ID: 1035279712

View in Genome Browser
Species Human (GRCh38)
Location 7:157769969-157769991
Sequence TAGGATACACACCCCGACCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035279708_1035279712 10 Left 1035279708 7:157769936-157769958 CCTCTGGTGCAGGCATCATGGCT 0: 1
1: 0
2: 1
3: 22
4: 188
Right 1035279712 7:157769969-157769991 TAGGATACACACCCCGACCTCGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035279712 Original CRISPR TAGGATACACACCCCGACCT CGG Intronic
900978061 1:6029521-6029543 CAGGAGTCACACCCAGACCTGGG + Intronic
905539188 1:38746659-38746681 CAGGATAGACAACCAGACCTCGG + Intergenic
918716743 1:187798340-187798362 TGGGATACCCACCCCAACTTGGG - Intergenic
1066164610 10:32772808-32772830 TGGCATACACACCCCCACCAGGG - Intronic
1071027372 10:81131570-81131592 TAAGAGACACACTCCCACCTTGG - Intergenic
1092374491 12:7943965-7943987 TAGGATACAGTCCTCAACCTTGG - Intergenic
1093534231 12:20203236-20203258 TAGGATACATACTCCTACCAGGG - Intergenic
1101469721 12:104985304-104985326 TGGGATACATACCCAGACATGGG - Intergenic
1121904587 14:97728124-97728146 TAGGCTCCCCACCCCTACCTTGG - Intergenic
1123143498 14:106105923-106105945 TGGGATACACATCCACACCTGGG - Intergenic
1125092364 15:35809273-35809295 GTGGATACAAACCCAGACCTGGG - Intergenic
1126579668 15:50231382-50231404 GGTGATCCACACCCCGACCTTGG + Intronic
1132503938 16:297507-297529 TAGGGGACACAGCCCGACCCTGG - Intronic
1132930203 16:2455162-2455184 TGGGCTTCACACCCAGACCTGGG + Intronic
1133993525 16:10729415-10729437 TGAGACACAAACCCCGACCTTGG + Intergenic
1140133597 16:72185403-72185425 TTGGACACACACCCAGTCCTTGG + Intergenic
1143434496 17:6913868-6913890 TGGGATACACACCCCCACCAGGG + Intronic
1148619306 17:49022497-49022519 CAGGGTACACACCCCACCCTGGG - Intronic
1151677370 17:75605617-75605639 AGGGATACACACACCCACCTTGG - Intergenic
1157539344 18:48488585-48488607 TATTATACAGACCCTGACCTGGG - Intergenic
1159763046 18:72452589-72452611 TTGGATACAAACCCAGAACTAGG - Intergenic
1160242018 18:77131739-77131761 CAGGTCACACACCCCGGCCTCGG + Intronic
1162741017 19:12773798-12773820 TAGAATCCACACCCCCACCATGG + Intronic
933131697 2:78681050-78681072 TGGGATACACACCCCCACCAGGG + Intergenic
933177441 2:79191472-79191494 TAAGATACCCACCCTAACCTTGG + Intronic
940366372 2:152852658-152852680 TGGGATACACACCCCCACCAGGG - Intergenic
943446465 2:187993833-187993855 TGGGATACACACCCCCACTGGGG + Intergenic
946172090 2:217901740-217901762 CAGGATTCACACTCCAACCTGGG + Intronic
1172844223 20:37920180-37920202 TGGGATTCAAACCCAGACCTTGG - Intronic
1174193249 20:48754979-48755001 TAGGATAAATACCCAGAACTTGG - Intronic
950627283 3:14256800-14256822 TAGGAGAGCCACCCCGCCCTAGG - Intergenic
952777309 3:37059053-37059075 TAGGAGACACACATCGTCCTAGG + Intronic
954685360 3:52367211-52367233 TAAAATGCACACCCCGGCCTGGG - Intronic
957281185 3:78153806-78153828 TGGGATACACCCCCTGACCAAGG + Intergenic
964636126 3:158859951-158859973 CAGGATACACACCCCCACTGAGG - Intergenic
968354521 3:198093941-198093963 CAGGATACAGACCCCCCCCTGGG + Intergenic
968640652 4:1712788-1712810 GAGGAGACACGCCCCCACCTGGG - Intergenic
977510321 4:97953716-97953738 CAGGATACACACCCCAACTGGGG - Intronic
978024967 4:103862297-103862319 TTGGATACACACCAAGAACTGGG + Intergenic
983482747 4:168295219-168295241 TTGGATACATACCCAGACATGGG - Intronic
985519814 5:368655-368677 GAGGAAACACACCCTGGCCTTGG - Intronic
988342099 5:29985702-29985724 TAGTAGACACACCATGACCTTGG - Intergenic
990976449 5:61565517-61565539 TTGGATACTCACCACTACCTGGG + Intergenic
994214308 5:97120378-97120400 AAGGATACACACCCCATCCCTGG + Intronic
999202293 5:149825011-149825033 AAGGATAAACAGCCTGACCTGGG + Intronic
1006399586 6:33809198-33809220 TAGCACCCACACCCCGTCCTTGG - Intergenic
1010453495 6:76029246-76029268 GAGGATACAAACCCAGAGCTGGG + Intronic
1012079240 6:94735472-94735494 TGGGATACACATCCCCACCCCGG + Intergenic
1017216068 6:151909178-151909200 TGGGATAGAAACCACGACCTTGG - Intronic
1018530445 6:164757585-164757607 TATGATACACACCACCACCATGG + Intergenic
1025956861 7:66189800-66189822 CAGGATACACACACAGTCCTAGG - Intergenic
1030255718 7:107507110-107507132 CAGGATACACACCCCTACAGGGG - Intronic
1034068987 7:148164422-148164444 TAGGTGACCCACCCTGACCTTGG - Intronic
1035279712 7:157769969-157769991 TAGGATACACACCCCGACCTCGG + Intronic
1038898516 8:31814978-31815000 GAGGATCCACACCCTGTCCTAGG + Intronic
1056538352 9:87550931-87550953 TTGGATACATACCCTGACCCCGG + Intronic
1058275551 9:103037524-103037546 TGGGATACACACCCCCACCAGGG + Intergenic
1059846131 9:118278883-118278905 TAGGATACACTCCCCAAACCTGG - Intergenic
1062073302 9:134570969-134570991 TCAGAAACACATCCCGACCTTGG + Intergenic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1191616558 X:63176245-63176267 TGGGATACACACCCCTCCCAGGG + Intergenic
1191619739 X:63202678-63202700 TGGGATACACACCCCTCCCAGGG - Intergenic
1197538424 X:127723036-127723058 GAGGATATACACCCCCACTTGGG - Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic