ID: 1035285572

View in Genome Browser
Species Human (GRCh38)
Location 7:157804465-157804487
Sequence CATTCTCTGGAGCAGCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035285572_1035285579 24 Left 1035285572 7:157804465-157804487 CCATGCAGCTGCTCCAGAGAATG 0: 1
1: 0
2: 1
3: 19
4: 234
Right 1035285579 7:157804512-157804534 AGATGATTCTAGACTGTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035285572 Original CRISPR CATTCTCTGGAGCAGCTGCA TGG (reversed) Intronic
900189349 1:1346693-1346715 CATGCTCTGGAGCAGAGGCTGGG + Intronic
900655040 1:3752678-3752700 CATGCTCTGGAGGAGCACCAGGG - Exonic
900688425 1:3964493-3964515 TCTTGTCTGCAGCAGCTGCACGG - Intergenic
900721303 1:4177524-4177546 CATTCTCAGGCCCAGCTCCAAGG + Intergenic
901161385 1:7178740-7178762 CATTCTCCAGAACAGCTACAGGG - Intronic
901252785 1:7793945-7793967 CTTTCTTTCTAGCAGCTGCACGG + Exonic
904086096 1:27909415-27909437 TATTCTCAAGAGCAGCTGCTTGG + Intronic
904890522 1:33776236-33776258 CCTTCTCTGGAGCCCCTGTAGGG - Intronic
905528836 1:38660553-38660575 ATCTGTCTGGAGCAGCTGCAGGG + Intergenic
906964086 1:50439619-50439641 CATACTCAGGAACAGCAGCAGGG - Exonic
907928020 1:58972954-58972976 CATTCTCTGAAGCATGTGAATGG + Intergenic
909068449 1:70963617-70963639 CCATGGCTGGAGCAGCTGCAGGG + Intronic
910749794 1:90616599-90616621 CATTCTCTGGAGCAGTTGCTGGG + Intergenic
911997740 1:104788313-104788335 CATTATGGGAAGCAGCTGCATGG - Intergenic
912456329 1:109800362-109800384 TATTCTTTTGAACAGCTGCATGG - Intergenic
913262653 1:117013730-117013752 CTTTCTCTGAAGCACCTGCCAGG - Exonic
917805538 1:178610026-178610048 CATTCTTTATAGCAGTTGCAGGG - Intergenic
918244305 1:182645490-182645512 CATTTCCAAGAGCAGCTGCAGGG + Intergenic
918606580 1:186434499-186434521 CTTTCTCTGAAGGAGCAGCAAGG - Intergenic
923129326 1:231061542-231061564 CATTGTCTGGAGGTGGTGCAGGG - Intergenic
1062768256 10:81289-81311 CAGTCTCTGCAGCTGCTGAAAGG - Intergenic
1062900233 10:1138351-1138373 CATTGTCTGCTGTAGCTGCAAGG - Intergenic
1063120600 10:3103156-3103178 CATTCTCTGAAGCTGTTGCCAGG + Intronic
1064509478 10:16074202-16074224 GCTTCTCTAGACCAGCTGCAAGG + Intergenic
1065482448 10:26209487-26209509 TATTCTCTTGAGCCGCTTCAAGG + Intronic
1067945530 10:50686026-50686048 CAGTCCCTGGAGCATCTGAAGGG - Intergenic
1070443484 10:76469516-76469538 CAGTCTCTGGAGCAGTGGCTTGG + Intronic
1070754989 10:78986462-78986484 TATTCTGTGGACCAGCCGCATGG - Intergenic
1070785950 10:79162343-79162365 CTTTCTCTAGAGCAGCTGCTAGG + Intronic
1070867043 10:79712899-79712921 CAGTCCCTGGAGCATCTGAAGGG - Intronic
1070880833 10:79851020-79851042 CAGTCCCTGGAGCATCTGAAGGG - Intergenic
