ID: 1035274116

View in Genome Browser
Species Human (GRCh38)
Location 7:157737276-157737298
Sequence CGTCCACACAGGCCCCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035274116_1035274123 7 Left 1035274116 7:157737276-157737298 CCAGACTGGGGCCTGTGTGGACG 0: 1
1: 0
2: 0
3: 12
4: 151
Right 1035274123 7:157737306-157737328 CAGCAGTGTTCCTGTGTCCGTGG No data
1035274116_1035274125 15 Left 1035274116 7:157737276-157737298 CCAGACTGGGGCCTGTGTGGACG 0: 1
1: 0
2: 0
3: 12
4: 151
Right 1035274125 7:157737314-157737336 TTCCTGTGTCCGTGGTTTGGAGG 0: 1
1: 0
2: 0
3: 16
4: 157
1035274116_1035274124 12 Left 1035274116 7:157737276-157737298 CCAGACTGGGGCCTGTGTGGACG 0: 1
1: 0
2: 0
3: 12
4: 151
Right 1035274124 7:157737311-157737333 GTGTTCCTGTGTCCGTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035274116 Original CRISPR CGTCCACACAGGCCCCAGTC TGG (reversed) Intronic
902649326 1:17826380-17826402 CCTCCACCAAGGCCACAGTCTGG + Exonic
903808848 1:26023292-26023314 CGGCAACACAGCCCCCAGCCCGG + Exonic
904312051 1:29635318-29635340 TGTCTACACAGGCCTCAGGCTGG - Intergenic
905278457 1:36834004-36834026 TGTCAGCCCAGGCCCCAGTCTGG + Intronic
906186158 1:43863711-43863733 ACCCCACAGAGGCCCCAGTCTGG + Intronic
906216934 1:44047439-44047461 GGTCCAGACAGGCTCCAGCCTGG + Intergenic
908536911 1:65086685-65086707 CTTCCAATCAGGCCACAGTCTGG + Intergenic
909376794 1:74950539-74950561 CACCCACACAGTCCCCAGTGGGG + Intergenic
912689521 1:111794031-111794053 CCTCCACACTGGCCCCAGATAGG - Intronic
913089136 1:115464770-115464792 CCCCCTCACAGGCCCCAGTGTGG - Intergenic
917728247 1:177848086-177848108 GTTCCCCACAGGCCCCAGTCAGG - Intergenic
922194818 1:223350888-223350910 AGAACACACAGGCCACAGTCAGG + Intronic
922909541 1:229204211-229204233 CCTGCACACAGGCCCCTGTCGGG - Intergenic
923663651 1:235979934-235979956 ACTCCACACAGGCACCAATCGGG - Exonic
1069613191 10:69789151-69789173 CCCACACAGAGGCCCCAGTCAGG - Intergenic
1071893856 10:90042306-90042328 CGTGGGCACAGGCCCCAGTGTGG + Intergenic
1072787884 10:98296463-98296485 GGTCCCCACAGGGCCCAGACTGG + Intergenic
1074777582 10:116777526-116777548 AGTCCACACATGTCCCTGTCTGG - Intergenic
1076199263 10:128545419-128545441 CGGGCACACCTGCCCCAGTCCGG - Intergenic
1076220554 10:128730028-128730050 CATGCACCCAGGCCCCAGTGAGG + Intergenic
1076851889 10:133097313-133097335 TGTCCACTCAGGCCTCCGTCAGG + Intronic
1076859218 10:133132708-133132730 CGCCCACGAAGGCCCCAGACAGG + Intergenic
1077060105 11:614174-614196 CTCCAGCACAGGCCCCAGTCAGG + Exonic
1078619411 11:12893519-12893541 ATTTCACAGAGGCCCCAGTCAGG + Intronic
1081112791 11:39157446-39157468 TGGCCACACAGGCCAAAGTCTGG + Intergenic
1083617148 11:64031944-64031966 CTTCCCCACAGGCCCCAGCCTGG - Intronic
1085713479 11:78851774-78851796 TGTCATCAGAGGCCCCAGTCTGG - Intronic
1090955678 11:131511271-131511293 CATCCCCTCAGGCCCCAGCCAGG + Intronic
1091189511 11:133679344-133679366 CTTCCACACAGTCCACACTCTGG + Intergenic
1091583356 12:1801799-1801821 CTTCCACCCACGCCCCTGTCCGG + Intronic
1091738708 12:2944530-2944552 GGCCCACGCAGGCCCCAGCCAGG + Intergenic
