ID: 1035288075

View in Genome Browser
Species Human (GRCh38)
Location 7:157818997-157819019
Sequence TGCACCCTGAGCCTCCTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 338}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035288072_1035288075 -5 Left 1035288072 7:157818979-157819001 CCAGGCACCCATGAAATCTGCAC 0: 1
1: 0
2: 1
3: 13
4: 155
Right 1035288075 7:157818997-157819019 TGCACCCTGAGCCTCCTCTCAGG 0: 1
1: 0
2: 2
3: 28
4: 338
1035288067_1035288075 18 Left 1035288067 7:157818956-157818978 CCACCTCTCAGGACAGGCCAGGC 0: 1
1: 0
2: 5
3: 36
4: 333
Right 1035288075 7:157818997-157819019 TGCACCCTGAGCCTCCTCTCAGG 0: 1
1: 0
2: 2
3: 28
4: 338
1035288071_1035288075 -4 Left 1035288071 7:157818978-157819000 CCCAGGCACCCATGAAATCTGCA 0: 1
1: 0
2: 1
3: 8
4: 159
Right 1035288075 7:157818997-157819019 TGCACCCTGAGCCTCCTCTCAGG 0: 1
1: 0
2: 2
3: 28
4: 338
1035288068_1035288075 15 Left 1035288068 7:157818959-157818981 CCTCTCAGGACAGGCCAGGCCCA 0: 1
1: 0
2: 1
3: 29
4: 341
Right 1035288075 7:157818997-157819019 TGCACCCTGAGCCTCCTCTCAGG 0: 1
1: 0
2: 2
3: 28
4: 338
1035288070_1035288075 1 Left 1035288070 7:157818973-157818995 CCAGGCCCAGGCACCCATGAAAT 0: 1
1: 0
2: 1
3: 14
4: 193
Right 1035288075 7:157818997-157819019 TGCACCCTGAGCCTCCTCTCAGG 0: 1
1: 0
2: 2
3: 28
4: 338
1035288062_1035288075 25 Left 1035288062 7:157818949-157818971 CCCCGAGCCACCTCTCAGGACAG 0: 1
1: 0
2: 2
3: 17
4: 170
Right 1035288075 7:157818997-157819019 TGCACCCTGAGCCTCCTCTCAGG 0: 1
1: 0
2: 2
3: 28
4: 338
1035288063_1035288075 24 Left 1035288063 7:157818950-157818972 CCCGAGCCACCTCTCAGGACAGG 0: 1
1: 1
2: 3
3: 34
4: 309
Right 1035288075 7:157818997-157819019 TGCACCCTGAGCCTCCTCTCAGG 0: 1
1: 0
2: 2
3: 28
4: 338
1035288065_1035288075 23 Left 1035288065 7:157818951-157818973 CCGAGCCACCTCTCAGGACAGGC 0: 1
1: 0
2: 4
3: 20
4: 232
Right 1035288075 7:157818997-157819019 TGCACCCTGAGCCTCCTCTCAGG 0: 1
1: 0
2: 2
3: 28
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035288075 Original CRISPR TGCACCCTGAGCCTCCTCTC AGG Intronic
900137755 1:1125591-1125613 TTAACCCTTAGCATCCTCTCAGG + Intergenic
900149852 1:1173623-1173645 TGGTCCCTGAGCCGTCTCTCAGG - Intergenic
900464190 1:2816423-2816445 TGCAGCCTTGACCTCCTCTCGGG - Intergenic
900789485 1:4670257-4670279 TTCTCACTGAGCCTCCTCCCTGG - Intronic
901447849 1:9319100-9319122 TGCAACCTCTGCCTCCTCCCAGG - Intronic
901841497 1:11956856-11956878 TGGACCCTGAGCCTGACCTCTGG + Intronic
901883624 1:12208148-12208170 TGCACCCTCCGCCTTCACTCCGG + Exonic
902328470 1:15718193-15718215 TGCTCCCTGGTCCTCCTCCCAGG + Intronic
902781420 1:18707496-18707518 TGCAACCTCTGCCTCCTCCCAGG + Intronic
903287287 1:22285136-22285158 TGCAGACTTAGCCTCCTCCCTGG - Intergenic
903501438 1:23802137-23802159 TGATCCTTGAGTCTCCTCTCTGG - Exonic
904285627 1:29451682-29451704 AGCACCCTGAGCCCCCACTGGGG - Intergenic