1071633955 10:87235122-87235144 CAGTCCCTGGAGCATCTGAAGGG - Intronic
1071647403 10:87367339-87367361 CAGTCCCTGGAGCATCTGAAGGG - Intronic
1072717215 10:97760060-97760082 GCTCCGCTGGAGCAGCTGCAGGG + Exonic
1073420694 10:103421519-103421541 CAGTGCCTGGAGGAGCTGCAGGG + Exonic
1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG + Intronic
1073629609 10:105135243-105135265 CACATTCTGGTGCAGCTGCATGG - Intronic
1074766342 10:116702617-116702639 CAGTGTGTGGAGCAGCTGCCTGG - Intronic
1075241237 10:120780845-120780867 CATGCCCTGGAGGAGCCGCAGGG + Intergenic
1075769397 10:124920036-124920058 CAGTCTCTCGAGTAGCTGCTGGG + Intergenic
1076617147 10:131763042-131763064 AACTCTCAGGAGCAGGTGCAGGG - Intergenic
1076652870 10:132002043-132002065 CATTATCTGGCACAGCTGCTGGG + Intergenic
1078355490 11:10628996-10629018 CCATCTCTTGAGCAGCAGCAGGG - Intronic
1080263920 11:30381127-30381149 GAGTCTTTGGAGCAGCTGCAGGG + Intergenic
1081091131 11:38867441-38867463 CATCCCCTAGAGCAGCTGCAGGG - Intergenic
1081198176 11:40186515-40186537 CAGTCTCTAGTGCAGCTGGAGGG + Intronic
1083016894 11:59463345-59463367 CATTCTCTGGAGCAGATGAGAGG + Intergenic
1084157359 11:67321363-67321385 CATTCTCTGGAGAGGGAGCACGG - Intronic
1084455666 11:69266816-69266838 CTTTCTCTGCACCAGGTGCAGGG - Intergenic
1084654184 11:70505668-70505690 CATTCTCTGGATCTGATGCTTGG + Intronic
1086756892 11:90575960-90575982 CATTCTATGGATTACCTGCAAGG + Intergenic
1087664559 11:101028829-101028851 GATTTTCTGGAAAAGCTGCAGGG - Intergenic
1090752812 11:129762428-129762450 CACTCCCTAGAGCAGATGCAGGG + Intergenic
1093098651 12:15000976-15000998 CATAATCTGCAGCTGCTGCATGG + Intergenic
1094452385 12:30596535-30596557 CACTCTCTGCAGCATCTACAAGG + Intergenic
1097235741 12:57538263-57538285 CATCCTCTGGAGCCTCTCCAAGG + Intronic
1098873579 12:75843726-75843748 CATGCTCTGGAGCAACAGAAAGG + Intergenic
1101476069 12:105049611-105049633 CATCCTCTGGAGCAGAGGAACGG - Intronic
1101493186 12:105229146-105229168 CATTGCCTGGAGCAGCTGGTTGG + Exonic
1101637794 12:106560538-106560560 TATACTCTGGGGCAGATGCAAGG - Intronic
1102164433 12:110795157-110795179 CATTCTCTGGGGCAGTTGCCAGG + Intergenic
1102806694 12:115787623-115787645 CATTGTTTTTAGCAGCTGCATGG - Intergenic
1104067196 12:125315854-125315876 CAGTCTCTGGAGCCACTGCTGGG - Intronic
1105944547 13:25178035-25178057 CTTTCTGTGGAGCAGTTTCACGG + Intergenic
1107064599 13:36199426-36199448 CATTCACTGGAGCTACAGCAAGG + Intronic
1112135616 13:96574870-96574892 CTTGATCTGGGGCAGCTGCAGGG - Intronic
1113447073 13:110377484-110377506 CACACCCAGGAGCAGCTGCAGGG - Intronic
1115204371 14:30886287-30886309 CATCATGTGCAGCAGCTGCAGGG - Exonic
1116998289 14:51346938-51346960 CATTCTCTGAAGCAACAGCCTGG - Intergenic
1118495623 14:66305573-66305595 CATTCTCTGGAGACCCTGAATGG - Intergenic
1118637807 14:67763967-67763989 CATTCCCTGGAGATGCTGCTGGG + Intronic
1119030430 14:71188106-71188128 CAGCCTCTGGAGAAGCTGCGGGG - Intergenic
1119633088 14:76251064-76251086 CCTGCACTGGGGCAGCTGCATGG + Intronic
1122000649 14:98649016-98649038 AATTCTGTGTGGCAGCTGCATGG - Intergenic
1123996572 15:25722109-25722131 CAGCTTATGGAGCAGCTGCAGGG + Intronic
1127896336 15:63302743-63302765 CATTCTCTGTGACAGCTGCGTGG + Intronic
1129172898 15:73818595-73818617 TGCTCTCTGCAGCAGCTGCAGGG - Intergenic
1129669863 15:77601537-77601559 GATTCTATGGTGCAGCTGCCAGG - Intergenic
1130421607 15:83753357-83753379 CATGCTCTGGACCACCTGCAGGG - Intronic
1130817036 15:87447715-87447737 CATTGTCTGGAGCAGCCCAAGGG + Intergenic
1130919193 15:88330005-88330027 CCTTCTCTGCATCATCTGCAGGG - Intergenic
1130934167 15:88454926-88454948 CACTCCCTGGAGCTGATGCATGG + Intergenic
1131305211 15:91236765-91236787 CATTACCTGGGGCAGCTGGAAGG + Intronic
1131730638 15:95276226-95276248 GTTTCTCTGGAGCCCCTGCAAGG - Intergenic
1132157666 15:99507793-99507815 CCTTTTCTGGAGCTGCTACAAGG - Intergenic
1132457157 16:30265-30287 CAGTCTCTGCAGCTGCTGAAAGG - Intergenic
1133091614 16:3408798-3408820 GATCCTCTGGTGCAGCTTCAGGG - Exonic
1133381726 16:5336569-5336591 TATCCTCTGGAGTAGGTGCAGGG + Intergenic
1133647862 16:7781196-7781218 CATTCTGTGGAGGATGTGCATGG + Intergenic
1135747543 16:25029991-25030013 CATTCTCTGGAGGAGGAGGATGG - Intergenic
1136232545 16:28895081-28895103 CAGCCTGTGGAGAAGCTGCAGGG - Intronic
1137886179 16:52106026-52106048 CATGCTCTGGAGAAGATGTAAGG + Intergenic
1138806941 16:60100958-60100980 CATCCCCAGCAGCAGCTGCATGG - Intergenic
1139959637 16:70710226-70710248 CATGCTCTGTGGCATCTGCAAGG + Intronic
1140761242 16:78110857-78110879 CAGTCCCTGGAGCAGGTGCTGGG - Intronic
1141529054 16:84633584-84633606 CATTCTCCGGAACGGCTGCCAGG - Intergenic
1141791641 16:86240820-86240842 CATTCTCTGGGGCATTTTCAAGG - Intergenic
1142174738 16:88639921-88639943 CAGGCTCTGGAGCAGCCGCACGG - Exonic
1142320625 16:89380478-89380500 CGTTCTCTGGAGTAGCCCCAAGG - Intronic
1142784873 17:2213343-2213365 CCTTCTCTGAAGCTGCTGCTTGG - Intronic
1142864298 17:2781027-2781049 CATGATCTGGAGCAGTCGCAGGG + Intronic
1143135896 17:4712036-4712058 ATTGCCCTGGAGCAGCTGCAAGG - Intronic
1143850082 17:9804373-9804395 TATTCTCTGGAGAAGGTGAACGG + Intronic
1148189560 17:45669073-45669095 CATTGCCTGGAGGGGCTGCAGGG - Intergenic
1149532460 17:57406487-57406509 CATTCCCGGGAACAGCTGAAAGG - Intronic