1092001218 12:5033818-5033840 GGACCCCACAAGCCCCAGTCAGG - Intergenic
1092786698 12:12033027-12033049 CCTCCTCTCAGGCCCCAATCAGG + Intergenic
1095965553 12:47864771-47864793 CTTCCTCTCAGGCCCCACTCTGG + Intronic
1101245771 12:102883319-102883341 CTTCCCCACAGACCTCAGTCAGG + Intronic
1101964203 12:109271221-109271243 CATCCACACAGGCCACAGAAAGG + Intergenic
1103033102 12:117633876-117633898 CCTCCAGACATGCCCCAGTGTGG + Intronic
1103471359 12:121184434-121184456 CTTCCACACTGGCACCAGACGGG - Exonic
1104019349 12:124981284-124981306 AGTGCTCACAGGCACCAGTCAGG + Intronic
1104793567 12:131499775-131499797 CCTCCCCACAAGCCCCACTCAGG - Intergenic
1104870186 12:131989313-131989335 CGTCAACACAGGCCCTGATCGGG - Intronic
1104944387 12:132409220-132409242 CGTCCACACCGTCCCCAGACGGG + Intergenic
1106173601 13:27309430-27309452 CTTACACAAAGGTCCCAGTCTGG - Intergenic
1113374859 13:109755665-109755687 CGTCCACACCGAGCCCAGTGTGG - Exonic
1116095323 14:40359835-40359857 CCTCCACACAGAGCCCAGACTGG + Intergenic
1118309217 14:64680434-64680456 GGTCCAAACAGGCCCCAGGGAGG - Intergenic
1119357355 14:74018676-74018698 CGGCCACACAGGACCTAGTGAGG + Intronic
1121006844 14:90496139-90496161 CCTCCACACAGACCCCACTCCGG + Intergenic
1122876109 14:104666124-104666146 CGGCCACAGAGGCCCCAGCGGGG + Intergenic
1126638656 15:50803439-50803461 TGTCCACACATTCCCCAGCCTGG - Intergenic
1131919422 15:97307622-97307644 CATCAACACAGGCCACATTCTGG - Intergenic
1132758246 16:1496323-1496345 GGGCCACACAGGCCCCACGCAGG - Intronic
1135281547 16:21157694-21157716 GGTCAACACAGGTCCCTGTCTGG + Intronic
1136704248 16:32172914-32172936 TGTCCACACAGCCCCCCGTTGGG - Intergenic
1136763661 16:32756492-32756514 TGTCCACACAGCCCCCCGTTGGG + Intergenic
1136804438 16:33113894-33113916 TGTCCACACAGCCCCCCGTTGGG - Intergenic
1137056720 16:35749610-35749632 CCTCCATCCAGGCCCCAGCCAGG - Intergenic
1138514717 16:57529620-57529642 CTTCCGCACAGGACCCAGGCGGG + Intronic
1139568725 16:67797000-67797022 CGACCACACAAGACCCACTCTGG + Intronic
1203065811 16_KI270728v1_random:1016813-1016835 TGTCCACACAGCCCCCCGTTGGG + Intergenic
1142966173 17:3583128-3583150 CGTCTCCACAGGCCCAAGGCAGG - Intronic
1143119934 17:4600153-4600175 CCTCCCCAGAGGCCCCAGGCAGG - Intronic
1144759763 17:17700684-17700706 CGTCCGCCGAGGCCGCAGTCCGG + Intronic
1146650339 17:34602467-34602489 CCTCCACCCTGGCCCCTGTCAGG - Intronic
1147311028 17:39596361-39596383 CATACACACAGACTCCAGTCAGG - Intergenic
1148348737 17:46923122-46923144 CGTCCTCACAGCCCCCCTTCCGG - Exonic
1150410799 17:64939168-64939190 CGTCCACTCGGGCCCCAGAATGG - Intergenic
1151608192 17:75153755-75153777 CGACCACACATGCACCTGTCAGG + Intronic
1152026867 17:77815576-77815598 AGTTCACTCAGGCCCCAGCCAGG - Intergenic
1152228321 17:79102745-79102767 TGTCCCCACATGGCCCAGTCTGG - Intronic
1152396734 17:80037239-80037261 CTTCCACCCAGGCCCCAGGACGG - Intronic
1154484456 18:14862613-14862635 CCTCCACACAGTCCCCACTGGGG + Intergenic
1159585183 18:70277264-70277286 CGTGGACACAGGACCCAGCCTGG + Intergenic
1159671070 18:71221686-71221708 TAGCCACACCGGCCCCAGTCGGG + Intergenic
1160346622 18:78137580-78137602 CATCCACACAGGCCCCGTCCAGG - Intergenic