904610016 1:31720718-31720740 TGCTCCCTCAGCCTCCTCTCTGG + Intergenic
905096953 1:35480704-35480726 TGCAGCCTCCGCCTCCTCTCGGG - Intronic
905805408 1:40873431-40873453 CGCACTCTGAGCCCCTTCTCTGG - Intergenic
906420732 1:45664752-45664774 TGCAACCTCTGCCTCCTCCCGGG + Intronic
907924544 1:58943665-58943687 TGCTTCCTGAGCTTCCTCTTGGG + Intergenic
908232306 1:62117879-62117901 TGACCCCTAAGTCTCCTCTCTGG + Intronic
908301158 1:62761832-62761854 TGCAGCCTGAGCCTCCCCAACGG + Intergenic
909519224 1:76547776-76547798 TGCAACCTCTGCCTCCTCCCAGG - Intronic
910161004 1:84272084-84272106 AGCAGCCTGAGCCTTGTCTCTGG - Intergenic
910193775 1:84620724-84620746 TGCGCCCAGAGCCTCCCCGCTGG - Intergenic
910399291 1:86822598-86822620 TGCAGCCCGAGCCTCCTAACAGG + Intergenic
910890167 1:92010348-92010370 TGCAACCTCTGCCTCCTCCCAGG + Intronic
912077463 1:105893075-105893097 TGCAGCCTGAGCATCCTCTGTGG - Intergenic
913170866 1:116230990-116231012 TGCTCCCTGGCCCTCCTCCCAGG - Intergenic
915089004 1:153408720-153408742 GGTACCCTGAGCTTTCTCTCTGG - Intergenic
915650508 1:157307222-157307244 TGGCCCCTGAGACCCCTCTCAGG + Intergenic
916072132 1:161176621-161176643 TTCACCCTGATCCTGATCTCTGG - Intronic
916854693 1:168737530-168737552 TGCACCCTAATCCTGCTCTCAGG + Intergenic
917327935 1:173852578-173852600 TGCAACCTCTGCCTCCTCCCGGG + Intronic
917514064 1:175692341-175692363 TGGCCCCTGTGCCTCCTCTCTGG - Intronic
917727112 1:177838708-177838730 TTCACCCAGAACCTCCTCCCAGG - Intergenic
918417755 1:184329742-184329764 TGCAGCCTCACCCTCCTCTGGGG + Intergenic
920117215 1:203629374-203629396 TGCACTCTGAGCCTCCACGATGG - Intronic
920381093 1:205534936-205534958 TTCACCCTGCCCCTACTCTCTGG + Intergenic
923337956 1:232986231-232986253 TCCACCCTGAGCTTCCTCTTCGG - Exonic
923748412 1:236724609-236724631 TGCGACGTGAGACTCCTCTCAGG - Intronic
924805905 1:247361463-247361485 TGCAACTTTTGCCTCCTCTCTGG - Intergenic
1064330767 10:14391943-14391965 TGCAACCTCCGCCTCCTCCCAGG - Intronic
1064435139 10:15304611-15304633 TGCTCCCTCAGCCTCCTGGCTGG + Intronic
1064573581 10:16721359-16721381 TGCACCATGAGCTGCCTTTCTGG + Intronic
1066541872 10:36456390-36456412 TGCAACCTCTGCCTCCTCCCAGG - Intergenic
1066973648 10:42342816-42342838 TGTAACCCCAGCCTCCTCTCAGG + Intergenic
1067212015 10:44267260-44267282 TGAACCCTGTGCCTCCTAACTGG + Intergenic
1068518725 10:58055755-58055777 TGCACGCTCCGCCTCCTCCCGGG - Intergenic
1069844634 10:71362468-71362490 AGCACCCTGGCCCTCCTCTACGG + Exonic
1070329929 10:75409513-75409535 CGGACCCGGGGCCTCCTCTCTGG + Intergenic
1070770849 10:79081564-79081586 TGCAGCCAGAGCCCCCTCACTGG + Intronic
1072094355 10:92162265-92162287 TAAACCCTTAGGCTCCTCTCTGG - Intronic
1072494868 10:95946886-95946908 AGCACACTGAGCCCACTCTCTGG - Intergenic
1072638661 10:97194235-97194257 TGCAACCTCTGCCTCCTCCCAGG - Intronic
1072735744 10:97878202-97878224 AGCTCTCTGAGCCTCATCTCTGG + Intronic
