ID: 1035283116

View in Genome Browser
Species Human (GRCh38)
Location 7:157789543-157789565
Sequence GGCTGAATTCCCTTGTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035283116_1035283122 8 Left 1035283116 7:157789543-157789565 CCTGACAACAAGGGAATTCAGCC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1035283122 7:157789574-157789596 GGTGGCTCCGTGGTCCCCTGAGG 0: 1
1: 0
2: 2
3: 23
4: 185
1035283116_1035283120 -2 Left 1035283116 7:157789543-157789565 CCTGACAACAAGGGAATTCAGCC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1035283120 7:157789564-157789586 CCACACACCAGGTGGCTCCGTGG No data
1035283116_1035283118 -10 Left 1035283116 7:157789543-157789565 CCTGACAACAAGGGAATTCAGCC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1035283118 7:157789556-157789578 GAATTCAGCCACACACCAGGTGG 0: 1
1: 0
2: 1
3: 61
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035283116 Original CRISPR GGCTGAATTCCCTTGTTGTC AGG (reversed) Intronic
900029986 1:364474-364496 GGCAGAATTCCCATGTGGGCAGG - Intergenic
900050637 1:593538-593560 GGCAGAATTCCCATGTGGGCAGG - Intergenic
901685098 1:10939372-10939394 GGCTGAATTCCCTGGCAGTGCGG - Intergenic
902217140 1:14941380-14941402 GGCTGAGTGCCCATGTTCTCAGG - Intronic
902947422 1:19851818-19851840 GGCTGCATTCCCATATGGTCAGG - Intergenic
904272779 1:29361531-29361553 GGTACAATTCCCTTATTGTCAGG - Intergenic
904716038 1:32468275-32468297 GGCTGACTTCCCTGGTGGTATGG + Intronic
908919454 1:69171557-69171579 GGCTGAATTTGCTTTTTGACTGG + Intergenic
910317207 1:85899982-85900004 GTCTGAATTCACTTGCTGACGGG - Intronic
914792112 1:150887270-150887292 GGCTACATTCACTTGTTGCCAGG - Intergenic
915645402 1:157268411-157268433 AGCTGAAGTGCCTTCTTGTCTGG + Intergenic
920395139 1:205639683-205639705 GGCTGGATTGCCTTGTTATTGGG - Intergenic
923044734 1:230347426-230347448 GGCAGAATTCCCTTTTTCTCGGG + Intronic
923977518 1:239280600-239280622 GGCAGAATTTCCTTTTTGTTGGG - Intergenic
1064571411 10:16697454-16697476 GGCCAAATTGCCTTGTGGTCTGG - Intronic
1067298079 10:44986456-44986478 GGCTGAGACCCCATGTTGTCTGG - Intronic
1070288061 10:75098062-75098084 GGCTTGATTCCCTTGTTCCCTGG - Intronic
1070463636 10:76695272-76695294 GGTTAAATTCCATTGTGGTCTGG + Intergenic
1071741945 10:88369337-88369359 GGCTGAATTCCCTAGAGTTCTGG + Intronic
1077484949 11:2834365-2834387 GGAGGAAATCCCTTGTTCTCCGG + Intronic
1078475453 11:11625359-11625381 GGCTGAATTCCATTAGTGACTGG - Intergenic
1079585863 11:22126475-22126497 GGCTGGCCTCCCTTGTTGTTTGG - Intergenic
1080655525 11:34255024-34255046 GGCTTTATGCCTTTGTTGTCCGG - Intronic
1086213929 11:84354489-84354511 GGCAGAATAACTTTGTTGTCAGG + Intronic
1087737407 11:101850633-101850655 GGCAGAATTCCCTTTTTCTGGGG - Intronic
1099742243 12:86654354-86654376 AGCTGATTTCGATTGTTGTCAGG - Intronic
1102449349 12:113029237-113029259 GGCTGAAATCCCTTGTTCAGGGG - Intergenic
1106784191 13:33090809-33090831 GTCTGAATTCCCTTGTTCCGGGG + Intergenic
1110060438 13:71032918-71032940 GCCTGACCTCCCCTGTTGTCAGG - Intergenic
1112281031 13:98063463-98063485 GACTGAAATCTCTTGTTTTCAGG + Intergenic
1113189318 13:107725833-107725855 GGTTGAATTTCCTTGTAATCTGG - Intronic
1118622089 14:67622809-67622831 GGCTGAAACCGCTTCTTGTCAGG - Intronic
1125188690 15:36963990-36964012 TGTTGAATTCCCTTGCTGACAGG - Intronic