1149966635 17:61170952-61170974 CATTCGCTGGAGCTTATGCAGGG + Intronic
1150437261 17:65163811-65163833 CACTCTCAGATGCAGCTGCAAGG - Intronic
1152216777 17:79037785-79037807 CAGTCTCTTGAGCAGCTGCTGGG + Intronic
1152587823 17:81196933-81196955 CGCTCTCTGCAGCAGCAGCATGG + Exonic
1152961143 18:80786-80808 CAGTCTCTGCAGCTGCTGAAAGG - Intergenic
1155553904 18:26996582-26996604 CATTGGCTGGAGAGGCTGCAAGG + Intronic
1156303542 18:35856273-35856295 CCTCCTCTGGGGCAGCTGCCAGG + Intergenic
1157498016 18:48170372-48170394 CCTTCTCTGGAGAGGCTGCCAGG - Intronic
1159140904 18:64392849-64392871 AAATCTTTAGAGCAGCTGCAGGG + Intergenic
1161780551 19:6289008-6289030 CCTTCTCAGGAGAAGCTGCAAGG + Intergenic
1162914386 19:13866097-13866119 CATTACCGGCAGCAGCTGCAGGG + Intronic
1166863762 19:45824054-45824076 CCATGTCTGGAGGAGCTGCAGGG - Intronic
1167834890 19:52060410-52060432 CATTCTCTGGTGAAACTGGAAGG + Intronic
925449533 2:3956969-3956991 CCTGCTCTGCAGCAGCTGGAGGG - Intergenic
925572707 2:5329054-5329076 CAGTCACTGGAGCAGCAACAGGG - Intergenic
925705957 2:6684885-6684907 AAATCTCAGGAGAAGCTGCAAGG - Intergenic
925931982 2:8715359-8715381 ACTTCTCTGGAGGAGCTGTAAGG + Intergenic
926702281 2:15811507-15811529 GATTCTCTGGAGGGGCTGGATGG + Intergenic
928312102 2:30219794-30219816 GCTTCTCTGCAGCAGCTGCCTGG - Intergenic
931693030 2:64851487-64851509 CAGTCTCTGGAGGAGATGCCTGG - Intergenic
931917249 2:66969555-66969577 GCTTCCCTGGGGCAGCTGCATGG - Intergenic
933773397 2:85757543-85757565 CATTCTCCTGAGCAGCTTCCTGG + Intronic
937242501 2:120471373-120471395 GCTTCTCTGGAGAGGCTGCATGG + Intergenic
937769131 2:125698189-125698211 CATTTGCTGGAGCAAGTGCAGGG - Intergenic
938115522 2:128600744-128600766 CGCTCACTGGAGCATCTGCAGGG - Intergenic
939449816 2:142359241-142359263 TTTCCTCTGGAGCAGTTGCATGG + Intergenic
948028973 2:234800940-234800962 CATTCTCTGCTGTATCTGCAAGG + Intergenic
948807538 2:240459490-240459512 GATTCTCCTGAGCACCTGCAGGG + Intronic
949069341 2:242013987-242014009 GATTTTCTGGGGCAGCTGCAGGG - Intergenic
949071405 2:242027150-242027172 CATTCTCCCCAACAGCTGCATGG + Intergenic
1169459310 20:5780659-5780681 CATGGTCAGGGGCAGCTGCAAGG - Intronic
1170047291 20:12098762-12098784 CATTGTCAGCAGCAGCTGGAAGG + Intergenic
1170273624 20:14556678-14556700 TATTTTCTAGAGCAGCTGCTAGG + Intronic
1171449665 20:25226631-25226653 CATTCACTGAAGCAGCTCAAGGG - Exonic
1172210046 20:33191033-33191055 CCATCTCTGGGGCAGCTGAATGG + Intergenic
1175884138 20:62279324-62279346 CACTCACTTGAGCAGCTCCAGGG - Exonic
1176419749 21:6504621-6504643 CCTGCTCTGGAGCCCCTGCAGGG + Intergenic
