ID: 1035279277

View in Genome Browser
Species Human (GRCh38)
Location 7:157767057-157767079
Sequence TTGCCACAGCTCCCCCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035279272_1035279277 6 Left 1035279272 7:157767028-157767050 CCATACAATAGTCACTCCAGGGG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1035279277 7:157767057-157767079 TTGCCACAGCTCCCCCTGCAGGG No data
1035279265_1035279277 29 Left 1035279265 7:157767005-157767027 CCTCCTCCTGGCACCACCTAGCA 0: 1
1: 0
2: 1
3: 40
4: 350
Right 1035279277 7:157767057-157767079 TTGCCACAGCTCCCCCTGCAGGG No data
1035279264_1035279277 30 Left 1035279264 7:157767004-157767026 CCCTCCTCCTGGCACCACCTAGC 0: 1
1: 0
2: 1
3: 27
4: 332
Right 1035279277 7:157767057-157767079 TTGCCACAGCTCCCCCTGCAGGG No data
1035279267_1035279277 23 Left 1035279267 7:157767011-157767033 CCTGGCACCACCTAGCACCATAC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1035279277 7:157767057-157767079 TTGCCACAGCTCCCCCTGCAGGG No data
1035279274_1035279277 -10 Left 1035279274 7:157767044-157767066 CCAGGGGCTGCCATTGCCACAGC 0: 1
1: 0
2: 4
3: 33
4: 335
Right 1035279277 7:157767057-157767079 TTGCCACAGCTCCCCCTGCAGGG No data
1035279269_1035279277 13 Left 1035279269 7:157767021-157767043 CCTAGCACCATACAATAGTCACT 0: 1
1: 0
2: 2
3: 5
4: 101
Right 1035279277 7:157767057-157767079 TTGCCACAGCTCCCCCTGCAGGG No data
1035279266_1035279277 26 Left 1035279266 7:157767008-157767030 CCTCCTGGCACCACCTAGCACCA 0: 1
1: 0
2: 1
3: 26
4: 258
Right 1035279277 7:157767057-157767079 TTGCCACAGCTCCCCCTGCAGGG No data
1035279268_1035279277 16 Left 1035279268 7:157767018-157767040 CCACCTAGCACCATACAATAGTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1035279277 7:157767057-157767079 TTGCCACAGCTCCCCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035279277 Original CRISPR TTGCCACAGCTCCCCCTGCA GGG Intronic
No off target data available for this crispr