ID: 1035273676

View in Genome Browser
Species Human (GRCh38)
Location 7:157734706-157734728
Sequence ATTTCGAAGCCAAATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035273676_1035273678 16 Left 1035273676 7:157734706-157734728 CCATTCTCATTTGGCTTCGAAAT 0: 1
1: 0
2: 0
3: 12
4: 223
Right 1035273678 7:157734745-157734767 TACAATAACCTGGAACTGTAAGG 0: 1
1: 0
2: 0
3: 8
4: 102
1035273676_1035273680 23 Left 1035273676 7:157734706-157734728 CCATTCTCATTTGGCTTCGAAAT 0: 1
1: 0
2: 0
3: 12
4: 223
Right 1035273680 7:157734752-157734774 ACCTGGAACTGTAAGGGTCCTGG No data
1035273676_1035273677 6 Left 1035273676 7:157734706-157734728 CCATTCTCATTTGGCTTCGAAAT 0: 1
1: 0
2: 0
3: 12
4: 223
Right 1035273677 7:157734735-157734757 ACAAAACTGTTACAATAACCTGG 0: 1
1: 0
2: 0
3: 20
4: 183
1035273676_1035273679 17 Left 1035273676 7:157734706-157734728 CCATTCTCATTTGGCTTCGAAAT 0: 1
1: 0
2: 0
3: 12
4: 223
Right 1035273679 7:157734746-157734768 ACAATAACCTGGAACTGTAAGGG No data
1035273676_1035273683 25 Left 1035273676 7:157734706-157734728 CCATTCTCATTTGGCTTCGAAAT 0: 1
1: 0
2: 0
3: 12
4: 223
Right 1035273683 7:157734754-157734776 CTGGAACTGTAAGGGTCCTGGGG 0: 1
1: 0
2: 0
3: 12
4: 235
1035273676_1035273682 24 Left 1035273676 7:157734706-157734728 CCATTCTCATTTGGCTTCGAAAT 0: 1
1: 0
2: 0
3: 12
4: 223
Right 1035273682 7:157734753-157734775 CCTGGAACTGTAAGGGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035273676 Original CRISPR ATTTCGAAGCCAAATGAGAA TGG (reversed) Intronic
904459430 1:30666979-30667001 ATTTCCAAGACCAATTAGAAGGG + Intergenic
905624835 1:39482447-39482469 ATTTCAAAGAAAAATTAGAATGG + Intronic
907954459 1:59214996-59215018 TTTTCAAAACCAAATTAGAAGGG + Intergenic
908329287 1:63054764-63054786 AGTTCTAAGCCAGTTGAGAAAGG + Intergenic
908498812 1:64722436-64722458 CACTCGAAGCCAAATGAGAGAGG + Intergenic
910684787 1:89905150-89905172 TTTTCTAAGCCAAATGACACAGG - Intronic
911525610 1:98981766-98981788 ATTTTGAACCCATATGATAAGGG + Intronic
911875761 1:103160906-103160928 AATTGGAAGCCAAAGGAAAAGGG + Intergenic
912909912 1:113747790-113747812 ATTTGGAAGCTAAAAGATAATGG - Intronic
913468080 1:119163662-119163684 ATCTACAAGCCAAATGAGAGAGG + Intergenic
913718784 1:121569156-121569178 CTTTCTAAGACAAATGACAAAGG - Intergenic
917630918 1:176890624-176890646 ATTTTCAATCCAAAAGAGAAAGG + Intronic
918336870 1:183524491-183524513 ATTTCCATGCCCAGTGAGAAAGG + Intronic
921153860 1:212422964-212422986 CTTTCAGAGCCAAATGAGCAAGG - Intergenic
923192520 1:231633515-231633537 ATGTGGAAGCCCAATGAGCAGGG - Intronic
1064782555 10:18858391-18858413 TTGTGGAAGCCAAATTAGAATGG + Intergenic
1065054461 10:21829908-21829930 ACTTCCAAGCCAATTGAGAGAGG - Intronic
1066186836 10:33018116-33018138 AGTTTAAAGCCAAATGATAAGGG - Intergenic
1067919333 10:50437319-50437341 ACTTGGAAGCAAAATGAGAGTGG + Intronic
1068509775 10:57950513-57950535 ATTTCAAAGCCAATTCACAAAGG + Intergenic
1068542275 10:58308521-58308543 ATTTTCAAGGCAAATAAGAAAGG + Intergenic