1125282206 15:38054639-38054661 GACAGAATTCCCTTGATTTCAGG - Intergenic
1127750429 15:62035345-62035367 GGCTGAGTTTCCTTTTTTTCAGG - Intronic
1131748324 15:95474923-95474945 GGGTAAATTCCTTTGTTCTCTGG + Intergenic
1131754117 15:95541552-95541574 AGCTGAATTCCCTCTTTGTCCGG - Intergenic
1133629121 16:7602359-7602381 GGCTCCATTGCCTTGTTGTGGGG + Intronic
1134169577 16:11957692-11957714 GGCTGAATTCCTTCTTTTTCAGG - Intronic
1134667639 16:16030668-16030690 TGCTTAGTTTCCTTGTTGTCCGG + Intronic
1136595211 16:31244188-31244210 GGCTGAACTGAATTGTTGTCAGG - Intergenic
1137484639 16:48881204-48881226 GGCAGAATTCCCATGCTATCTGG - Intergenic
1138702777 16:58881996-58882018 GGCTGAATTCACTTAATGGCTGG + Intergenic
1152329647 17:79664954-79664976 GGCTGAATTCTATTATTTTCTGG + Intergenic
1152949771 17:83222086-83222108 GGCAGAATTCCCATGTGGGCAGG + Intergenic
1157579570 18:48765497-48765519 GGCTGACTTCTCTTGCTGCCAGG + Intronic
1157808817 18:50678773-50678795 GGCAGGATCCCCTTGTTTTCTGG + Intronic
1160797603 19:953117-953139 GGCTGAACTCCCTGGTTCTAGGG + Intronic
1162284706 19:9729522-9729544 TGCTGATTTCCCTTGGTGTGTGG + Intergenic
1165927655 19:39336861-39336883 GATTGAACTCCCTTGTTGTAGGG - Intronic
1167396004 19:49229394-49229416 GGCTGAAATCACTTGAGGTCAGG - Intergenic
929599955 2:43198754-43198776 GCCTCACTTCCCTTGTTTTCTGG + Intergenic
930698832 2:54439199-54439221 GGGTGACTTCCCTTGTTGAGGGG + Intergenic
931632228 2:64311566-64311588 GGCTAACTTCCCTCGGTGTCTGG - Intergenic
932890098 2:75587107-75587129 GGCTGAATTCCCTGGGAGTCAGG + Intergenic
933205895 2:79507418-79507440 GGCTGAATTCTCCTTTTATCAGG - Intronic
937952564 2:127399905-127399927 GGCTGAATTCCACTGTATTCTGG - Intergenic
939021522 2:136963373-136963395 GGCTGAATACCCTGGGTGCCAGG + Intronic
939576381 2:143900459-143900481 GGCTGAATTCCCTCTTTCCCAGG + Intergenic
940979081 2:159981359-159981381 GACTGAATTCTCTGGTAGTCTGG + Intronic
1171951401 20:31425658-31425680 GGCTGAATATCCCTGTGGTCTGG - Intergenic
1172819026 20:37715612-37715634 GGCCGAATTCCCTTGTGTACAGG + Intronic
1173417405 20:42869163-42869185 GGCTGAATTCCCATGTCTCCAGG - Intronic
1173994735 20:47329001-47329023 TGCTGAATTCCCTTTTTGCCAGG - Intronic
1176009165 20:62882713-62882735 GGATGAATTCCCTTGTGGATTGG - Intronic
1176291797 21:5049692-5049714 GGCTGTATTCCCAGGGTGTCAGG - Intergenic
1179865459 21:44213949-44213971 GGCTGTATTCCCAGGGTGTCAGG + Intergenic
1180695084 22:17746816-17746838 GGCTGGAATCCCATGTTGCCCGG - Intronic
1184805404 22:46792284-46792306 GGCTGAATGCCCTGCTTGTGTGG + Intronic
949740067 3:7222193-7222215 GTCTGAATGCCTTTTTTGTCAGG + Intronic
954576570 3:51679581-51679603 GGCTGAATGGCTTGGTTGTCTGG + Intronic
954792529 3:53143820-53143842 GGCTGTATTCCCATGCTGTGTGG - Intergenic
959880519 3:111440032-111440054 GACTGAAATCCCTTCTGGTCAGG + Intronic
959917080 3:111828081-111828103 GGCTGAGCTCCTTTGTGGTCTGG - Intronic
960487907 3:118275792-118275814 GGCTGAATTCCCTTTTGGGGTGG - Intergenic
960515955 3:118602987-118603009 TGCTAAATTTCCTGGTTGTCTGG - Intergenic
962358615 3:134716352-134716374 GGCTGAATTGCTCTGTGGTCTGG + Intronic
962927659 3:140010428-140010450 GGCTGGCCTGCCTTGTTGTCTGG + Intronic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
972389356 4:38599800-38599822 AGCTCAATTCCCCTGTGGTCAGG - Intergenic
973971776 4:56220254-56220276 GACTGAAGTCCTTTGTTTTCTGG + Intronic