1073146790 10:101286324-101286346 TGCCCACTGAGCCTCCCCACAGG + Intergenic
1073600985 10:104845893-104845915 TGCTCCCTGTGCCTCCCGTCTGG - Intronic
1073818245 10:107231399-107231421 TGCACACAAATCCTCCTCTCAGG + Intergenic
1074929765 10:118112416-118112438 TGCACACAGAGCCTCCTAGCAGG - Intergenic
1074948872 10:118308709-118308731 TGCCCCCTCAGCATCCCCTCGGG - Exonic
1075068984 10:119308458-119308480 TGCCCCCTCAGAATCCTCTCTGG + Intronic
1075797962 10:125134714-125134736 AGCACCCTGGGCCACCTCTGCGG + Intronic
1075863665 10:125698788-125698810 TGCACAGTGAGGCTGCTCTCAGG + Intergenic
1076162701 10:128257494-128257516 TGCCCCTTGATCCTCCTCTTTGG - Intergenic
1076283505 10:129271636-129271658 TGCAACATGTGCCTCCTCTCGGG + Intergenic
1076862996 10:133150802-133150824 AGGGCCCAGAGCCTCCTCTCCGG + Intergenic
1077137373 11:1007731-1007753 TTCACTCTGAGCCTCGGCTCTGG - Intronic
1077246539 11:1542027-1542049 AGGAGCCTCAGCCTCCTCTCTGG - Intergenic
1077302628 11:1854285-1854307 GTCACCCTGGGCCTCCTCTCAGG - Intronic
1078925595 11:15872025-15872047 TGCAACCGTAGCCTTCTCTCTGG - Intergenic
1079013481 11:16848947-16848969 TGCCCCCAGAGCCTACCCTCTGG + Intronic
1080383824 11:31798951-31798973 TGAGCCCAGAGCCTCCACTCCGG - Intronic
1081576655 11:44322908-44322930 CCCACCCTGAGCCCCCACTCTGG - Intergenic
1083401020 11:62423639-62423661 AGCCCCCGGGGCCTCCTCTCTGG + Intergenic
1084237461 11:67797269-67797291 AGCACACTCAGTCTCCTCTCTGG - Intergenic
1084701008 11:70786040-70786062 TGCAGCCCAAGTCTCCTCTCAGG + Intronic
1084834945 11:71795559-71795581 AGCACGCTCAGTCTCCTCTCTGG + Intronic
1085352678 11:75809955-75809977 TGCAGCCTCAACCTCCTCCCAGG - Intergenic
1086268309 11:85028561-85028583 TGCCCCCTCAGCCCCCCCTCTGG - Intronic
1088289584 11:108222255-108222277 TCCACCCCGAGCTTCCCCTCGGG + Intronic
1089367022 11:117926717-117926739 TCCCCCCTGAGGCTCCTTTCTGG - Intronic
1089529384 11:119116551-119116573 AGCACCCTGGGACTCCGCTCAGG - Exonic
1089672708 11:120067580-120067602 AGCACCTTGTGCCTCCTCTGAGG - Intergenic
1090069213 11:123528982-123529004 CAGACCCTGAGCCTGCTCTCTGG - Intronic
1090663803 11:128901704-128901726 TACATCCTGTGCCTCCTTTCTGG - Exonic
1092196302 12:6551590-6551612 CCCACCCAGAGCCTCCTCTAAGG + Intronic
1093002268 12:14010783-14010805 TGCACACTTGGCCTTCTCTCTGG - Intergenic
1098114738 12:67162937-67162959 GGCACCATGCGCCTCCACTCTGG - Intergenic
1098891350 12:76012975-76012997 TGCACCCTGTGTGTGCTCTCTGG - Intergenic
1099978179 12:89568476-89568498 TTCTCCCTCAGCCTCCTCCCTGG + Intergenic
1101121197 12:101582008-101582030 AGCACCCTGCCCCTCCTCACAGG - Intronic
1102147911 12:110668763-110668785 TGTACCCTGATGCTCCTCTGCGG + Intronic
1103973891 12:124689447-124689469 TGCAGCCTCTGCCTCCTCCCGGG - Intergenic
1104383934 12:128332653-128332675 TGGACTCAGAGCCTCCTCCCAGG - Intronic
1105779849 13:23696316-23696338 TGCACCATGCGCCTCCGCCCAGG + Intergenic