1070432572 10:76355944-76355966 ATTTGGAAACCCAATTAGAAGGG + Intronic
1071883643 10:89926759-89926781 AATGCAAAGCCAAAGGAGAAAGG - Intergenic
1072476536 10:95766623-95766645 ATATATCAGCCAAATGAGAAGGG - Intronic
1072529281 10:96303455-96303477 ATTGTTTAGCCAAATGAGAAAGG + Intergenic
1074861936 10:117516823-117516845 CTGTCGAACCCTAATGAGAATGG + Intergenic
1074875611 10:117610874-117610896 ATTTCAAGGCCAAATGGAAATGG + Intergenic
1076639691 10:131905927-131905949 CTTTTGAAGGCAAATGAAAATGG + Intronic
1078558842 11:12353407-12353429 ATTTAGAAGCCAAACAAAAAAGG - Intronic
1079290309 11:19182301-19182323 ATTTGGATGTCAACTGAGAAAGG - Exonic
1080244795 11:30167718-30167740 ATTTCAAAGCCAAATTAAAATGG + Intergenic
1081584522 11:44375384-44375406 ATTTATAAGGGAAATGAGAAAGG + Intergenic
1083488742 11:62999623-62999645 ATCCAGAAGCCAAAAGAGAATGG - Intronic
1084910733 11:72386769-72386791 ATTTCAAAGAGAAATGAGAAGGG + Intronic
1087359867 11:97144688-97144710 ATTTCTAAGAGATATGAGAAAGG + Intergenic
1089535021 11:119155685-119155707 ATTTCGAGGACAAGTCAGAAAGG - Intronic
1091252749 11:134157276-134157298 TTTTTGAATCCTAATGAGAATGG - Intronic
1092986815 12:13853782-13853804 ATTTTAAACCCAAATGAAAATGG - Intronic
1093110611 12:15147367-15147389 CTTTACAAGCCAAATGAGATGGG + Intronic
1093745151 12:22731740-22731762 ATGTCAAAGACAAATGAGGAGGG + Intergenic
1095193230 12:39283141-39283163 AGTTGGAAGTCAAGTGAGAAAGG + Intergenic
1096442524 12:51656317-51656339 TTTTCAAAACTAAATGAGAAAGG + Intronic
1096879288 12:54654378-54654400 GTTTAGAAGCCAGACGAGAATGG - Intergenic
1098017834 12:66125182-66125204 ATGTAGAAGATAAATGAGAAGGG + Intronic
1099057360 12:77860747-77860769 ATTTTAAAGCCAAATGGGCAGGG + Intronic
1100156117 12:91802333-91802355 ATTTCTAAGGCAAATCACAAAGG + Intergenic
1100459768 12:94787888-94787910 ATTTCCAAGGAAAGTGAGAAAGG - Intergenic
1101957490 12:109223796-109223818 ATTTCTAAGGGAAATGAAAAGGG - Exonic
1104268304 12:127259052-127259074 ATTGTGAAGCAAAAGGAGAAAGG + Intergenic
1106843546 13:33712268-33712290 AAGTAGAAGCCAAATGACAAAGG - Intergenic
1107779437 13:43882076-43882098 AATTAGAAGCCAAATAACAAGGG + Intronic
1108094137 13:46882561-46882583 ATTCAGAAGCCATAAGAGAAAGG + Intronic
1109060361 13:57610431-57610453 ATTTACAAGAGAAATGAGAAAGG + Intergenic
1109205551 13:59478962-59478984 TTTTAGAAGTCTAATGAGAAAGG + Intergenic
1109858413 13:68164633-68164655 ATTTGGAAGCAAAATAATAAAGG + Intergenic
1110844855 13:80182657-80182679 TTTTGGAAACCAAATGATAACGG + Intergenic
1112767222 13:102758365-102758387 ATTTTGAAGCTAAATGAAATAGG - Intronic
1112859866 13:103817518-103817540 ATTTGGAAGCCAGAAGAGATGGG - Intergenic
1114915741 14:27262826-27262848 ATTTGTTAGACAAATGAGAAGGG - Intergenic
1115779719 14:36756103-36756125 ACTCCCAAGGCAAATGAGAATGG - Intronic
1116276970 14:42847571-42847593 ATTTTGAAGTCAAAGGAGAGAGG - Intergenic
1116315360 14:43382603-43382625 ATTTCGAAGTAGAATAAGAAAGG - Intergenic
1117109993 14:52442560-52442582 AATTAGAAGAAAAATGAGAATGG - Intronic