1178628973 21:34243050-34243072 CATCCTCTGGGGCAGGTGGAAGG + Intergenic
1179608018 21:42530820-42530842 CATTCTCTGCAGCAGGTACGTGG - Intronic
1179695242 21:43112944-43112966 CCTGCTCTGGAGCCCCTGCAGGG + Intergenic
1180600453 22:17012044-17012066 CAGTCTCTGTAGCTGCTGAAAGG + Intergenic
1180943985 22:19679678-19679700 CGTCCTCTGGAGCAGGTGCTTGG - Intergenic
1181007003 22:20018338-20018360 CATCCTGTGGAGCAGCACCATGG + Intronic
1181287399 22:21763871-21763893 CTCTCTCTGGTGCGGCTGCATGG + Exonic
1181826380 22:25519637-25519659 CATTCTCTGCTGCACCTGGAAGG + Intergenic
1182695512 22:32196705-32196727 TCTTCCCTGGAGCAGCTGAAAGG - Intronic
1183292340 22:37010475-37010497 CATGCTCAGGAGCAGGTGAAAGG - Intergenic
1184358398 22:43997714-43997736 CATTACCTGCAGAAGCTGCAGGG + Intronic
950574674 3:13824937-13824959 CATTCTCTTTAGCAGCTATAGGG - Intronic
950695776 3:14700104-14700126 CATCCCCAGCAGCAGCTGCAAGG - Intronic
953789522 3:45936770-45936792 GTTTCCCTGGAGCAGCTGTAGGG + Intronic
960422543 3:117464834-117464856 CATTCTCTGTGATAGCTGCACGG + Intergenic
961211943 3:125132142-125132164 CATGCTCTGCACCAGCTCCAGGG - Intronic
961327072 3:126115159-126115181 CATCCGCTGGCACAGCTGCAGGG + Intronic
961575637 3:127833739-127833761 CATTCTGTGGGGCAGCAACATGG - Intergenic
961672719 3:128546695-128546717 AGTTCTGTGGAGCAGCTGAACGG + Intergenic
963284309 3:143418144-143418166 CAATCTCTGGACCAGATGCCCGG - Intronic
963882674 3:150546190-150546212 CCTCCTCTGGAGCCGCTGCGAGG + Exonic
966141819 3:176766247-176766269 CACCCTGTGTAGCAGCTGCATGG + Intergenic
966451341 3:180066329-180066351 CATGATCTGGAGCAGCTGGGTGG + Intergenic
967343837 3:188431223-188431245 TATTCACTGGAACAGCTGCCAGG + Intronic
967476909 3:189932455-189932477 CATTCTTTTTAACAGCTGCATGG + Intergenic
968880091 4:3294122-3294144 CTGTCTTTGGAGCTGCTGCAAGG + Intronic
969338070 4:6523194-6523216 TTTCCTCTGGAGCAGCTGCTTGG - Intronic
971276870 4:25206743-25206765 CATACTCTGAATCAGCTACAAGG - Intronic
973199256 4:47481210-47481232 CAGCCTCTGCAACAGCTGCATGG - Intergenic
973571426 4:52243431-52243453 AATTCACTGGAGCATCTGCTTGG + Intergenic
976211921 4:82680371-82680393 GATTCTCTGGAGTAGCAGAAGGG - Intronic
978072598 4:104491475-104491497 CATGCTCTGGGGCAGCGGCGGGG - Exonic
979561104 4:122103119-122103141 CATTCTCTTGGCCAGATGCAAGG + Intergenic
980471817 4:133262864-133262886 GATTCTCTGGAGGGGGTGCACGG + Intergenic
980881406 4:138713524-138713546 CATACCCTGGAGCTGGTGCATGG + Intergenic
982255562 4:153448089-153448111 CATGTTCTGGATCAGCGGCAGGG + Intergenic
983469319 4:168137012-168137034 CACCCTCTGGAGCAGCAGCCTGG + Intronic
984625216 4:181999279-181999301 CACTCTCTGGAGCACCTGCCTGG - Intergenic
