ID: 1035278070

View in Genome Browser
Species Human (GRCh38)
Location 7:157759856-157759878
Sequence CCAGCTCCTCCCCAAGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 7, 3: 31, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035278070_1035278075 6 Left 1035278070 7:157759856-157759878 CCCCTCTCTTGGGGAGGAGCTGG 0: 1
1: 0
2: 7
3: 31
4: 236
Right 1035278075 7:157759885-157759907 CACAAGTCCAGCACTCACAGAGG 0: 1
1: 0
2: 0
3: 8
4: 148
1035278070_1035278077 30 Left 1035278070 7:157759856-157759878 CCCCTCTCTTGGGGAGGAGCTGG 0: 1
1: 0
2: 7
3: 31
4: 236
Right 1035278077 7:157759909-157759931 TCATCCTGAGTTGTCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035278070 Original CRISPR CCAGCTCCTCCCCAAGAGAG GGG (reversed) Intronic
900344239 1:2203556-2203578 CCAGCTCCACCCCAGGTGAGGGG - Intronic
901534379 1:9872827-9872849 CCAGCTCCTCCTGGAGGGAGGGG - Intronic
902157391 1:14499464-14499486 CCAGCTCCTCCCAGAAAGAAAGG - Intergenic
902466507 1:16621827-16621849 CCAGGGCCTCCACAACAGAGAGG + Intergenic
902508149 1:16951219-16951241 CCAGGACCTCCACAACAGAGAGG - Intronic
903125428 1:21244425-21244447 CCACCTTCTCCCCAAGGAAGTGG - Intronic
903786136 1:25862569-25862591 CCAGCTCCTTGCCCAGGGAGAGG - Exonic
904783169 1:32965540-32965562 CCAGATCCTCCCCCAGTCAGAGG - Intergenic
905749563 1:40450344-40450366 CCTCCTCCTCCCCAAATGAGAGG - Intronic
906380398 1:45328750-45328772 CCAGCCCCTCCCCACCTGAGTGG - Intergenic
908765794 1:67553716-67553738 CCAGTTCATCCCCCAGAAAGTGG - Intergenic
911912148 1:103650518-103650540 CCAGGTACTCCCCAAGAGTTAGG - Intergenic
911916306 1:103701430-103701452 CCAGGTACTCCCCAAGAGTTAGG + Intronic
911919563 1:103744656-103744678 CCAGGTACTCCCCAAGAGTTAGG - Intronic
912955515 1:114152491-114152513 CCAGCCCCTCCCCCATGGAGGGG + Intronic
914225259 1:145714694-145714716 CCAGCTTCTCCCCTGGAGAAGGG - Intergenic
914247375 1:145896256-145896278 CCAGCTTCTCACCCTGAGAGTGG + Exonic
914903140 1:151722892-151722914 CCAGCACCTCCACAAAAGACAGG + Intronic
916211195 1:162361289-162361311 CCACCTCCTCCCCACCAGATGGG - Intronic
917440855 1:175067557-175067579 CCAGCTCCTGGCCAGGAGACAGG + Intergenic
917821512 1:178768655-178768677 CCAGCACCTCCCCAGGACTGAGG - Intronic
923151834 1:231240792-231240814 CCAACTCGTCCCCAAGTGTGGGG - Intronic
923341695 1:233013139-233013161 CCAGCTCCTCCCCAGGAGATTGG + Intronic
924772682 1:247090346-247090368 CCAGCTTCTGCCAAAGTGAGAGG - Intergenic
1067847377 10:49735132-49735154 GGAGCTCCTGCCCAGGAGAGGGG - Exonic
1068734625 10:60398888-60398910 CCAGTTCCTCCCCTAGGGTGGGG + Intronic
1070844546 10:79511516-79511538 CCAGCGCTTCCCCAAGAGGCTGG + Intergenic
1070929252 10:80248792-80248814 CCAGCGCTTCCCCAAGAGGCTGG - Intergenic
1071574911 10:86718187-86718209 CCAGCCCTTCCCCAAGATCGTGG + Intronic
1072622818 10:97091257-97091279 CCATCTTCTCCCCTGGAGAGGGG + Intronic