1117327165 14:54679960-54679982 ATTTGGAAGCCAAATGATCGTGG + Intronic
1117995445 14:61473554-61473576 ATTTGGAAGCCTAAAGAGAATGG + Intronic
1118603612 14:67487477-67487499 AATTTGAAGCTGAATGAGAATGG - Intronic
1118632461 14:67718251-67718273 TTTTGGAAGCCAGATGAGACAGG - Intronic
1118707715 14:68495359-68495381 ATTTCAAAGCCAAAAGCAAAGGG - Intronic
1126233606 15:46355436-46355458 ATTACGCACACAAATGAGAAAGG + Intergenic
1126645568 15:50871799-50871821 GTTAAAAAGCCAAATGAGAAAGG - Intergenic
1129735940 15:77963502-77963524 ATTTTGAAGACAAAACAGAAAGG + Intergenic
1133273518 16:4623397-4623419 CTTGGGAAGCCAAATGAGTACGG - Intronic
1133588675 16:7220941-7220963 ATTTCAAAGACTGATGAGAAAGG + Intronic
1133942534 16:10322335-10322357 CTTTCGAAGCCTTATTAGAAGGG - Intergenic
1138784011 16:59824331-59824353 ATTTGGAATCAAAATGACAAGGG + Intergenic
1138937220 16:61742418-61742440 ATTTGGAATCTAAGTGAGAAAGG + Intronic
1140130793 16:72159026-72159048 CTTACAAAGCCAAAAGAGAAAGG - Intronic
1140503493 16:75454845-75454867 ATTTGGAAGTCAAATGTGCATGG + Intronic
1141260168 16:82445661-82445683 ATTTCCTATCCATATGAGAAAGG - Intergenic
1141386367 16:83625622-83625644 TTTTCGAAGCCAAAAGAGGGAGG - Intronic
1144005511 17:11095845-11095867 ATATTGAAGCCAAATGGGCAGGG + Intergenic
1149355535 17:55835400-55835422 ATTTTTAAGCCAAAGGTGAATGG - Intronic
1149960040 17:61098737-61098759 ATTTCTTTGCCAAATGAAAACGG + Intronic
1151563746 17:74885445-74885467 ATTCTGAAGCCAGATGTGAAGGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152599657 17:81255682-81255704 TTTTTGAAGCCAAATGAGGGAGG - Intronic
1153132572 18:1873281-1873303 ATTTCAAAGTTAAATAAGAATGG - Intergenic
1155135925 18:22992607-22992629 ATTTAGATGACAAAAGAGAAGGG - Intronic
1155370720 18:25097568-25097590 ATTTCTACGCCACATGAGAGAGG + Intronic
1156631651 18:38976518-38976540 ATTTCCAAGCCTAATGATAATGG - Intergenic
1156980135 18:43277113-43277135 ATTTAAAAGGAAAATGAGAATGG - Intronic
1157090415 18:44630331-44630353 ATTGGGAAGACAAAAGAGAAGGG - Intergenic
1159454267 18:68640955-68640977 ATTTGGAAACCCAATGACAATGG - Intergenic
928183805 2:29091285-29091307 ATTGCGAAGAGAAATGTGAATGG - Intergenic
928798240 2:35052305-35052327 ACTTAGAAGCCAGAAGAGAATGG - Intergenic
929840605 2:45458534-45458556 ATTTTGAAGCCAAGTGTGAAAGG - Intronic
931009967 2:57899518-57899540 ATTTCTAAGCAAGATGAAAAAGG + Intergenic
931039580 2:58282550-58282572 ATCTAGAAGCCAAAAGAGGAAGG - Intergenic
933141941 2:78802113-78802135 ATTTTGAAAACAAATGAGGAAGG - Intergenic
935431714 2:102983180-102983202 AGCTCAAAGCCAAAAGAGAATGG + Intergenic
935490087 2:103708674-103708696 ATTTCCAAGGCCAATGAGATGGG + Intergenic
937504310 2:122519496-122519518 ATTTGGAAGACAAAGGAGCAAGG + Intergenic
939164787 2:138628763-138628785 TTTGGGAAGACAAATGAGAAGGG - Intergenic
939577793 2:143917097-143917119 ATTTAGAAGCCAACTTAAAAGGG - Intergenic
941238620 2:163009222-163009244 ATTTACAAGCCCAATAAGAAGGG - Intergenic
941775087 2:169384682-169384704 ATTGAGGAGCCAAATGAGTAAGG - Intergenic