1106612233 13:31295272-31295294 TGAACCCTGTGCCTCCTGACTGG - Intronic
1107294200 13:38892920-38892942 TGGACACTGAGCTTCCACTCTGG - Intergenic
1109092897 13:58071164-58071186 TGCAGCCTCACCCTCCTCTTAGG + Intergenic
1110870335 13:80444871-80444893 TCCACCTTACGCCTCCTCTCTGG - Intergenic
1110957322 13:81571380-81571402 TGCAACCTCCGCCTCCTCCCAGG + Intergenic
1111668239 13:91296282-91296304 TGTTCCCTGACCCACCTCTCAGG - Intergenic
1113388452 13:109873053-109873075 TGCGCCCTGAGTCTGCTCCCTGG - Intergenic
1113435276 13:110286419-110286441 TGGACCCTGAGGCTCCTGTCTGG - Intronic
1113988358 13:114337664-114337686 TGCCCCATGATCCTACTCTCAGG - Intergenic
1114431634 14:22666485-22666507 TACAGCCTGAGCCACCACTCTGG - Intergenic
1115867162 14:37760457-37760479 TGACCCCTGTGCCTCCTTTCTGG - Intronic
1116249412 14:42461269-42461291 TTGACCTTTAGCCTCCTCTCAGG - Intergenic
1121126226 14:91408389-91408411 TGCAAACTGAGGCTCCTCTCTGG + Intronic
1121314055 14:92950671-92950693 TGCAGACTGAGTGTCCTCTCAGG - Intronic
1121527689 14:94630766-94630788 GGTACCCAGAGCATCCTCTCTGG + Intergenic
1122414676 14:101543170-101543192 TGCACCCACATCCTCGTCTCAGG - Intergenic
1123904747 15:24910568-24910590 TGCAACCTCTGCCTCCTCCCGGG + Intronic
1124249745 15:28099003-28099025 TGCCCCCTGAGCACCCCCTCCGG - Intronic
1124259485 15:28175656-28175678 TCCACCATGGGCCTTCTCTCAGG - Exonic
1124566179 15:30816508-30816530 TCCACCACGGGCCTCCTCTCAGG + Intergenic
1125875964 15:43145023-43145045 TGCAAGCTCTGCCTCCTCTCTGG - Intronic
1128465399 15:67906722-67906744 TGTAACATGACCCTCCTCTCAGG - Intergenic
1129703825 15:77783258-77783280 TGCACACTGCTCCTCCCCTCAGG - Intronic
1130000127 15:80039045-80039067 TCCACCCTGACCCTCCCCTATGG + Intergenic
1131005920 15:88978214-88978236 TGCACCCTGAGCCTCATAAAAGG - Intergenic
1132062788 15:98706186-98706208 TTCACCATGAGCCTCCTCAGAGG + Intronic
1132285571 15:100659871-100659893 AGCACCGTGGGACTCCTCTCAGG - Intergenic
1132873310 16:2124970-2124992 CTCACCCTGGGCCTGCTCTCGGG - Intronic
1132986482 16:2770157-2770179 TGCACCCTGTGCCTGCCCACTGG + Intronic
1134206256 16:12240673-12240695 TGCAACCTCTGCCTCCTCCCAGG + Intronic
1134552398 16:15144149-15144171 CTCACCCTGGGCCTGCTCTCGGG - Intergenic
1136248058 16:28986333-28986355 TGCCCCCTGAGCCCCACCTCAGG + Intronic
1137958126 16:52853285-52853307 TCCAGCATGAGCGTCCTCTCTGG + Intergenic
1138595153 16:58025856-58025878 GGCTCCCTGCGCCTCCTCCCGGG + Exonic
1141497497 16:84420111-84420133 TGCTCCCTGTCCCTCCTCCCAGG + Intronic
1141680479 16:85541038-85541060 AGCCCCCAGACCCTCCTCTCAGG - Intergenic
1141867369 16:86760068-86760090 CACATGCTGAGCCTCCTCTCGGG - Intergenic
1142363103 16:89636511-89636533 TGCACCCTGACTCTCCCCGCAGG + Exonic
1143319546 17:6059294-6059316 TGGACCCTGGGCCCCCTCTCCGG - Intronic
1143540501 17:7565611-7565633 TGCTCCCTGAATCCCCTCTCAGG - Intronic
