725011-113725033 TGGGAGACAATTGAATCATGGGG + Intergenic
1030791708 7:113738433-113738455 AGGGAGACTCTTGGATCATGAGG + Intergenic
1030918677 7:115351087-115351109 AGGGAGTTACTTGAATATTGGGG + Intergenic
1031257095 7:119467001-119467023 AGGGAGGTAATTGAATCATGGGG + Intergenic
1031442428 7:121811217-121811239 AGGGAGATAACTGAATCATGGGG - Intergenic
1031545622 7:123049024-123049046 TGGGAGTTAATTGAATCATGAGG - Intergenic
1032440210 7:131937002-131937024 AGGGAGGTATTTGAATCATGGGG + Intergenic
1032703938 7:134405935-134405957 AGGGAGATAATTGAATCATGGGG + Intergenic
1032810265 7:135406989-135407011 TGGGAGGCATTTGAATCATGGGG + Intronic
1032884218 7:136120802-136120824 TGGGAGGCAATTGAATCATGGGG - Intergenic
1032981784 7:137292368-137292390 TGGGAGGTAAGTGAATCATGGGG + Intronic
1033580449 7:142727799-142727821 AGGGAGGTAATTGAATCATGGGG - Intergenic
1033833849 7:145284801-145284823 TGGGAGACAATTGAATCATGGGG - Intergenic
1033859687 7:145609082-145609104 AGGGAGATAATTGAATCATGGGG + Intergenic
1034012470 7:147544730-147544752 TGGGAGACAATTGAATCATGGGG + Intronic
1034017076 7:147598761-147598783 TGGGAGTTAATTGAATCATGGGG + Intronic
1034122360 7:148639347-148639369 GGGGAGGTAAGTGAATCATGGGG - Intergenic
1034134888 7:148757913-148757935 TGGGAGACAACTGAATCATGGGG - Intronic
1034173528 7:149082112-149082134 TGGGAGGCAACTGAATCATGGGG + Intronic
1034622846 7:152469638-152469660 AGGGAGGTAATTGAATCATGGGG + Intergenic
1035138401 7:156730844-156730866 AGAGAATCACTTGAACCATGAGG + Intronic
1035271137 7:157720599-157720621 AGGGAGTCACGTGAATCATGTGG + Intronic
1035321776 7:158034385-158034407 TGGGAGGTACCTGAATCATGGGG + Intronic
1035920006 8:3666626-3666648 AGGGAGATAATTGAATCATGGGG + Intronic
1037238449 8:16749560-16749582 TGGGAGACATGTGAATCATGGGG + Intergenic
1037307624 8:17522307-17522329 TGGGAGACAACTGAATCATGGGG - Intronic
1037483911 8:19329651-19329673 TGGGAGGCAATTGAATCATGGGG + Intronic
1037564021 8:20101917-20101939 TGGGAGTTAATTGAATCATGGGG + Intergenic
1037711213 8:21356905-21356927 TGGGAGTTAATTGAATCATGGGG - Intergenic
1038631457 8:29248618-29248640 TGGGAGACAAATGAATCATGGGG - Intronic
1038863628 8:31414818-31414840 AGGCAGTAACGTGAGTGATGGGG + Intergenic
1039855329 8:41407130-41407152 AGGGAGATAATTGAATCATGGGG - Intergenic
1039902112 8:41760264-41760286 TGGGAGGTACTTGAATCATGGGG + Intronic
1040540088 8:48346055-48346077 AGGGAGGTAACTGAATCATGGGG + Intergenic
1041075129 8:54161970-54161992 AGGGAGGTAATTGAATCATGGGG + Intergenic
1041792971 8:61716387-61716409 AGGGAGGTAATTGAATCATGGGG - Intergenic
1042154241 8:65824831-65824853 AGCAAGTCACGTGAATCTTTTGG - Intronic
1042953460 8:74224648-74224670 AGGGAGGTAATTGAATCATGGGG - Intergenic
1043426420 8:80152688-80152710 AGAGAATCACTTGAATCTTGGGG + Intronic
1043663435 8:82776584-82776606 TGGGAGGCAATTGAATCATGGGG + Intergenic
1043740030 8:83800292-83800314 AGGGAGGTAATTGAATCATGGGG - Intergenic
1043805773 8:84670726-84670748 TGGGAGGCAATTGAATCATGGGG - Intronic
1044198228 8:89403455-89403477 AGGGAGATAATTGAATCATGGGG + Intergenic