1072623571 10:97096673-97096695 CCAGCTCGACCCCGAGAGAGGGG + Intronic
1072718061 10:97764811-97764833 CCAGCTTCTCCACACAAGAGGGG - Intergenic
1073103746 10:101020671-101020693 CCATCCCCTCCCCAGGAGACCGG - Exonic
1073287252 10:102396391-102396413 CCAGCCCCTCCCCCAGAGAGAGG - Intronic
1074779179 10:116788237-116788259 CCAGCTCCACCACCAGAGGGCGG - Intergenic
1076574965 10:131458667-131458689 CTAGACCCTCCCCAAGAGAAAGG - Intergenic
1076705379 10:132298484-132298506 CCAGCTCATCCTCAGGGGAGGGG - Intronic
1077042198 11:529797-529819 CCAGCTCCTCCCCTTGAGGGAGG - Intergenic
1077101525 11:824625-824647 CCAGCGCGTCCCCCAGCGAGAGG - Exonic
1077482780 11:2824340-2824362 CCAGCTCGTCCCCAAGTCTGGGG - Intronic
1078991801 11:16655228-16655250 CCAGCCCCTCCCCAAGTTATAGG - Intronic
1079276225 11:19040180-19040202 CAACCCCCTCCCCACGAGAGTGG - Intergenic
1079585808 11:22126080-22126102 CTATCTCCTCTCCATGAGAGTGG - Intergenic
1081644574 11:44780769-44780791 CAAGCCCCTCCCCAGGAGTGAGG - Intronic
1083304480 11:61755344-61755366 CCGGCTAATCCCCTAGAGAGAGG + Intronic
1083607281 11:63986567-63986589 CCAGCTGCTCCCGAGGAGGGAGG + Intronic
1084214318 11:67639349-67639371 CCAGGTCCTTCACAAGAGGGTGG - Intronic
1084430624 11:69108837-69108859 GGAGCTCCTCCCCCAGGGAGTGG - Intergenic
1084679907 11:70660915-70660937 GCATCACCTCCCCATGAGAGGGG - Intronic
1089326378 11:117660272-117660294 CCAGCACCTTCCCAAAAGGGAGG - Intronic
1089772778 11:120815382-120815404 TCAGATCCTCCCCAAGGGGGTGG + Exonic
1090545541 11:127762751-127762773 GAAGCTACTCCCCAAGAGAAAGG - Intergenic
1091348892 11:134876918-134876940 CCAGTTTCTCCTCAGGAGAGGGG - Intergenic
1091549095 12:1524314-1524336 CCAGCTCCTTAGTAAGAGAGAGG + Intergenic
1091691460 12:2600202-2600224 CCAGCTCTTCACCAAGAGGCAGG + Intronic
1092767925 12:11869875-11869897 CCAGGTCTTCCCGATGAGAGAGG - Exonic
1093293891 12:17364163-17364185 TCAGCTCCTCCTCAAGAGCAGGG - Intergenic
1093480688 12:19601359-19601381 CCAGCTATTCTCCAAGAGAATGG + Intronic
1095962379 12:47843848-47843870 CCACCCCCTCCCCAGGGGAGAGG - Exonic
1096848552 12:54420905-54420927 CCAGCTGCAGCCCAAGGGAGAGG + Intergenic
1102012009 12:109624556-109624578 ACAGCTCCTCCCTGAGAGAATGG - Intergenic
1102407984 12:112690704-112690726 CCCACTCCTCCCCAAGAGGCAGG - Intronic
1103904373 12:124320031-124320053 CCACCTCCCCCCAAAGAAAGAGG - Intergenic
1104428348 12:128696254-128696276 CCAGCTCCTTCCAAACAGAATGG + Intronic
1107220491 13:37973886-37973908 CCTGCCCCTCCCCCAGAAAGCGG + Intergenic
1107749373 13:43547969-43547991 CCAAGTCCTCCCCAAGAGAGTGG + Intronic
1107801314 13:44110240-44110262 CCAGCTCCACCTCTTGAGAGAGG - Intergenic
1107823056 13:44303837-44303859 CCAGCTCCGGCCCAAGTTAGGGG - Intergenic
1108703390 13:52962889-52962911 CCAGCTCCTTACCTAGACAGGGG + Intergenic
1112316828 13:98370499-98370521 CCACCTCATCACCAAGACAGAGG - Intronic
1113236209 13:108277978-108278000 CCAGCTCCTATCCAAGATGGAGG + Intronic