1144468277 17:15514855-15514877 TCCAACCTGAGCCCCTTCTCTGG + Intronic
1145816577 17:27799145-27799167 TGCACCATGAGCCTCCTTAGCGG + Intronic
1146042290 17:29467900-29467922 TGCAACCTTCGCCACCTCTCAGG + Intronic
1146258982 17:31409509-31409531 TGCACCCTGATTTTCCTCTGGGG - Intronic
1147338422 17:39740276-39740298 AGGACCCTGAGCCCCCTCCCTGG + Intronic
1147670520 17:42174363-42174385 AGCCCCCTGCCCCTCCTCTCAGG - Intronic
1147946832 17:44085076-44085098 TGCACCCTGAGCATGCTGGCCGG - Exonic
1148091039 17:45022591-45022613 TGTGCCCTGAGCCTCTTGTCAGG - Intergenic
1148385377 17:47230704-47230726 GGCACCCTGTGCCTCCTTACTGG - Intergenic
1148444327 17:47728294-47728316 TCCATCCTCAGCCTCCACTCAGG - Intergenic
1148594504 17:48842546-48842568 TGCAGCCTCAACCTCCTCCCAGG + Intronic
1149950669 17:60981356-60981378 TGCAGCCTCTGCCTCCTCCCAGG + Intronic
1150271549 17:63869055-63869077 TGCAACCTCCGCCTCCTCCCGGG - Intergenic
1150275084 17:63891925-63891947 TGCAACCTCCGCCTCCTCCCAGG - Intergenic
1150277221 17:63906692-63906714 TGCAACCTCCGCCTCCTCCCGGG - Intergenic
1151763684 17:76121652-76121674 TGCACCCTGGGCCTTCTCGGAGG - Intergenic
1152095890 17:78271448-78271470 TGAACCCTGGGCCCGCTCTCAGG - Intergenic
1152529277 17:80907568-80907590 TGCTCCATCAGCCTCCTCCCTGG + Intronic
1155119485 18:22803780-22803802 TGCAACCTCTGCCTCCTCTGGGG + Intronic
1155971988 18:32092041-32092063 TGCACCATGAGCCTCGGCTCCGG + Exonic
1156360626 18:36381510-36381532 GGCACCCTCATCCTCCTCTCGGG - Intronic
1157385982 18:47260421-47260443 TGCACCCCTAGCCCCGTCTCCGG - Intergenic
1157794488 18:50560885-50560907 GGCTCCCTGAGCCTCCTCCCGGG + Intronic
1158170072 18:54587751-54587773 TACACCCTGATCCTCCTATATGG - Intronic
1160222367 18:76986435-76986457 TGCACCCTCAGCCTCTGCTGGGG + Intronic
1160536857 18:79599104-79599126 TGCACCATGACCCACCTCCCGGG + Intergenic
1160868527 19:1266675-1266697 TGCACCCTGATACTCCTCCCGGG - Intronic
1160979746 19:1811528-1811550 TGGGCCTTGTGCCTCCTCTCAGG + Exonic
1161495730 19:4584728-4584750 TGCACCCCGGGTCTCCGCTCAGG + Intergenic
1162884903 19:13689736-13689758 TGCACCCAGATCCTTGTCTCAGG - Intergenic
1164454167 19:28393117-28393139 TCCAACCTCAGCCTCCTCTGAGG - Intergenic
1165292168 19:34895511-34895533 TGCAACCTCTGCCTCCTCCCGGG - Intergenic
1165430089 19:35767410-35767432 TGCACCCCCAGCCTCCACCCCGG + Intronic
1166174320 19:41055174-41055196 TCCACCCTGAGCTGCCTATCTGG - Intergenic
1166281384 19:41796552-41796574 TCCATGCTGAGCCTCCTCCCAGG - Exonic
1166863806 19:45824279-45824301 TGCTTCCTGAGCCTGCTCTGCGG + Intronic
1167548524 19:50143742-50143764 TCATCCCTGAGCCTCATCTCTGG - Intergenic
1168645301 19:58055605-58055627 GCCCCCCTGAGCCTTCTCTCAGG + Intergenic
925099528 2:1233518-1233540 TGCACCCTGCGGCTCCTGCCGGG - Intronic
925252396 2:2451150-2451172 TGACCCCTGTGCCTCCTCACTGG - Intergenic
926445147 2:12932503-12932525 TGCTCCTAGAGGCTCCTCTCAGG + Intergenic