985075887 4:186214165-186214187 GAACCTCTGGAGCAGCTGCTGGG + Intronic
985511474 5:316385-316407 CATCCTGTGGATCAGCTGCCGGG + Intronic
985553811 5:546418-546440 CAGGGTCTGGAGCAGCTGCCAGG + Intergenic
985562909 5:600927-600949 CACACACTGGCGCAGCTGCAGGG - Intergenic
985648151 5:1094896-1094918 CATGCTCTCGGGCAGCTGCTAGG - Intronic
985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG + Intergenic
986025339 5:3845341-3845363 AATTCTCTGAAGCTGCTTCAAGG - Intergenic
988092803 5:26564745-26564767 CATTCTCTGGACCAGTTACTTGG - Intergenic
988994368 5:36700629-36700651 CAGTCTCTTGAGTAGCTGCTGGG - Intergenic
989100367 5:37817714-37817736 CATTGGCAGGATCAGCTGCACGG + Intronic
992141156 5:73798535-73798557 CATTCTCTGCAGATGCTGTAAGG + Intronic
992170150 5:74093355-74093377 CTTTCTCTGCTGCAGCTGCTGGG + Intergenic
992326364 5:75664022-75664044 CAGTCTATTGAGAAGCTGCATGG - Intronic
992549800 5:77849714-77849736 CCTTCTCTGGAGAGGGTGCAGGG + Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995575509 5:113527988-113528010 AATTCTCTGGAGTAACTCCATGG - Intronic
996510651 5:124312269-124312291 CGTTCTCTGGAGCTGAAGCATGG - Intergenic
997767248 5:136516985-136517007 CATGTCCAGGAGCAGCTGCATGG + Intergenic
998768877 5:145519085-145519107 ACTTCTCTGGTGGAGCTGCATGG + Intronic
999077157 5:148807182-148807204 CATGCGATGGAGCAGCTGCATGG - Intergenic
999389454 5:151179703-151179725 CATTCCCTGCAGTGGCTGCAAGG + Intergenic
1001749894 5:174120844-174120866 TGTTCCCTGCAGCAGCTGCAGGG + Intronic
1002256925 5:177964726-177964748 CATCCTCTGGAGGAGCTGGGTGG - Intergenic
1002919541 6:1557039-1557061 CATTCTCTATAGCTGCTGCATGG + Intergenic
1004293735 6:14391499-14391521 CATTATCTGGAGCAGCAGAATGG + Intergenic
1005033153 6:21530163-21530185 CATTTTCTGCAGGAGCTGGAAGG - Intergenic
1006444135 6:34069439-34069461 CTCACTCTGGAGCAGCCGCATGG - Intronic
1007717705 6:43866791-43866813 TCTTCTCTGTAGCAGCTGGAAGG - Intergenic
1007904560 6:45446006-45446028 CATTCTGTGGAACTGATGCAAGG + Intronic
1010367310 6:75066291-75066313 CCTTCTCTTGAGAAGCTCCATGG + Intergenic
1012015728 6:93848061-93848083 TATTTTATGGAGCAGCTGCAGGG + Intergenic
1012023877 6:93962986-93963008 CATTCTATGTAGCAGGAGCAAGG + Intergenic
1013600540 6:111700135-111700157 CAGTCTCTTGATCAACTGCAGGG + Exonic
1013623521 6:111914678-111914700 CAGTCTTTGTAGCAGCTCCATGG + Intergenic
1014367564 6:120563293-120563315 CATTATCTGGAGATCCTGCAGGG + Intergenic
1014552736 6:122807550-122807572 AGTTCTTTGGAGCAGCTTCATGG + Intronic
1017702549 6:157089471-157089493 CATTCTTTGGAGAAGCAGAATGG + Intronic
1019939151 7:4275621-4275643 CATTCTTTTAAACAGCTGCATGG - Intergenic