942277759 2:174335325-174335347 TTTTTGAAACCAAATGAAAAAGG - Intronic
943172897 2:184426726-184426748 ATTTAGAAGTAAAATTAGAAAGG - Intergenic
944283077 2:197920866-197920888 ATTTCCCAGCTCAATGAGAAAGG + Intronic
944472535 2:200069833-200069855 ATGTTGAAGAGAAATGAGAATGG - Intergenic
944849505 2:203703817-203703839 ATTTCAAAAGCAAATGTGAAAGG + Intergenic
944961642 2:204881628-204881650 ATGCTGAAGCCAACTGAGAAAGG + Intronic
945464917 2:210157939-210157961 AATTCGTAGCAAAAAGAGAAAGG + Intronic
946726613 2:222667555-222667577 TTTTCGAAGGAAAATGTGAAAGG + Intergenic
1169782522 20:9324526-9324548 ATTTCTTAGGGAAATGAGAATGG - Intronic
1170367471 20:15613705-15613727 ATTTCGAAGTCAAAAAAGACTGG - Intronic
1172328620 20:34057806-34057828 ATATTGAGGCCAAATGAGGAGGG + Intronic
1172749390 20:37239404-37239426 ATTTCCAAGGCAAAGGATAAAGG - Intronic
1173739950 20:45393066-45393088 ATTTCCAAGCAAAATGTTAAAGG - Intronic
1174576369 20:51540768-51540790 GTTTCCAAGCCAAATCTGAAGGG - Intronic
1174651786 20:52132159-52132181 ATTTCTGAGACAAATGATAATGG + Intronic
1177154528 21:17487820-17487842 ATTTGCAAAACAAATGAGAAAGG + Intergenic
1177685445 21:24431314-24431336 ATTTGAAAGCCAAAAGAGAGAGG + Intergenic
1178481230 21:32980913-32980935 ATTATGAAGCCAGTTGAGAAGGG + Intergenic
1183021685 22:35032586-35032608 ATTTGGGAGCCAGATGACAATGG - Intergenic
1184317268 22:43705050-43705072 AAATGGAAACCAAATGAGAAAGG + Intronic
1185205123 22:49533421-49533443 ATTTGGAAGTCAAATGAGTGGGG + Intronic
949711039 3:6871626-6871648 ATCTGGTAGCCAAATGAAAATGG - Intronic
953863383 3:46564158-46564180 CTGTAGAAGCCAAAAGAGAAAGG + Intronic
954063276 3:48087095-48087117 ATTTTGAAGCTAAATTTGAAAGG + Intronic
956338614 3:68194233-68194255 ACTACCAAGCCAAATGACAAAGG + Intronic
958727697 3:97925909-97925931 CTTTCTAAACCAAATGAGAGAGG + Intronic
960500164 3:118428307-118428329 ATTTTGAATCCTAATTAGAAAGG - Intergenic
965794196 3:172421741-172421763 ATTTTGAAGGAAAATGTGAAAGG - Intergenic
966173137 3:177105603-177105625 ATTTCCAATAGAAATGAGAATGG + Intronic
966468443 3:180259436-180259458 ATTTTGAAACAAAATGATAATGG + Intergenic
966833091 3:184027747-184027769 ACTCCCAAGCCAAATGGGAAAGG - Intergenic
969444696 4:7237907-7237929 ATTTAGAAGCAAAAGGAAAACGG - Intronic
969973454 4:11072210-11072232 ATCTCGAATCTAAAAGAGAATGG + Intergenic
970739445 4:19216899-19216921 TTTTTGATGCCAAACGAGAAAGG - Intergenic
970741167 4:19239341-19239363 ATTTTGAAGACAAAAGAAAAAGG + Intergenic
970741583 4:19246010-19246032 ATTCCTAAGACAAATGAGAATGG - Intergenic
971117264 4:23663146-23663168 ATTTCGAAGCAAAATATTAAAGG + Intergenic
972025431 4:34370667-34370689 ATTTGGGAGTAAAATGAGAAGGG - Intergenic
974300741 4:60064117-60064139 ATTTGGAAACAAAATAAGAATGG - Intergenic
974343078 4:60639268-60639290 ATTTCTAAGTCAAATGTGGAAGG - Intergenic
974345447 4:60675324-60675346 ATATTGAAGCCAAATGATTACGG + Intergenic
975494470 4:75022791-75022813 ATTTGGCAGGGAAATGAGAATGG + Intronic
977011046 4:91633735-91633757 ATGTCGAAGTAAAATGAGAAGGG - Intergenic