1113516625 13:110907740-110907762 CCCTATCCTCCCCAAAAGAGAGG + Intronic
1115737500 14:36349590-36349612 CCAGATCCTCTCAAAAAGAGAGG - Intergenic
1116097108 14:40384351-40384373 CCAGGTCCCTCCCAAGACAGAGG + Intergenic
1120370260 14:83625185-83625207 CAGGCTCCTCCCAAAGAAAGAGG + Intergenic
1122857238 14:104565792-104565814 CCCTCTCCTTCCCCAGAGAGGGG + Intronic
1122864156 14:104595989-104596011 CCACCTGCTTCCCAAGAGTGTGG - Intronic
1123114971 14:105890486-105890508 CCAGGTCCTCCCCAAGATAGGGG - Intergenic
1123117157 14:105899934-105899956 CCATGTCCTCCCCAAGATAAGGG - Intergenic
1123119240 14:105909244-105909266 CCATGTCTTCCCCAAGATAGGGG - Intergenic
1123886691 15:24733762-24733784 CAATCCCCTCCCCAAGAGTGTGG - Intergenic
1124167675 15:27342623-27342645 CCAGCTTCTCCCCTTGAAAGAGG - Intronic
1125675377 15:41499552-41499574 CCATCTCCTCCCCATGGGAAAGG + Intronic
1126319699 15:47408833-47408855 GCACCTACTCCCCAAGACAGAGG - Intronic
1127261469 15:57329752-57329774 GCAGCGCCTCCCCAGGAGAGAGG - Intergenic
1127311044 15:57752629-57752651 CTAGCTCCTCCTGAAGACAGTGG - Intronic
1127504288 15:59582905-59582927 CCAGCTCTTCCCAAATATAGGGG + Intergenic
1128109281 15:65066752-65066774 CCAGCCCCACCCCCAGAGAGGGG - Intronic
1128701702 15:69809374-69809396 CCTGCTCCACCCAAAGAGAGGGG - Intergenic
1128792189 15:70441599-70441621 CCAGCACCTCACCGAGAGAGTGG - Intergenic
1129319757 15:74767968-74767990 CCATCCCCTCACCCAGAGAGGGG + Intergenic
1129399906 15:75275770-75275792 CCAGCACATCCCCAAGGCAGAGG - Intronic
1129938990 15:79477608-79477630 CTTGATCCTCCCCAAAAGAGAGG - Intergenic
1130406294 15:83605048-83605070 CCAGCTACTGGCCAAGAAAGAGG - Intronic
1130537352 15:84796967-84796989 CCCGCTCCCCCCCAAGAGACAGG + Intronic
1132858132 16:2056585-2056607 CCAGCTCCTCCCCACAGGAGAGG - Intronic
1132858205 16:2056962-2056984 CCATCTCCTCCCAAAGACAGAGG - Intronic
1133230744 16:4365417-4365439 CCTGGCCTTCCCCAAGAGAGAGG - Intronic
1134069578 16:11252596-11252618 ACAGGTCCTCCTCAAAAGAGGGG - Intronic
1135629717 16:24026703-24026725 CCAGCTCCTCTCCAAGACCTAGG - Intronic
1137510060 16:49091277-49091299 CCAGCTCATTCTCAAGACAGTGG - Intergenic
1138539699 16:57680409-57680431 CCAGCTCCTGCCCTGGGGAGGGG + Intronic
1139335624 16:66228914-66228936 CCACCTCCTACCCGGGAGAGGGG - Intergenic
1139941964 16:70611897-70611919 CCTGCTCCTCCCGAAGAGCTGGG - Intronic
1140143731 16:72285393-72285415 CCAGCTCCTGCAGAAGAGAGAGG - Intergenic
1140298955 16:73737817-73737839 TTAGCACCTCCCCCAGAGAGTGG + Intergenic
1140880498 16:79193770-79193792 CCAGCTCCTCACAAAGGGGGTGG + Intronic
1141786375 16:86203548-86203570 CCAGCTTCTCCCTAAGATGGCGG + Intergenic
1141792153 16:86244171-86244193 CCAGCTCCACTCCAGGACAGGGG - Intergenic
1142374961 16:89701967-89701989 GCCGCTCCTCCCCACGAGACAGG + Intergenic
1142510169 17:387718-387740 CCAGCCCCTCCCCATGACATTGG - Intergenic