1044542051 8:93419174-93419196 TGGGAGTTAATTGAATCATGGGG - Intergenic
1044750509 8:95411232-95411254 ACGGGGTCACGTGAGCCATGTGG + Intergenic
1045597070 8:103669262-103669284 GGGGAGACAACTGAATCATGGGG - Intronic
1045647612 8:104315005-104315027 TGGGAGTAAATTGAATCATGGGG + Intergenic
1045872342 8:106940898-106940920 AGGGAGGTAGTTGAATCATGGGG - Intergenic
1046391346 8:113576856-113576878 TGGGAGGCAATTGAATCATGGGG + Intergenic
1046539196 8:115557183-115557205 TGGGAGTTAATTGAATCATGGGG - Intronic
1046845101 8:118906810-118906832 TGGGAGACAATTGAATCATGGGG + Intergenic
1048668515 8:136690891-136690913 TGGGAGTTAACTGAATCATGGGG + Intergenic
1048770375 8:137888681-137888703 AGGGAGGTAATTGAATCATGGGG + Intergenic
1050236783 9:3590048-3590070 TGGGAGACAACTGAATCATGGGG + Intergenic
1050385631 9:5087368-5087390 TGGGAGGCAACTGAATCATGCGG - Intronic
1050770307 9:9190330-9190352 GGGGAGGTAAGTGAATCATGGGG + Intronic
1050809647 9:9727994-9728016 GGGGAGGCAATTGAATCATGGGG + Intronic
1050823929 9:9919553-9919575 GGGGAGTTACATGAATCATTGGG - Intronic
1051023247 9:12571235-12571257 AAGGAGACAATTGAATCATGGGG - Intergenic
1051100708 9:13517918-13517940 TGGGAGGCAATTGAATCATGAGG + Intergenic
1051424539 9:16920158-16920180 TGGGAGGCAATTGAATCATGGGG - Intergenic
1051986472 9:23095549-23095571 TGGGAGGCAATTGAATCATGGGG + Intergenic
1052156667 9:25201815-25201837 TGGGAGACAATTGAATCATGGGG - Intergenic
1052518315 9:29511399-29511421 TGGGAGTTAACTGAATCATGGGG - Intergenic
1052782427 9:32795221-32795243 TGGGAGGCAATTGAATCATGGGG - Intergenic
1054898119 9:70337083-70337105 TGGGAGGCAACTGAATCATGGGG - Intronic
1055105174 9:72504733-72504755 ATGGAGTAGCCTGAATCATGTGG + Intergenic
1056092376 9:83217487-83217509 AGGGAGGTAATTGAATCATGGGG + Intergenic
1056133426 9:83607732-83607754 AGGGAGGTAATTGAATCATGGGG + Intergenic
1056252282 9:84761945-84761967 TGGGAGGCAATTGAATCATGGGG + Intronic
1056432082 9:86537809-86537831 TGGGAGGCAATTGAATCATGGGG - Intergenic
1056957062 9:91090950-91090972 AGGTAGACAGGTGAATCCTGAGG + Intergenic
1057287182 9:93766655-93766677 AGTGAGTCACGTGAATTTTTTGG + Intergenic
1057783078 9:98065754-98065776 AGGGAGGTAGTTGAATCATGGGG + Intronic
1058174388 9:101721159-101721181 AGGGAGGTAATTGAATCATGGGG + Intronic
1058892805 9:109375247-109375269 GGGGAGACAACTGAATCATGGGG + Intergenic
1059050048 9:110914475-110914497 TGGGAGTTAATTGAATCATGGGG - Intronic
1059589842 9:115646879-115646901 TGGGAGACAATTGAATCATGAGG - Intergenic
1060021105 9:120132057-120132079 TGGGAGGCAATTGAATCATGAGG - Intergenic
1060322596 9:122578214-122578236 GGTGAGGCAGGTGAATCATGAGG + Intergenic
1060366043 9:123014963-123014985 AGGGAGGTAACTGAATCATGGGG - Intronic
1060761188 9:126250382-126250404 AGGGAGGTAATTGAATCATGGGG - Intergenic
1061294756 9:129671106-129671128 AGGGAGACACGCCCATCATGGGG - Intronic
1062540234 9:137038833-137038855 AGGGAGGAAGGGGAATCATGTGG - Intergenic
1203430652 Un_GL000195v1:88009-88031 ATGGAGGCAGGTGGATCATGAGG - Intergenic
1185708778 X:2285506-2285528 AGGCAGTCATGTGAACAATGGGG + Intronic