927131834 2:20066589-20066611 TGCAGAGTGAGCCTCTTCTCTGG + Intergenic
927850839 2:26498335-26498357 AGCGCCCTCAGCTTCCTCTCGGG - Intronic
928029682 2:27767862-27767884 TGCACATTGAGCATCCTCTTGGG - Intergenic
928031796 2:27786368-27786390 TCCACCTTGTGCCTCCACTCTGG - Intronic
928126933 2:28623295-28623317 TTTCCCTTGAGCCTCCTCTCTGG - Intronic
929257678 2:39830434-39830456 TGAACCCTGTGCCTCCTGACTGG - Intergenic
929827651 2:45321851-45321873 TGCACCCTTGGCATCCTCGCTGG - Intergenic
931202788 2:60116393-60116415 TGCACCCAGAGCCACATCTGTGG + Intergenic
931480454 2:62633962-62633984 TGAACCCTGTGCCTCCTCACTGG + Intergenic
932577324 2:72969982-72970004 TGCTCCTGGAGCCTCCTCTGAGG - Intronic
935400994 2:102660137-102660159 CACACCCTGTGCTTCCTCTCAGG + Intronic
937265377 2:120611932-120611954 CCCATCCTGAGCCTCCTCTGAGG + Intergenic
937693066 2:124778212-124778234 TACAGCCTCAGCCACCTCTCTGG - Intronic
937943482 2:127309613-127309635 TGTCCCCTGAGGCTCCTCTTAGG + Intronic
941872420 2:170399813-170399835 TGCAACCTGAACCTCTTATCTGG - Intronic
942298191 2:174537326-174537348 TTCTCCCTGCGCTTCCTCTCTGG - Intergenic
945259257 2:207829350-207829372 TGCACCCTCTGCCTCCTCCTGGG + Intronic
946164573 2:217856220-217856242 AGCACCCTGAGCCACTTCTTAGG - Intronic
947331495 2:229033914-229033936 TGCACCCTTTGCCTTTTCTCTGG - Intronic
948269710 2:236664937-236664959 TTCAACCTGTGCCTCCTCTGAGG + Intergenic
948804276 2:240446771-240446793 TGCTCCCCAAGTCTCCTCTCTGG - Intronic
948834054 2:240616044-240616066 TCCACCCTTAGCCTCCTCCACGG + Intronic
1170390530 20:15868230-15868252 TGTACCCTCAGCCTGGTCTCTGG + Intronic
1170993076 20:21323102-21323124 TGTCCCTTGAGCCTCCTCTCTGG + Intronic
1172250797 20:33477771-33477793 TGCACTCTGGGCCTCCCATCTGG - Intergenic
1174113765 20:48213518-48213540 TGCAACCAGAGGCTCCACTCTGG - Intergenic
1174464075 20:50703646-50703668 GGGAGCCTGAGCCTCCCCTCTGG - Intergenic
1174516610 20:51097265-51097287 TGCAACCTGTGCCTCAGCTCTGG - Intergenic
1174520033 20:51122260-51122282 TCTTCCCTTAGCCTCCTCTCTGG + Intergenic
1175216994 20:57396512-57396534 TGCACCCAGAGCCTCTCCTTGGG + Intronic
1175341129 20:58229591-58229613 TGAACACTCAGCCTCATCTCCGG - Intergenic
1175977901 20:62722275-62722297 GGCACCTTCAGCCTCCTCTGTGG + Intronic
1176070033 20:63221454-63221476 TGCTCCCTGAGCCTCCACCTTGG - Intergenic
1177122998 21:17161664-17161686 TGCACTCACAGCCTCCTCTGGGG - Intergenic
1178664390 21:34533926-34533948 GCCACCCTGAGCCTCCTTGCTGG - Intronic
1178808652 21:35860734-35860756 TTCAGCCAGAGCGTCCTCTCTGG - Intronic
1180130214 21:45822257-45822279 TGCAGCCTGAGCCTTTCCTCTGG + Intronic
1180742665 22:18064653-18064675 TGTACCCTGAGGCTCCCCTTGGG - Intergenic
1181134025 22:20751757-20751779 TGCACCAAGAGCCAGCTCTCAGG + Intronic
1181346953 22:22226298-22226320 TGCAGCCTCTGCCTCCTCCCAGG - Intergenic