1143594719 17:7907373-7907395 CCAGCCGCTCCCCAAGTGATGGG - Exonic
1143921399 17:10333384-10333406 CTAGCATCTCCCCAAGAGGGTGG - Intronic
1144668508 17:17118257-17118279 CCAGCACATCCTCAAAAGAGAGG - Intronic
1144668653 17:17118931-17118953 CCAGCACCTCCTCAAAAGAGAGG + Intronic
1144931689 17:18864232-18864254 CCAGGTCCTCCCCAGAAGTGAGG - Intronic
1145940450 17:28740846-28740868 CAGGCTCCTCCCCCAGGGAGAGG - Exonic
1147854623 17:43469725-43469747 CCAGCTTTTTCCCCAGAGAGGGG + Intergenic
1147947399 17:44087678-44087700 TCAGATCCTCACCAAGACAGGGG - Exonic
1148806705 17:50267454-50267476 CCAGCTGTCCCCCCAGAGAGAGG - Intergenic
1149376268 17:56047333-56047355 CTAGTTCATCTCCAAGAGAGGGG + Intergenic
1150006126 17:61470065-61470087 CCAACTCCTGCCCAAAAGGGTGG + Intronic
1150283027 17:63940420-63940442 CCAGCTCCTCCTCAAGTGAGGGG + Exonic
1150442573 17:65203230-65203252 CCAGCTCCTCCCACAGGGAGGGG + Intronic
1150579663 17:66460807-66460829 CCAGCTCCTACCCCAGAGGTTGG + Intronic
1151827148 17:76529883-76529905 TCAGCACCACCCCAAGAGAGTGG - Intronic
1151945662 17:77318616-77318638 CCACCTCCTCCCAAAGAGCCTGG - Intronic
1154122996 18:11666645-11666667 TGAGATCCTCCCCAAGAGAAGGG - Intergenic
1155393929 18:25366649-25366671 CATGCTCCTCCCCAGGTGAGGGG - Intergenic
1158962223 18:62596521-62596543 CCAGCTCCCACCCAAGCAAGGGG - Intergenic
1159937862 18:74382891-74382913 CCTGCACCTCCCCAGGGGAGTGG - Intergenic
1161241294 19:3225163-3225185 TCAGCTGCACCCCCAGAGAGGGG - Intronic
1161460196 19:4392027-4392049 CCAACACCTCCCCGAGGGAGAGG + Intronic
1162493271 19:11007853-11007875 TCAGTTCATCCCCCAGAGAGGGG - Intronic
1164725069 19:30460748-30460770 CCAGCTTCTCCTCAAGAGCAGGG - Intronic
1166122821 19:40695604-40695626 CCAGCTCCCTCCTAAGAGAAAGG - Intronic
1167375515 19:49108856-49108878 CCAGCCCCCCACCAAGACAGGGG - Intergenic
1167750109 19:51374315-51374337 CCAGTTCATCTCCAAGACAGAGG - Intergenic
926296398 2:11572199-11572221 CCAGTGCCTTCCCAGGAGAGTGG - Intronic
926395606 2:12439444-12439466 CCAGCTCCACCCCTAGTGAATGG - Intergenic
927495082 2:23546647-23546669 GGAGCTCCTCCCCGGGAGAGGGG - Intronic
929449936 2:42030201-42030223 CCAGCCCTTCCCCACGAGGGTGG - Intergenic
929762984 2:44821291-44821313 GCAGCTCCTCCCCCAGGCAGAGG - Intergenic
929871397 2:45762066-45762088 GCAGCTACTCCCCTAGAGAGTGG - Intronic
930177297 2:48314490-48314512 CCACCTCCTACCGAAGGGAGGGG - Intergenic
932828029 2:74959066-74959088 CCAGGTCCTCAACAAGAGGGAGG - Intronic
937322878 2:120971467-120971489 CCAGAGCCTCCCCACGACAGTGG + Intronic
938159573 2:128973296-128973318 CCAGCACCTCCTCAAGGGAGTGG + Intergenic
943957130 2:194207122-194207144 CCAGCTCCTGCACAAGAAGGTGG + Intergenic
944107711 2:196097274-196097296 CCCTCTCCTCCCCAAAAGTGGGG - Intergenic
945969354 2:216221056-216221078 CCAGGACAGCCCCAAGAGAGTGG + Intergenic
947632839 2:231665161-231665183 CCTTCTCCCCACCAAGAGAGTGG + Intergenic