1185914256 X:4018005-4018027 AGGGAGGTAATTGAATCATGGGG - Intergenic
1185973904 X:4696895-4696917 TGGGAGTTAATTGAATCATGGGG - Intergenic
1186080298 X:5923683-5923705 CGGGAGGCAAGTGAATCATGGGG - Intronic
1186165161 X:6820223-6820245 AGGGAGGTAATTGAATCATGGGG - Intergenic
1186189323 X:7053442-7053464 TGGGAGACAATTGAATCATGGGG + Intronic
1186203410 X:7176771-7176793 TGGGAGGTACTTGAATCATGGGG - Intergenic
1186258063 X:7744278-7744300 TGGGAGATACTTGAATCATGGGG + Intergenic
1186267935 X:7851981-7852003 AGGGAGGTAATTGAATCATGGGG - Intergenic
1187044159 X:15629454-15629476 ATGGAGTCAGGAAAATCATGTGG - Intronic
1187214526 X:17263726-17263748 TGGGAGGCAATTGAATCATGAGG + Intergenic
1187260860 X:17683977-17683999 TGGGAGGCAATTGAATCATGGGG + Intronic
1187311868 X:18152349-18152371 AGGGAGATAAATGAATCATGGGG + Intergenic
1187438584 X:19295591-19295613 TGGGAGGCAACTGAATCATGGGG + Intergenic
1188056176 X:25543145-25543167 TGGGAGTTAATTGAATCATGGGG - Intergenic
1188393723 X:29654606-29654628 TGGGAGGCAATTGAATCATGGGG - Intronic
1188705259 X:33320395-33320417 AGTGAGTCACATGAATTATTCGG + Intronic
1189023682 X:37369740-37369762 TGGGAGGCAATTGAATCATGAGG + Intronic
1190547670 X:51545671-51545693 TGGGAGGTAAGTGAATCATGGGG - Intergenic
1191678970 X:63822079-63822101 AGGGAGGTAATTGAATCATGGGG - Intergenic
1191679859 X:63829994-63830016 AGGGAGGTAATTGAATCATGGGG + Intergenic
1193506413 X:82349644-82349666 AAGGAGGCAATTGAATCATGGGG - Intergenic
1194097193 X:89656394-89656416 TGGGAGGCAATTGAATCATGAGG + Intergenic
1194323018 X:92476051-92476073 AGGGAGGTAACTGAATCATGGGG + Intronic
1194920467 X:99758869-99758891 AGGGAGGTAATTGAATCATGGGG + Intergenic
1196503469 X:116412082-116412104 TGGGAGTTAATTGAATCATGGGG + Intergenic
1196558510 X:117120242-117120264 AGGGAGGTAATTGAATCATGGGG - Intergenic
1197094423 X:122575838-122575860 TGGGAGACAATTGAATCATGGGG - Intergenic
1197249314 X:124198386-124198408 TGGGAGACAATTGAATCATGGGG - Intronic
1197464412 X:126784973-126784995 GGGGAGGTACTTGAATCATGGGG + Intergenic
1197921427 X:131598718-131598740 TGGGAGGCAATTGAATCATGGGG - Intergenic
1198083667 X:133263278-133263300 TGGGAGACAATTGAATCATGTGG - Intergenic
1199020180 X:142869485-142869507 CGGGAGTTAATTGAATCATGGGG + Intergenic
1199226613 X:145383303-145383325 TGGGAGACAATTGAATCATGGGG + Intergenic
1199309698 X:146308287-146308309 TGGGAGACAATTGAATCATGGGG + Intergenic
1199943117 X:152643055-152643077 AAGGAGTTGCCTGAATCATGCGG + Intronic
1200450213 Y:3317771-3317793 TGGGAGGCAATTGAATCATGAGG + Intergenic
1200631119 Y:5589211-5589233 AGGGAGGTAACTGAATCATGGGG + Intronic
1201439349 Y:13991692-13991714 AGGGAGGTAATTGAATCATGGGG + Intergenic
1201445224 Y:14051016-14051038 AGGGAGGTAATTGAATCATGGGG - Intergenic
1201625095 Y:16006231-16006253 TGGGAGGCAATTGAATCATGTGG - Intergenic
1201927928 Y:19310488-19310510 TGGGAGACAACTGAATCATGAGG - Intergenic
1201990018 Y:20013684-20013706 TGGGAGTTAATTGAATCATGGGG + Intergenic
1201990234 Y:20015613-20015635 TGGGAGACAATTGAATCATGGGG + Intergenic