ID: 1035272362

View in Genome Browser
Species Human (GRCh38)
Location 7:157728003-157728025
Sequence CCCACAGACGTCTGCAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 149}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035272362_1035272376 24 Left 1035272362 7:157728003-157728025 CCCACCCTGCAGACGTCTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1035272376 7:157728050-157728072 GAGGCCCAGAGGGGCTCCTGAGG No data
1035272362_1035272377 25 Left 1035272362 7:157728003-157728025 CCCACCCTGCAGACGTCTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1035272377 7:157728051-157728073 AGGCCCAGAGGGGCTCCTGAGGG 0: 1
1: 0
2: 4
3: 50
4: 317
1035272362_1035272369 5 Left 1035272362 7:157728003-157728025 CCCACCCTGCAGACGTCTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1035272369 7:157728031-157728053 CCTCTCCCGTCTACACCTGGAGG 0: 1
1: 0
2: 8
3: 22
4: 103
1035272362_1035272374 15 Left 1035272362 7:157728003-157728025 CCCACCCTGCAGACGTCTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1035272374 7:157728041-157728063 CTACACCTGGAGGCCCAGAGGGG 0: 1
1: 1
2: 1
3: 38
4: 481
1035272362_1035272372 13 Left 1035272362 7:157728003-157728025 CCCACCCTGCAGACGTCTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1035272372 7:157728039-157728061 GTCTACACCTGGAGGCCCAGAGG No data
1035272362_1035272373 14 Left 1035272362 7:157728003-157728025 CCCACCCTGCAGACGTCTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1035272373 7:157728040-157728062 TCTACACCTGGAGGCCCAGAGGG No data
1035272362_1035272367 2 Left 1035272362 7:157728003-157728025 CCCACCCTGCAGACGTCTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1035272367 7:157728028-157728050 CTGCCTCTCCCGTCTACACCTGG 0: 1
1: 0
2: 4
3: 30
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035272362 Original CRISPR CCCACAGACGTCTGCAGGGT GGG (reversed) Intronic
900109980 1:1001326-1001348 CCCAAAGGCTTCTGCGGGGTGGG + Intergenic
900244262 1:1630280-1630302 CTCAGAGCCGTCTGCGGGGTGGG - Exonic
900488225 1:2933544-2933566 CCCGCAGACCCCTGTAGGGTGGG + Intergenic
900488235 1:2933575-2933597 CCCGCAGACCCCTGCAGGGTGGG + Intergenic
900997108 1:6128643-6128665 ACCACAGAGGGCTGCAGGGTTGG + Intronic
903022847 1:20406032-20406054 CCCACAGGTGTCTGCAGGGAGGG + Intergenic
903467411 1:23561410-23561432 GCCACAGAAGTCTGCAAGATAGG - Intergenic
904607205 1:31704363-31704385 CCCCCAGAAGGCTGCGGGGTGGG + Intergenic
904953212 1:34261179-34261201 CCCCAAGTCCTCTGCAGGGTTGG - Intergenic
906545111 1:46615016-46615038 CCCAAAGAAGTCCCCAGGGTGGG + Exonic
908777895 1:67659378-67659400 CCCACAGAAGTATGCTGTGTGGG - Intergenic
909793730 1:79706014-79706036 GCCACAGCCCTCTGCAGAGTAGG + Intergenic