948334058 2:237194017-237194039 CCAGCTCAGCCCCAAGAATGTGG + Intergenic
948653099 2:239461297-239461319 CCAGCTCCTCCCCAAGCTTTGGG - Intergenic
948752553 2:240140970-240140992 TCAGCTCCTCCTCACGAGGGAGG - Intronic
1170548453 20:17454995-17455017 CCAGCTCCTCCCAAACAGAAGGG + Intronic
1172146128 20:32759777-32759799 CCTGCTCCTTCCCAAGTGATGGG + Intergenic
1173437862 20:43048748-43048770 CCATCTGCTCCACAACAGAGAGG + Intronic
1173643043 20:44616791-44616813 CCAGCGACTCCCCAAGGCAGGGG + Intronic
1175467984 20:59205430-59205452 ACAGCTCCTGCCCCAGACAGGGG + Intronic
1175822422 20:61917539-61917561 GCAACTCCTCCCCAAGACAGGGG + Intronic
1178710560 21:34912871-34912893 CCAGCCCCACCCCAAGTGAAAGG - Intronic
1178917122 21:36711544-36711566 CCCCCTCCACCCCTAGAGAGGGG - Intronic
1179133762 21:38661417-38661439 CCGGCTCCTCCCCACGACCGAGG - Intronic
1179662582 21:42886626-42886648 CCCGCTCCTCCCCAAAAGGCTGG - Intronic
1181031011 22:20148920-20148942 CCAGCCCCTCCCCGACAGAAAGG - Exonic
1182393657 22:30019996-30020018 CCAGGTCCCCCCCAGGGGAGAGG + Exonic
1182634330 22:31712428-31712450 CCAGCTCCTCTCCAAGACTATGG - Exonic
1184295179 22:43518866-43518888 CCAGCTCCACTCAAGGAGAGAGG + Intergenic
1184670655 22:46010975-46010997 CTGGCCCCTCCCCAGGAGAGTGG + Intergenic
1184967872 22:47994750-47994772 CCAGCTCCACACCAAGCGTGTGG - Intergenic
1185220434 22:49626753-49626775 CCAGCTCCTCCTGAGCAGAGTGG + Intronic
950872013 3:16237742-16237764 CCAGGGCCTCCCAAGGAGAGTGG - Intergenic
953568615 3:44053968-44053990 CCAGCTCGCCCCCAGGAGAGGGG + Intergenic
955213328 3:56962254-56962276 CCAGGTCCTCACCAAAGGAGGGG + Intronic
955398975 3:58577721-58577743 CCAGCACTTCCCCATGGGAGGGG + Intronic
955876291 3:63493191-63493213 CCAGCCCATCCCCAATAGAATGG + Intronic
956241452 3:67135245-67135267 TCAGCTCTTCCCCAAGAGAAAGG - Intergenic
958026955 3:88059603-88059625 CCCGCTCCTCCCCAACAAGGAGG + Intronic
960443728 3:117721532-117721554 CCAACTCCCCCACAAGAGAGGGG - Intergenic
961205741 3:125080129-125080151 CCAGCACCTCCCTAGGAGACTGG - Intergenic
961404522 3:126668764-126668786 CCAGCTCCTCCCCACCTCAGGGG - Intergenic
962349868 3:134648865-134648887 CCAGATCCTCCACTGGAGAGTGG - Intronic
963061735 3:141231829-141231851 CCAGCTCCTCCCGGCGCGAGGGG - Exonic
965561181 3:170063625-170063647 CCAGCTCTTCCACCGGAGAGAGG - Intronic
967812534 3:193772775-193772797 CCAGCACTTCCCCAGAAGAGAGG - Intergenic
968080105 3:195839952-195839974 CCAGCTCCTCCCCAGGAGGAGGG - Intergenic
968090793 3:195897091-195897113 ACAGCTCCTCCCCCAGCCAGAGG + Intronic
969052054 4:4380090-4380112 CCAGCTCCTGTCCTAGAGACAGG + Intronic
969075872 4:4577252-4577274 CCACCTCCTCCCCATGCTAGGGG + Intergenic
969308197 4:6337410-6337432 CCAGCACCTGCCCAGGTGAGTGG + Intronic
969496608 4:7529915-7529937 CCAGCCCCTCCCCAGGATGGCGG - Intronic
972261690 4:37415357-37415379 CCAGCTTCTCCACATGAGAAGGG - Intronic