1020112459 7:5455266-5455288 CAGTATCGGGAGCACCTGCAGGG + Intronic
1021114581 7:16733363-16733385 CAACCTCTGGAGTAGCTGGATGG + Intergenic
1021853536 7:24831875-24831897 AATTCTCTAGAGCAGCTGGATGG + Intronic
1021936918 7:25640163-25640185 GATTCACTGGAGCAACTGAAGGG + Intergenic
1027988390 7:85324749-85324771 CATTCTCTGGAGTGGCTGATAGG - Intergenic
1030711539 7:112756002-112756024 TATTCTCTAGAGCTTCTGCAAGG - Intergenic
1035285572 7:157804465-157804487 CATTCTCTGGAGCAGCTGCATGG - Intronic
1035381630 7:158444638-158444660 CGTTCTGGCGAGCAGCTGCACGG - Intronic
1036728356 8:11240243-11240265 CACCCTCTGGTCCAGCTGCATGG + Intergenic
1038493744 8:27987620-27987642 CCTTCTCTGCAGCTGTTGCAGGG - Exonic
1039782182 8:40796662-40796684 CAGTCTCTGCAGCAGCTGTGCGG - Intronic
1045256583 8:100529662-100529684 CATTCCCTCGAGCTGCTGCAAGG + Exonic
1047720250 8:127632351-127632373 CAGTCTCTGTAACAGCTGCAAGG - Intergenic
1049015010 8:139914028-139914050 CATTGTGTGCAGCAGCTGCAAGG + Intronic
1049171028 8:141160760-141160782 GATGCTCACGAGCAGCTGCAGGG - Exonic
1050192060 9:3037038-3037060 GGTTCTCTGAAGCAGCTGCTTGG + Intergenic
1050292342 9:4167955-4167977 CATTCTAAGGGCCAGCTGCAAGG + Intronic
1052999007 9:34567055-34567077 CCATCTTTGGAGCAGTTGCATGG - Intronic
1056209053 9:84348044-84348066 CACTCTCTGGACCAAGTGCAGGG + Intergenic
1057124904 9:92609378-92609400 AAGTCTCTGGAGCAGCAGGAAGG + Intronic
1061389308 9:130308529-130308551 CATTCCTTGCAGCAGCTGCCTGG + Intronic
1062015299 9:134288230-134288252 CTTCCTCTGGAGCAGGGGCAGGG - Intergenic
1062182818 9:135199933-135199955 CAGACCCTGGAGCAGCTCCAGGG + Intergenic
1062737016 9:138143200-138143222 CAGTCTCTGCAGCTGCTGAAAGG + Intergenic
1186288723 X:8073012-8073034 GTTTCTCTGGAGCCTCTGCAGGG - Intergenic
1187493931 X:19777975-19777997 GATCCTCTGGAGCAGCTGGCTGG + Intronic
1189991166 X:46596475-46596497 TATGGTCTTGAGCAGCTGCAAGG - Intronic
1192033092 X:67535832-67535854 CATTCCCAGAAGCAGCTGCCAGG + Intergenic
1192069523 X:67922496-67922518 CATTCTCAGCAGTGGCTGCATGG + Intergenic
1197630565 X:128852982-128853004 CATTGTCTGGTGCTGCTGCTGGG - Intergenic
1197874278 X:131087213-131087235 CATTATCTGAAGCATCTGCGTGG - Intronic
1200399202 X:156009461-156009483 CAGTCTCTGCAGCTGCTGAAAGG + Intronic
1200817539 Y:7549126-7549148 CAATCTCCGGTGCTGCTGCATGG - Intergenic
1201389039 Y:13477352-13477374 CATTCTTTGGAGAAGGTGGAAGG - Intronic
1201567850 Y:15385295-15385317 CAGCTTCTGCAGCAGCTGCAAGG + Intergenic
1202331158 Y:23754517-23754539 AATTCTTTGAAGGAGCTGCAAGG - Intergenic
1202539611 Y:25915543-25915565 AATTCTTTGAAGGAGCTGCAAGG + Intergenic