910730550 1:90391414-90391436 CCTGCAGACATCTTCAGGGTAGG + Intergenic
912518477 1:110230184-110230206 CCCACAAACCACTGCAGGGTGGG - Intronic
913264979 1:117034997-117035019 CCCTCATACGCCTGCAGGGCTGG + Intronic
914456977 1:147845420-147845442 CCCACACACAGCTGCATGGTTGG - Intergenic
916530383 1:165651110-165651132 ACCAAAGACATCTGCAGAGTGGG + Intronic
920439425 1:205969322-205969344 TCCCCAGACGTTTGCAGGCTTGG - Intergenic
921932773 1:220768855-220768877 GCCACAAACGCCTGCAGGGAGGG - Intronic
922528027 1:226321297-226321319 CCCACAGACCTCTGTAGCGAGGG - Intergenic
1062984287 10:1753168-1753190 TCCACAGAAGTAGGCAGGGTAGG + Intergenic
1065804415 10:29381710-29381732 CACACAGTTTTCTGCAGGGTAGG + Intergenic
1065944770 10:30596325-30596347 CACACAGTTTTCTGCAGGGTAGG - Intergenic
1067049082 10:43001635-43001657 CCCACAGGCTCCTGCATGGTGGG + Intergenic
1067546691 10:47196985-47197007 ACCACAGTCCTCTGCAGGGTGGG + Intergenic
1069562042 10:69437488-69437510 TCCACAGACGTCAGGTGGGTAGG + Intergenic
1070156682 10:73839760-73839782 CCCCCAGACTGCTGCAGGGCTGG - Intronic
1070546547 10:77457290-77457312 CAGGCAGAAGTCTGCAGGGTGGG + Intronic
1074055797 10:109922441-109922463 CCCACATACTTCCACAGGGTGGG + Intronic
1074299569 10:112221331-112221353 CCCACAGCCATCTGGAGGATTGG - Intergenic
1075246086 10:120823279-120823301 CCCAGAGGCCTCTGCAGGGCTGG - Intergenic
1075879763 10:125840682-125840704 CCCACAGGCATCTGCAGAGTGGG - Intronic
1077323019 11:1950820-1950842 CACTCGGAGGTCTGCAGGGTTGG + Intronic
1080647672 11:34198656-34198678 CCCACAGACTCCAGCAGGGCAGG - Intronic
1083702780 11:64490703-64490725 CACACAGACGGCTGCAGGTGTGG - Intergenic
1084556265 11:69878091-69878113 AGCACAGAGGGCTGCAGGGTTGG + Intergenic
1084948042 11:72649538-72649560 CCCAGGGACGTCTGGAAGGTGGG + Intronic
1084954177 11:72682836-72682858 TCCTCAGAACTCTGCAGGGTAGG + Intergenic
1202806004 11_KI270721v1_random:6015-6037 CACTCGGAGGTCTGCAGGGTTGG + Intergenic
1091427195 12:401470-401492 CCCAGAGACCTCTGCGCGGTCGG + Intronic
1092755528 12:11759633-11759655 ACCACAGACGTATTGAGGGTTGG - Intronic
1104159895 12:126168193-126168215 CCCACACCCTCCTGCAGGGTTGG + Intergenic
1104440737 12:128791411-128791433 CACACCGACGTCTTCAGGGCAGG + Intergenic
1104779066 12:131408174-131408196 CCCACAGTCCCGTGCAGGGTTGG - Intergenic
1117802656 14:59461260-59461282 CCCACAGAAGTCTACAGGTAAGG - Exonic
1119043602 14:71297514-71297536 CCCACAGACATCAGGAGAGTGGG + Intergenic
1120905504 14:89617798-89617820 TGCACAGATTTCTGCAGGGTCGG - Intronic
1122265137 14:100543085-100543107 CCCACGGATGTCTGCATGGCTGG + Intronic
1122361474 14:101169391-101169413 CCCATTGACATCAGCAGGGTGGG + Intergenic