1160682390 19:417813-417835 CCTCCACCCAGCCCCCAGCCAGG - Intronic
1161208810 19:3055993-3056015 CGGCCACTCAGGCCCCTGGCAGG + Intronic
1163502552 19:17685753-17685775 TGTCCACACAGGAACAAGTCTGG + Intronic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1164732866 19:30519292-30519314 TGTCCACACCTGCCCCAGCCAGG - Intronic
1165063744 19:33217615-33217637 CGTCCTCTCAGGACCCGGTCTGG - Intronic
1165509042 19:36255556-36255578 CGTCCACGCAGGCCTGAGCCTGG - Intergenic
1166046488 19:40233574-40233596 AATCCACACAAGCCCCAGTGAGG - Exonic
1166947481 19:46405844-46405866 CATGCACACAGGACCCACTCTGG - Intergenic
1167603210 19:50466411-50466433 CGTCGACACAGGCCGCGGTGAGG + Intergenic
1167737700 19:51306649-51306671 TGTTCCCATAGGCCCCAGTCTGG + Intergenic
925036615 2:692161-692183 GGCCCACACAAGCCCCAGGCAGG - Intergenic
925310686 2:2879355-2879377 TGTCCATCCAGGCCCCAGGCTGG - Intergenic
925821592 2:7804628-7804650 CGTGCACACATGCCCAACTCAGG - Intergenic
927109215 2:19852227-19852249 ACTCCCCACAGGCCCCAGGCTGG + Intergenic
927159333 2:20242786-20242808 CCTCCCCACAGGCCCAAGCCTGG - Intergenic
928088450 2:28359941-28359963 CCTGCACACAGGCCTCAGGCTGG - Intergenic
930678100 2:54226129-54226151 CGGCCACACTGGTGCCAGTCTGG - Intronic
933769196 2:85732575-85732597 TGTCTACAGAGGACCCAGTCAGG + Intergenic
938138743 2:128779923-128779945 CCTCCTCCCAGGCCCCAGGCAGG - Intergenic
940211851 2:151262929-151262951 TGTCCCCACAGGCGCCATTCGGG - Intergenic
946145000 2:217724047-217724069 CGACCACACAGCCCCCAGCAAGG + Intronic
947613089 2:231536002-231536024 CGTGGACACTGGCCCCAGGCTGG + Intergenic
948684248 2:239660118-239660140 CCTTCACACAGCCCCCACTCTGG + Intergenic
1169398571 20:5259443-5259465 CCCCCACACAAGCCCCAGTGTGG - Intergenic
1173613979 20:44390758-44390780 CCTCCACACTGCTCCCAGTCTGG - Intronic
1175916640 20:62428894-62428916 CGTGCACACAGTCCCCACACAGG - Intergenic
1176088395 20:63308315-63308337 GGTCCACACCCGGCCCAGTCTGG + Intronic
1176109761 20:63405927-63405949 CGTCCACTCTGGCTCCAGTTTGG + Intergenic
1176426916 21:6553659-6553681 CCAGCACACAGGCCCCAGGCTGG - Intergenic
1179702407 21:43161981-43162003 CCAGCACACAGGCCCCAGGCTGG - Intronic
1180245746 21:46546158-46546180 CCTGCACACAGGCCTGAGTCGGG + Intronic
1181643899 22:24220014-24220036 CGTACACACAGGCCCCCTCCTGG + Exonic
1183152308 22:36047469-36047491 CCTCCACAGAGCCCCCAGTCTGG - Intergenic
1183240392 22:36653485-36653507 GGCACACACAGGCCCCAGCCCGG - Intronic
954222306 3:49162254-49162276 GATCCAGACAGGCCCCATTCAGG - Intergenic
966839792 3:184079178-184079200 CGTCAACACTGGCCCCATTCTGG - Intergenic
967017966 3:185498613-185498635 GCACCACACAGGTCCCAGTCAGG + Intronic
967271784 3:187738685-187738707 CAGCCACAAAGGCCGCAGTCTGG + Intronic
968006336 3:195245670-195245692 CCTCCCACCAGGCCCCAGTCCGG - Intronic
968502558 4:957761-957783 TGGCCACACAGGCCCCAGCAGGG - Intronic
968729336 4:2262215-2262237 CGTCCCCATTGGCCCCAGCCCGG - Exonic
969960522 4:10940408-10940430 CCCCCACACAGTCCCCAGTGGGG + Intergenic
978169158 4:105648373-105648395 TGTCCACCCATGTCCCAGTCAGG - Intronic