976322878 4:83735664-83735686 CCATTTCCTCCCCAATAAAGTGG - Intergenic
976383975 4:84434068-84434090 CCAGCTGCTCCCTAACACAGGGG + Intergenic
976496679 4:85738208-85738230 CCACTTCCTACCCAATAGAGTGG - Intronic
976874637 4:89837590-89837612 CCAGCAGCTCCCCAAGGGATAGG - Intronic
978348511 4:107797225-107797247 CCATCTCCTTCCCAAGAAAGGGG + Intergenic
980064552 4:128171132-128171154 CCGGCCCCACCCCAAGAGATAGG + Intronic
986132352 5:4943039-4943061 CCAGCTCCTCCCGCAGTGCGGGG - Intergenic
988481616 5:31636187-31636209 CCATCTCCTGGCCAAGAAAGGGG - Intergenic
988772769 5:34448832-34448854 CCTGCTCCTCCCCAGGTCAGTGG + Intergenic
994053047 5:95383560-95383582 CCAGCTTCTCTCCTAGTGAGTGG - Intergenic
997395511 5:133556785-133556807 CCAACCCCTTCCCAAGAAAGAGG + Intronic
997719642 5:136067163-136067185 CCATCGCCTCCCCAAGTGATGGG - Intergenic
999121943 5:149216610-149216632 CCAGCATTTCCCCAAGTGAGAGG - Intronic
999250442 5:150179433-150179455 CCAGCTCTTCCACAAGGGAGGGG - Intronic
999795717 5:154988030-154988052 GCACATCCTCCCCAAGGGAGAGG - Intergenic
1001080754 5:168665559-168665581 CCTGCTCCTCCCCAGGAGAGGGG - Intronic
1001379665 5:171295922-171295944 CCAGCCCCTCCCCAAGCAGGAGG + Exonic
1001829521 5:174773914-174773936 CAAGCCCATTCCCAAGAGAGAGG - Intergenic
1001955574 5:175846149-175846171 CCAAGTCCTCCCCAAGGGTGGGG + Intronic
1003530811 6:6936164-6936186 CCAGCACCTGCCCAAGTGTGTGG - Intergenic
1004029562 6:11853008-11853030 ACATATACTCCCCAAGAGAGTGG - Intergenic
1006611466 6:35296804-35296826 CCAGCTCCTTGGGAAGAGAGGGG + Intergenic
1013366714 6:109442689-109442711 CCAGCTCTTCCCCATGACTGGGG - Intronic
1013627041 6:111948927-111948949 CTACCTCCTCCCCAAGGGAGAGG - Intergenic
1016408147 6:143753566-143753588 GCAGCTTTTCCCCAAGACAGAGG + Intronic
1016936334 6:149451378-149451400 CGAGCTCCGCGCCAAGACAGGGG - Exonic
1017512800 6:155129571-155129593 CCAGCTCGTGGCCAACAGAGTGG - Exonic
1018737275 6:166696759-166696781 CCAACTCCCCCACAAGTGAGAGG + Intronic
1019257035 7:59176-59198 CCAGCTCCTTCCCACGATAAGGG - Intergenic
1019502333 7:1370412-1370434 CCACCTCCTCCCAGGGAGAGAGG + Intergenic
1019649771 7:2150510-2150532 CCAGCTCCTCCTCCAAACAGAGG + Intronic
1021898450 7:25259553-25259575 CCAGATCCTCCCCCAGACACGGG + Intergenic
1022409762 7:30130147-30130169 CTAGCTCATCCTCTAGAGAGAGG - Intronic
1023884470 7:44342989-44343011 CCACCTGCAACCCAAGAGAGAGG + Intergenic
1024984503 7:55183528-55183550 CCACCCCCTCCCCAAGACAGTGG - Intronic
1026110033 7:67451720-67451742 CCACCTCCTCCCCTAGAGAGAGG - Intergenic
1026937111 7:74263921-74263943 CTAGCTCCTACCCAGCAGAGGGG - Intergenic
1028332476 7:89611666-89611688 CCAGCCCCACCCCCAGTGAGAGG - Intergenic
1028460985 7:91092322-91092344 CAACCTCCTCCACATGAGAGAGG + Intronic
1028674085 7:93438620-93438642 CCAGCTCCTCTCCATAAGAGAGG - Intronic
1028692362 7:93667839-93667861 CCATCTGCAACCCAAGAGAGGGG - Intronic