1124467653 15:29952961-29952983 GCCACAGAAGTCTGAAGGGAAGG - Intronic
1124822516 15:33061061-33061083 CCCACAGATGGCTGTGGGGTGGG + Intronic
1127626253 15:60782952-60782974 CCCAGAGAAGGCTGCTGGGTCGG - Intronic
1132840710 16:1977344-1977366 CCCTCAAATGTCTGCAAGGTGGG - Exonic
1136375014 16:29860310-29860332 GCCAGAGAGGTCTGCAGGGCTGG - Intronic
1137235505 16:46613701-46613723 CGCACAGATGTCTGCATGATTGG - Intronic
1137246841 16:46712666-46712688 CCCACAGACATGTGGAGTGTGGG - Exonic
1138428320 16:56951263-56951285 CCCACTGAGGCCTGCAGGGAAGG + Intergenic
1138525950 16:57607351-57607373 GCCCCAGGCGACTGCAGGGTTGG - Intergenic
1139012998 16:62656469-62656491 CTCACATACATGTGCAGGGTAGG - Intergenic
1139426211 16:66881261-66881283 CGCACCGACTTCTGCGGGGTGGG + Intronic
1139530645 16:67540989-67541011 ATCACAGAGGTCTGCATGGTAGG - Intronic
1139914729 16:70421034-70421056 CCCAAAGCCACCTGCAGGGTTGG - Intronic
1141104860 16:81225166-81225188 GCCACAGATGTCTGCATGGCAGG - Intergenic
1141255858 16:82401900-82401922 CCCCCAGATATCTGCAGGGCTGG - Intergenic
1141300452 16:82810708-82810730 CCCACAGCTGACTGAAGGGTTGG - Intronic
1141561145 16:84868474-84868496 CCCACAGGGCTCTGCAGGGCAGG - Intronic
1141952926 16:87350605-87350627 TCCACAGATGGCTGCAGGGATGG + Intronic
1144148898 17:12424301-12424323 CCAGCTGACCTCTGCAGGGTAGG - Intergenic
1146494793 17:33312001-33312023 CCCAGAGACCACTGCAGGGTTGG - Intronic
1147992725 17:44345008-44345030 CCCCCAGGCGCCTGCAGGATGGG + Intergenic
1148079152 17:44957951-44957973 ACATCAGGCGTCTGCAGGGTTGG + Intergenic
1149303897 17:55330440-55330462 CCCACAGGCGACAGCATGGTAGG + Intergenic
1152253756 17:79225677-79225699 CCCACAGACCCCAGCTGGGTAGG + Intronic
1155908301 18:31478800-31478822 TCCACAGACGGCGGCAGGGATGG + Intergenic
1160038188 18:75320533-75320555 CCAACAGAGGGCAGCAGGGTGGG + Intergenic
1160237097 18:77094354-77094376 ACCACACAAGTCAGCAGGGTGGG + Intronic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160799493 19:961151-961173 CCCACAGAGGTCGGAAGGGGTGG + Intronic
1161905374 19:7152613-7152635 CCCAGAGACGGCAGAAGGGTGGG - Intronic
1162657142 19:12139930-12139952 CCCAGAGAGGGCTCCAGGGTCGG + Intronic
1163008925 19:14412796-14412818 GCCACAGACACCTGCAGGGCTGG + Intronic
1163493866 19:17633268-17633290 CCCACAGAGGAGTGTAGGGTAGG + Intronic
1164077754 19:21835817-21835839 CCCACAGAGGGCTGCAGGCCGGG + Intronic
1164484045 19:28639568-28639590 CTCACAGACATCTGCTGGGGTGG + Intergenic
1164547769 19:29183431-29183453 GCCACAGACGGCTGCACTGTCGG - Intergenic
1164676489 19:30104888-30104910 CCCACAGAGCTCTACATGGTGGG + Intergenic
1166669571 19:44701683-44701705 CCCAGAGAGGTTTTCAGGGTGGG + Intronic
1166731330 19:45060648-45060670 CCCCCAGATGCCAGCAGGGTGGG - Intronic