974246320 4:59324315-59324337 GGCAGAATTTCCTTCTTTTCAGG + Intergenic
975348137 4:73317300-73317322 ACCTGAATTCCCTTTTGGTCTGG - Intergenic
980077475 4:128308962-128308984 AGCTGAATTCCCTCTTTATCTGG + Intergenic
980759101 4:137204828-137204850 GGCAGAATTCCCTTTTTTTAAGG + Intergenic
984791462 4:183618674-183618696 GGCAGAATTCCTTTTTTCTCGGG + Intergenic
985343701 4:188978190-188978212 GGCTGAATGCCTTTGTTGTGGGG + Intergenic
987155999 5:15090236-15090258 CTCTGAATTCCCTGGCTGTCTGG + Intergenic
987365589 5:17146008-17146030 CACTGAATTCCCTGGATGTCAGG - Intronic
988451317 5:31346354-31346376 AGGTGAATTACCTTATTGTCTGG + Intergenic
989217963 5:38924689-38924711 GGCTGAATTCCCTTCTTGCATGG + Intronic
992255131 5:74913742-74913764 GGCTGAATTCGCTTGTTTAGGGG - Intergenic
995651110 5:114369570-114369592 GCCTGAATTCCTTTGTTGAGTGG + Intronic
995856823 5:116601190-116601212 GGCTGAAATCCTGTGTTGACGGG + Intergenic
998882718 5:146659933-146659955 GACTGAATTCCCTTGGTGGATGG - Intronic
1002744003 5:181455898-181455920 GGCAGAATTCCCATGTGGGCAGG + Intergenic
1004025567 6:11815032-11815054 GGCTGAATTCCCGAGCTTTCTGG - Intergenic
1005617548 6:27589148-27589170 GTGTGAATTCCCTTGTAGCCTGG + Intergenic
1008246747 6:49184509-49184531 GGCTTAATTCCCCTGTTATAGGG + Intergenic
1008247175 6:49191659-49191681 GTCTGAATTTCCTTTTTGTAAGG + Intergenic
1011282168 6:85688069-85688091 GGCTTAAATCCTTTGTTGTGAGG - Intergenic
1015905928 6:138116421-138116443 GGCTGAACTCCCTTGAGCTCAGG - Intergenic
1019248862 6:170729127-170729149 GGCAGAATTCCCATGTGGGCAGG + Intergenic
1019898647 7:4002320-4002342 GGCTGAAATTCTTTGTTGTCTGG + Intronic
1023063221 7:36349566-36349588 GGCTGAATTTCTGTGTTATCAGG + Intronic
1023585296 7:41723956-41723978 GTCAGTATTCCCTTGTTTTCTGG + Intergenic
1024985856 7:55192597-55192619 GACTGAAATCCCCTGTTGCCGGG + Intronic
1026144351 7:67733620-67733642 GGCAGAATTCCCTGTTTGTTTGG + Intergenic
1032407310 7:131665948-131665970 GGCAGAATTCCCTCTTGGTCGGG + Intergenic
1034833049 7:154326519-154326541 GACTAATTTCCCTTGTTGCCAGG + Intronic
1035283116 7:157789543-157789565 GGCTGAATTCCCTTGTTGTCAGG - Intronic
1035499182 8:78208-78230 GGCAGAATTCCCATGTGGGCAGG - Intronic
1036744465 8:11394668-11394690 GGGTGAATTCCTTTCTTCTCAGG + Intronic
1039732163 8:40291982-40292004 GGCAGAATTCACTTGTGGTCGGG + Intergenic
1041100785 8:54394927-54394949 GGCTGAATTCCGGTGTTCTTTGG + Intergenic
1043014116 8:74916881-74916903 GGCTTCATTCCCTTGTTTTCTGG - Intergenic
1049707114 8:144048107-144048129 GGCTGGATTCCCTGGAGGTCTGG - Intergenic
1055208528 9:73762274-73762296 GGCTGAAGGCCCTGGTTGTGAGG - Intergenic
1057224358 9:93281588-93281610 TGCTGCATTCTCTTGTTTTCTGG - Intronic
1057931997 9:99201686-99201708 GGGTGAGATGCCTTGTTGTCTGG - Intergenic
1058393036 9:104519293-104519315 GGCAGAATTCCTTTCTTTTCTGG + Intergenic
1059393781 9:114017756-114017778 GGCTGAAGCCCCTTATAGTCTGG + Intronic
1061501057 9:131002223-131002245 GGCAGAATTCCCTTTTCCTCAGG - Intergenic
1203609817 Un_KI270748v1:86391-86413 GGCAGAATTCCCATGTGGGCAGG + Intergenic
1190178509 X:48171299-48171321 GGCTAAACTCCCTTGGTGACAGG + Intergenic
1193296443 X:79838283-79838305 AGCTTTATTCCCTTGTGGTCAGG + Intergenic
1199399224 X:147377077-147377099 GTCAGACTTCCCTTGTTGTCAGG + Intergenic
1201254873 Y:12097407-12097429 GGCTGAAATCATGTGTTGTCAGG - Intergenic