1029489298 7:100861636-100861658 CCAACTCCAGCCAAAGAGAGAGG - Intronic
1032089964 7:128906589-128906611 CCAGCACATTCCCCAGAGAGGGG + Intronic
1034412914 7:150950558-150950580 CCAGGTCCTTCCCAAGACACTGG - Intronic
1035005330 7:155653570-155653592 CCAGCCCCTCCCCTCGAGGGAGG - Intronic
1035278070 7:157759856-157759878 CCAGCTCCTCCCCAAGAGAGGGG - Intronic
1035770571 8:2143514-2143536 TCTGCTCCGCCCCAAGAGAAGGG - Intronic
1036567617 8:9951066-9951088 CCAGGTCCTGCAGAAGAGAGAGG - Intergenic
1037482337 8:19315986-19316008 CCAGCTCCGCCTCTAGTGAGCGG - Intronic
1037841750 8:22249988-22250010 CCTTCTACTCCCCAAGAGAAAGG - Intronic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1039359199 8:36857194-36857216 CCAGCTCACCCCCAAGGCAGAGG - Intronic
1041010817 8:53541894-53541916 CCAGCACTTACCCACGAGAGGGG + Intergenic
1049594013 8:143475256-143475278 TGACCTCCTCCCCAAGACAGGGG + Intronic
1049623346 8:143609154-143609176 CCTGCTGCTCCCCATGAGAGGGG + Intronic
1049765135 8:144351704-144351726 CCAGATCCTGCCCCAGAGATGGG + Intergenic
1049785891 8:144450591-144450613 CCAGCTCCTCCTCAAGAGCAAGG - Exonic
1050259443 9:3826025-3826047 GCAGCTCCTCTCAAAGAGGGAGG + Intronic
1051333788 9:16048337-16048359 CCAGCTCCCTCCTCAGAGAGAGG - Intronic
1053274206 9:36771050-36771072 CCAGCTCCTCCCCAAGAACTGGG + Intergenic
1056621789 9:88221000-88221022 CCAGCTCCCGCCAAAGGGAGAGG + Intergenic
1057202399 9:93148913-93148935 CGAGTTCCTCCCCAAGGGATTGG - Intergenic
1057337450 9:94166658-94166680 CCAGCTCCTCACCGACAGGGCGG + Intergenic
1057567974 9:96181734-96181756 ACTGTTCCTCCCCCAGAGAGAGG + Intergenic
1057949992 9:99362129-99362151 TCTGCTCCTCCCAAGGAGAGAGG + Intergenic
1060151922 9:121294367-121294389 CCATTTCCTCCCCGAGAGAAGGG + Intronic
1060547132 9:124468292-124468314 CCTGCTCCTCCCCAGGGAAGTGG - Intronic
1061011980 9:127961245-127961267 CCAGCTGCTTCCCACCAGAGGGG - Intronic
1061902171 9:133678511-133678533 CCAGCTCCTCCCCAGAAAAGTGG - Intronic
1062025117 9:134336654-134336676 CCAGCTCCGAGCCATGAGAGGGG - Intronic
1062083892 9:134638665-134638687 CCAGCTGCTTCCCAAGACAAAGG - Intergenic
1062179370 9:135182768-135182790 CACGCTCCTGTCCAAGAGAGTGG + Intergenic
1062498309 9:136841884-136841906 CCAGCCCCTCCCCAAGGCATTGG - Intronic
1185709987 X:2296323-2296345 CCAGCTTCTGCCCCAGAGGGAGG + Intronic
1187372995 X:18725914-18725936 GCAGCTCCTCCCTTGGAGAGTGG + Intronic
1187507543 X:19888815-19888837 CGACCCCCTACCCAAGAGAGGGG + Intergenic
1187844924 X:23525214-23525236 CCAGCTCAGCCACAGGAGAGTGG + Intergenic
1190266221 X:48828662-48828684 GCAGTTCCTCCCCATGACAGAGG - Intergenic
1199593373 X:149488275-149488297 CCTCGTCCTCCCCGAGAGAGTGG - Intronic
1199598646 X:149527156-149527178 CCTCGTCCTCCCCGAGAGAGTGG + Intronic
1199977657 X:152903861-152903883 CCAGCTCCTTCCCAAGGTGGTGG - Intergenic
1201598053 Y:15694276-15694298 CCATCTCCAACCCATGAGAGAGG + Intergenic