925825628 2:7846108-7846130 CCCAGAGAGGTCAGCAGTGTGGG + Intergenic
926144159 2:10386658-10386680 ACCACAAAGGTCTGCAGGCTGGG + Intronic
929889418 2:45906807-45906829 GCCCCAGGCCTCTGCAGGGTAGG - Intronic
932655961 2:73611326-73611348 CCCACAGAACTGTGCAGTGTGGG - Intergenic
937379453 2:121363353-121363375 CACACAGCAGTCAGCAGGGTCGG + Intronic
937403446 2:121605948-121605970 CCCAGATACGTCTGCTGGGAGGG - Exonic
942567327 2:177280087-177280109 CCCCCAGACATCAGCAGGGCTGG + Intronic
947057188 2:226118599-226118621 CCCACAGACATCTGCGGGTGAGG - Intergenic
948116142 2:235495147-235495169 CCCCCAGGCGTCTGCTGGGCCGG - Intronic
948973476 2:241447768-241447790 CCCACACACGCCTGCGGGGGTGG + Intronic
1168831627 20:848299-848321 TCCACAGAGGCCTGCAGGGAAGG - Intronic
1169859007 20:10132391-10132413 CCTCCAGACATCTTCAGGGTAGG - Intergenic
1171411023 20:24949200-24949222 CCCACAGTGGTTTGCAGGGTGGG + Intergenic
1172845216 20:37926020-37926042 CCCACAGGACTCTGCAAGGTTGG + Intronic
1175548433 20:59797634-59797656 GCCACAGACTTCTGCAGACTAGG - Intronic
1175605689 20:60310627-60310649 CCAACAGATCTCTGCAGTGTAGG - Intergenic
1175819392 20:61900480-61900502 CCCAGAGACGGCTGCAGAGGGGG + Intronic
1175877550 20:62237543-62237565 CCCACAGACCTCTCCAGAGCTGG - Intronic
1175908450 20:62393203-62393225 CCCACAGATGACTCCAGGGAGGG - Intronic
1176390131 21:6158998-6159020 CCCAGAGACCTCTGCAGCGGGGG + Intergenic
1176418982 21:6499219-6499241 CCCGCGGGCGTCGGCAGGGTCGG - Intergenic
1177629997 21:23714483-23714505 CCCACAGCAGTGTGCAGGGGTGG + Intergenic
1179176011 21:39008854-39008876 CACACAGACGGGAGCAGGGTCGG - Intergenic
1179733335 21:43379242-43379264 CCCAGAGACCTCTGCAGCGGGGG - Intergenic
1183412160 22:37661165-37661187 TCCACAGACGCCTGCAAGGCAGG - Intronic
1183620133 22:38967285-38967307 CCCACACATTTCTGCAGGGCTGG + Intronic
1183748518 22:39705893-39705915 TCCCCAGACGTCTGCAGGGCGGG + Intergenic
949649499 3:6139594-6139616 CTCACAGAAATCTTCAGGGTGGG - Intergenic
950569609 3:13791951-13791973 CCCACAGAAGTCAGCAGGCTGGG - Intergenic
952423607 3:33152941-33152963 CCCACACACGACTCCAAGGTGGG + Exonic
954713258 3:52515182-52515204 CCCATAGAGGTCTGGAGGGCTGG + Intronic
956669471 3:71672805-71672827 TCCACACACGTCTTCTGGGTTGG + Intergenic
960144967 3:114191349-114191371 CCCACTGACCTTTGCATGGTTGG - Intronic
961570757 3:127797020-127797042 CCCACGGAGCTCTGCAGAGTGGG - Intronic
962344017 3:134606766-134606788 CCCATAGAGGTCTGCAGGGGTGG - Intronic
962977949 3:140462743-140462765 CCCACATGGGTCTGGAGGGTAGG + Intronic
968656605 4:1781037-1781059 CCAAGACACATCTGCAGGGTGGG + Intergenic
968660240 4:1795785-1795807 CCCCCAGACCCCTGCTGGGTGGG - Intronic
971128804 4:23783066-23783088 CCCACATACCTCTGCATGGCCGG - Intronic