977382873 4:96299150-96299172 ATTTCTAAGCTAAATAACAAAGG - Intergenic
977429281 4:96911433-96911455 AGTTCTAACCCAATTGAGAAAGG + Intergenic
980425834 4:132627343-132627365 ATTTATAAGCCAACTGGGAAAGG + Intergenic
980436058 4:132775426-132775448 ATTTCTAAGCCAAGTGTTAAAGG - Intergenic
980564093 4:134515867-134515889 ATTTTAAATCGAAATGAGAAAGG - Intergenic
981867727 4:149444974-149444996 ATTTCCAACCCAAATGGGAATGG - Intergenic
982996349 4:162352643-162352665 ATTTCTAAGCAAAGTGATAAAGG - Intergenic
984344609 4:178506497-178506519 ATTTCTAAGCAAAATGCAAAAGG - Intergenic
984475658 4:180231143-180231165 ATTCAGAAGGCAAAGGAGAAGGG + Intergenic
986092185 5:4520589-4520611 TTCTTGAAACCAAATGAGAATGG - Intergenic
987467001 5:18283878-18283900 ATTTCTAGGCCATATGACAAGGG - Intergenic
987580156 5:19779867-19779889 ATTTTGAGGCCAAATGAACATGG - Intronic
988674145 5:33414049-33414071 ATTTCCAAGGTAAATGAGATAGG + Intergenic
989105842 5:37862198-37862220 ATTTGGAAGACAAAATAGAACGG - Intergenic
991257339 5:64629704-64629726 ATTTGGAAGCCAAAGGGCAAGGG - Intergenic
992154412 5:73940704-73940726 ATGGCCAAGCCCAATGAGAAAGG - Intronic
992830747 5:80591124-80591146 ATTCCAAAGCCAAAAGATAAGGG + Intergenic
993704652 5:91155847-91155869 ATTTAGAAGCAATATCAGAAAGG + Intronic
995614598 5:113946820-113946842 ATTGAGAAGCCAAAGGAGAAAGG - Intergenic
995960887 5:117837841-117837863 AGTTTGCAGACAAATGAGAACGG + Intergenic
997785951 5:136714003-136714025 ATTTTGAAGCCAAATGTAATAGG - Intergenic
998526890 5:142850721-142850743 AGTTAGCAGCCTAATGAGAAGGG - Intronic
1001774554 5:174319515-174319537 ATTTAGAAGCAAAATAAAAAAGG - Intergenic
1004894268 6:20131722-20131744 ATTTCGAAGGGAAATAAAAATGG - Intronic
1007449830 6:41934305-41934327 ATTTCGAAAGCAAATAACAAGGG - Intergenic
1008159167 6:48056249-48056271 ATTTTGAAGGAAAATAAGAAAGG + Intronic
1008894304 6:56534864-56534886 AGTTCAAAGCCAAGTGGGAAGGG - Intronic
1009349380 6:62654581-62654603 GTTTTGAAGATAAATGAGAAAGG - Intergenic
1010261751 6:73824836-73824858 ATTTAGAAGGCAAAGAAGAAAGG - Exonic
1010406508 6:75511927-75511949 ATATCAAAGCTAAAGGAGAATGG + Intergenic
1010433872 6:75808684-75808706 ATTTTGAAACCAATTTAGAAAGG + Intronic
1011359338 6:86506033-86506055 ATATCCAAGCCAAATCAAAAAGG - Intergenic
1011523076 6:88231783-88231805 ATTTCTAAGAGAAATGAAAATGG + Intergenic
1013134183 6:107263609-107263631 ATTTTGAAGCCACAAGACAATGG - Intronic
1014255741 6:119158797-119158819 ATGTCGAAAGCAAAGGAGAAAGG - Intergenic
1015370589 6:132447379-132447401 ATTTAGAAGGAAAATGATAAAGG - Exonic
1015936279 6:138408322-138408344 TTTTCTAAGCAAAATGTGAATGG - Intronic
1016626675 6:146178760-146178782 ATTTGGTATCCAAATAAGAATGG - Intronic
1019111359 6:169718289-169718311 ATTTAAAAGCAAAATGGGAAAGG - Intronic
1023727609 7:43160541-43160563 ATTTCCAAACCAAGGGAGAATGG - Intronic
1024981347 7:55159843-55159865 ATTTCCAGGCAAAATGAAAATGG + Intronic
1027766768 7:82353808-82353830 ATTTCTATGCAAAAAGAGAAAGG + Intronic
1028869654 7:95755450-95755472 ATTACAAAGCCAATGGAGAATGG - Intergenic