985532044 5:439484-439506 TGTCCACACAGGTGCCAGTGTGG - Intergenic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
991388857 5:66121156-66121178 AGGCCACACAGGGCCCAGTGTGG + Intergenic
993384709 5:87251073-87251095 CCCCCACACAGGCCCCAGTTTGG + Intergenic
994073716 5:95628742-95628764 CCTCCACGCAGTCCCCAGTGGGG - Intergenic
997614979 5:135240110-135240132 CGCCCACACAGCCCTCAGCCAGG + Intronic
999296191 5:150461058-150461080 CCTTCACACAGCCCACAGTCTGG + Intergenic
1001900378 5:175422152-175422174 CCTCCACACACACTCCAGTCCGG + Intergenic
1001962424 5:175887705-175887727 CGTCTCCACAGGCACTAGTCTGG + Intergenic
1001988645 5:176097294-176097316 TGTGCACACAGGCCACAGTGTGG + Intronic
1002228223 5:177740840-177740862 TGTGCACACAGGCCACAGTGTGG - Intronic
1003868074 6:10381510-10381532 CGTCCTCTCAGGCCCCAGATAGG - Intergenic
1005952285 6:30640859-30640881 CGTCAACATAGGCCAGAGTCAGG + Intronic
1006804141 6:36777504-36777526 CGTCCACACAGGCCCCCTCCAGG - Intronic
1008880836 6:56378629-56378651 AGTTCCCACAGGCCCCAGGCAGG - Intronic
1010514699 6:76759406-76759428 CCTCCACCCAGGCCCCACTGTGG + Intergenic
1012201050 6:96406444-96406466 AGTCTACACAGACCCCATTCTGG + Intergenic
1018289970 6:162282094-162282116 GGTCCTCACAGGCCACAGACAGG + Intronic
1019140159 6:169937778-169937800 CGTCCACACAGAACCCAACCTGG - Intergenic
1019564177 7:1671410-1671432 GGTCCAAAGAGGCCCCACTCCGG - Intergenic
1020043380 7:5021079-5021101 GGTGCACGCAGCCCCCAGTCAGG - Intronic
1022125830 7:27356232-27356254 GGTCTAGACAGGCCCCAGACAGG - Intergenic
1023621173 7:42074669-42074691 CGTCCACCCAGGGCCCTGCCAGG + Intronic
1023896466 7:44437564-44437586 CCCCCACACAGGCCAGAGTCAGG - Intronic
1029284470 7:99456314-99456336 CATCCACCAAGTCCCCAGTCGGG - Intronic
1030654847 7:112155654-112155676 GGTCCACACTGTCCACAGTCTGG - Intronic
1031814910 7:126421824-126421846 CTTTCACCCAGGCCCCAGGCTGG + Intergenic
1034283359 7:149868619-149868641 CGGCCACACAGGTGCCAGTGTGG - Intergenic
1034869944 7:154675186-154675208 CGTCCACACCGGGGCCTGTCCGG + Intronic
1035274116 7:157737276-157737298 CGTCCACACAGGCCCCAGTCTGG - Intronic
1038190904 8:25319461-25319483 CGTCCACACATGCCCTACACTGG - Intronic
1041318941 8:56593870-56593892 CCTCCAGGCAAGCCCCAGTCTGG - Intergenic
1041370436 8:57154182-57154204 CTTACACACAGGCCACTGTCCGG - Intergenic
1047259682 8:123244393-123244415 TGTCAACTCAGCCCCCAGTCAGG + Intronic
1048865843 8:138760937-138760959 CGTCCTCACAGACCCCAGGGAGG + Intronic
1049772223 8:144388832-144388854 CGGCCATTCAGGCCCCACTCTGG - Intronic
1050086727 9:1973683-1973705 CTTCTTCACAGCCCCCAGTCTGG + Intergenic
1058046692 9:100364951-100364973 GGACAACACAGGCCCCAGACAGG - Intergenic
1059726561 9:117014242-117014264 GGTCCACAGAGCCCCAAGTCAGG + Intronic
1059938745 9:119337320-119337342 CGTAGGCACAGGTCCCAGTCTGG + Intronic
1061225945 9:129281050-129281072 TGTCCACACAGGCCCCAGCTGGG - Intergenic
1061481751 9:130900867-130900889 CGTCCACACAGGCCTCTGGCTGG - Intergenic
1193259241 X:79386056-79386078 ATCCCCCACAGGCCCCAGTCTGG - Intergenic
1193489487 X:82132015-82132037 AGTTGCCACAGGCCCCAGTCAGG - Intergenic
1200398353 X:156004258-156004280 GGTCCACAAAAGCCCCAGGCGGG - Intronic