978149448 4:105415532-105415554 CCCACCCACCTCTGCAGGCTCGG - Intronic
981779617 4:148412218-148412240 CCCACTGATGTCTGCAGCGGAGG - Intronic
985221582 4:187711645-187711667 CCCACAGGCCACTGCAGAGTTGG - Intergenic
985936732 5:3103159-3103181 CCCCCATCCATCTGCAGGGTGGG + Intergenic
988098339 5:26646071-26646093 CAGACAGACCTCAGCAGGGTAGG - Intergenic
995301259 5:110585950-110585972 CTCACAGAAGTTTGCAGGTTTGG + Intronic
997650310 5:135512602-135512624 CCTACAGCCTTCAGCAGGGTAGG + Intergenic
997973873 5:138426933-138426955 CCCACAAACATCTGCTGGTTTGG - Intronic
1000342581 5:160289152-160289174 CCCACAGGAGGCTGCTGGGTAGG - Intronic
1001657206 5:173360788-173360810 CTCACAGACATATGCAGGGAAGG - Intergenic
1001692999 5:173646727-173646749 ACCACAGAAGCCTGCATGGTGGG - Intergenic
1005599019 6:27407339-27407361 CCCACACACAGCTGCAGGGCTGG + Intergenic
1018903839 6:168064002-168064024 TCCTCAGACGTCTGCAGGTGGGG + Intronic
1020073105 7:5240382-5240404 CCCGCAGATGTCTGCACAGTTGG - Intergenic
1020115882 7:5476142-5476164 ACCACCGACGGCTGCAGGGGAGG + Intronic
1020405460 7:7828556-7828578 CACACAGAAGTCAGCAGGGATGG - Intronic
1022411535 7:30142062-30142084 CCCAAAAATGTCTGTAGGGTTGG + Intronic
1022968796 7:35498300-35498322 TCAACAGACGTCTCCAAGGTGGG + Intergenic
1023030172 7:36084217-36084239 CCCACAGTCGTCTGGGGGTTAGG + Intronic
1026439994 7:70435842-70435864 CCCACACACAGCTGCAGGGTAGG + Intronic
1029048857 7:97661806-97661828 CCAACAGACAACTGCAAGGTGGG + Intergenic
1032196316 7:129790862-129790884 CCCTCAGATCTCTGAAGGGTGGG + Intergenic
1034592554 7:152154506-152154528 TTCACAGATGTCAGCAGGGTTGG - Intronic
1035272362 7:157728003-157728025 CCCACAGACGTCTGCAGGGTGGG - Intronic
1038779186 8:30556356-30556378 CGCACAGGTGCCTGCAGGGTTGG - Intronic
1039348418 8:36733965-36733987 CCTACAGGTGTCAGCAGGGTTGG - Intergenic
1046024876 8:108710670-108710692 CCCACACACAGCTGCACGGTTGG + Intronic
1046973740 8:120250625-120250647 CCCACAAACGTTTCCAGTGTTGG - Exonic
1047539047 8:125746371-125746393 CCCACTGATGTCTTCAGGGTGGG - Intergenic
1049038935 8:140098100-140098122 TCCACAGCTATCTGCAGGGTAGG + Intronic
1049629303 8:143643901-143643923 GCTACAGACTTCTGCAGGGTAGG + Intronic
1059245539 9:112846699-112846721 CCCACAGAGAACTGCAGGATGGG - Intronic
1060670671 9:125466683-125466705 CTCACAGCCTTTTGCAGGGTCGG + Intronic
1062427481 9:136512607-136512629 CCCAGAGACCCCAGCAGGGTGGG + Intronic
1185455027 X:305044-305066 CCCACAGAGGCCTGCGGGGTGGG - Exonic
1189203753 X:39220078-39220100 CCCTCTGAAGTCTCCAGGGTAGG + Intergenic
1192131880 X:68559326-68559348 CACACAGAAGTCTGCAGCCTGGG - Intergenic
1197849354 X:130841159-130841181 CACACACACATTTGCAGGGTGGG + Intronic