1029924061 7:104297255-104297277 TTTCCCAAGCGAAATGAGAAGGG - Intergenic
1031011444 7:116528088-116528110 TGTTCAAAGCCACATGAGAAGGG - Intronic
1031913096 7:127538056-127538078 TATTCTAAGCAAAATGAGAAAGG + Intergenic
1032508787 7:132455650-132455672 ATTTCGAAGCCCAGAAAGAAAGG - Intronic
1032896675 7:136258911-136258933 ATTTTGAATCCACATGATAAAGG - Intergenic
1034786281 7:153928819-153928841 ATTTCAAAACCTAATTAGAAGGG + Intronic
1035273676 7:157734706-157734728 ATTTCGAAGCCAAATGAGAATGG - Intronic
1035921867 8:3685964-3685986 ATTTGGTAGCAAAATGGGAAAGG - Intronic
1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036950450 8:13134154-13134176 ATTAGGAAGCCTAATGTGAAGGG + Intronic
1041629444 8:60069437-60069459 ATTTGCAAGCCAAAAGACAATGG - Intergenic
1042981015 8:74528110-74528132 AGTTCGAAGACAAATAAAAATGG + Intergenic
1043422767 8:80115902-80115924 ATTTGGAAGACATATGACAAAGG + Intronic
1043695693 8:83213837-83213859 AATTCTAAGAAAAATGAGAAGGG - Intergenic
1044295481 8:90522216-90522238 ATTTGGAAGGCAGAAGAGAAGGG + Intergenic
1044432604 8:92126449-92126471 ATTTCTGAGACAAATGGGAAAGG - Intergenic
1045184166 8:99819103-99819125 ATTTCTAAGCTTAATGAGAAAGG - Intronic
1045586360 8:103541558-103541580 CTTTCCAAGTGAAATGAGAAGGG + Intronic
1047031344 8:120884907-120884929 ATTCAGAAGCCAAATTGGAAAGG + Intergenic
1047469045 8:125149336-125149358 TTTTAAAAGCCAAATGTGAATGG + Intronic
1047932575 8:129745247-129745269 ACTTGGAAGCCATATGAAAAAGG - Intergenic
1048452062 8:134542135-134542157 AGTTAGAATGCAAATGAGAAAGG - Intronic
1048558620 8:135507957-135507979 TTTTCTAAGCCAACTGAAAACGG - Intronic
1050033729 9:1413446-1413468 ATTTCAAAGCCAAAAGAGCCTGG - Intergenic
1050371506 9:4926038-4926060 ATTTCAAAGGCAAATGGAAAAGG + Intergenic
1051323212 9:15933687-15933709 TTTTCTGAGACAAATGAGAATGG - Intronic
1052245400 9:26328233-26328255 ATTTGGTAGTTAAATGAGAATGG - Intergenic
1052492460 9:29187705-29187727 ATTTACAAGGCAAATGAGATAGG - Intergenic
1055467975 9:76584103-76584125 ATTTCCAAGCCAAGTGTGGAAGG - Intergenic
1055776893 9:79776113-79776135 ATTTAGAAGACAATAGAGAAAGG + Intergenic
1056305191 9:85283468-85283490 ATTCTGAAGCCAAATGAGGGCGG + Intergenic
1059780792 9:117524688-117524710 ATTTTTATGCAAAATGAGAATGG - Intergenic
1186040300 X:5469510-5469532 ATTTTAAAGCTAAATGAGAGTGG - Intergenic
1186535139 X:10339373-10339395 ATCTCCAAGCCTAGTGAGAAAGG + Intergenic
1189182522 X:39017606-39017628 ATTTCGAAGCGATATAAGAAAGG + Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1190718463 X:53126010-53126032 ATCTCAAAGCCAAAAGAGAATGG - Intergenic
1191239554 X:58173094-58173116 ATTTTGAAGCCCAATGAGTTAGG + Intergenic
1191239876 X:58177799-58177821 ATTTCTGAGCCCATTGAGAAAGG + Intergenic
1192685220 X:73297380-73297402 ATTTGAGAGCCAAATCAGAAAGG + Intergenic
1196022812 X:111007872-111007894 CTCTAGAAGACAAATGAGAAAGG + Intronic
1196296813 X:114007135-114007157 ATTTCCAAGCAAAATGTTAAAGG + Intergenic
1199392307 X:147295200-147295222 ATTTCTAATTCAAATGAAAAAGG + Intergenic