1181494967 22:23282600-23282622 TGCAGCCTGAGGTTCTTCTCGGG - Intronic
1181556810 22:23675918-23675940 GGCCCCTTGAGCCTCCTGTCAGG - Intergenic
1183020439 22:35022276-35022298 TGCAACCTGCGCCTCCTCCGTGG - Intergenic
1183183565 22:36278142-36278164 TGCTCCCTCAGCCTCCTATGGGG - Intergenic
1183965778 22:41441405-41441427 AGAACCATGAGCCTTCTCTCAGG + Intronic
1184660071 22:45961593-45961615 AGCTCCCTGTGCCTCCTCTAAGG - Intronic
949118156 3:354631-354653 TACATCCAGAGCCTCCTCGCTGG + Exonic
951324403 3:21285194-21285216 TGAACCCTGTGCCTCCTGACTGG - Intergenic
952884930 3:38006422-38006444 CCCAGCCTGAGGCTCCTCTCTGG + Intronic
954375026 3:50189551-50189573 GGCACCCTGAGCCTCCTGGCTGG - Intergenic
954410701 3:50369720-50369742 TGCACACTGAGCGTGCACTCCGG + Intronic
954449501 3:50564017-50564039 TGCACCCTGGGCCTGCTTGCTGG + Intronic
954690531 3:52393214-52393236 GGCAGCCTGGGCCTCCTCTTGGG - Intronic
954869348 3:53755972-53755994 TGGGACCTCAGCCTCCTCTCAGG + Intronic
955407814 3:58636431-58636453 CGCATCCTGACCATCCTCTCTGG - Intronic
955543161 3:59999681-59999703 TGCACCCTCTGCCGCCTCCCAGG + Intronic
955723085 3:61904115-61904137 TCCAGCCTGTGCCTCCTCTCTGG + Intronic
956191322 3:66611013-66611035 TCCAGCCTCAGCCTCCTCCCTGG + Intergenic
959486701 3:106934833-106934855 TGCTCCCTGACTCCCCTCTCAGG - Intergenic
960923014 3:122767477-122767499 TGCAACCTCTGCCTCCTCCCAGG - Intronic
961301422 3:125924509-125924531 AGCACACTCAGTCTCCTCTCTGG + Intergenic
962342374 3:134596417-134596439 TGCATCCTCAGCCTCCTCCAGGG + Intergenic
962841755 3:139238852-139238874 TGCAGCGTCAGCCTCCTCTCCGG + Intronic
963084280 3:141422295-141422317 TGCATCCTGCCCCACCTCTCGGG + Intronic
963671045 3:148252784-148252806 TGCAACCTCCGCCTCCTCCCGGG + Intergenic
963735906 3:149017672-149017694 TGCAACCTCCGCCTCCTCCCAGG + Intronic
966795473 3:183709408-183709430 TGCAACCTCTGCCTCCTCACAGG + Intronic
968046025 3:195624293-195624315 TGCACCCTTATGCTCCCCTCAGG - Intergenic
968285268 3:197504975-197504997 TGCAGCCTAAGCCTCTTGTCCGG + Intergenic
968308629 3:197665794-197665816 TGCACCCTTATGCTCCCCTCAGG + Intergenic
968592302 4:1465249-1465271 TGCCCTCTAAGCCTGCTCTCTGG + Intergenic
968620153 4:1600305-1600327 GGCACCCTGAGGCTCCTGTGAGG - Intergenic
969196294 4:5566404-5566426 AGCACTCTGGGCATCCTCTCGGG - Intronic
969352761 4:6607280-6607302 TGCAGCCTCAACCTCCTCTGGGG + Intronic
969401936 4:6961535-6961557 TTAATCCTGAGTCTCCTCTCGGG + Intronic
969961152 4:10946132-10946154 TGCACCCTGAACTTTGTCTCAGG - Intergenic
970612144 4:17735717-17735739 TGCACATTCAGCATCCTCTCAGG - Intronic
970652828 4:18197554-18197576 TGCATGCTCAGCCTCCACTCCGG - Intergenic
970736728 4:19179220-19179242 TGGACCCTGAGCAGTCTCTCAGG - Intergenic
973030642 4:45333288-45333310 TCCTCCTTGAGCCTCTTCTCTGG + Intergenic
978333248 4:107638550-107638572 TCCACTCTGAGCCCCCACTCTGG - Intronic
978531109 4:109714776-109714798 TGCACCATGACACTCCACTCTGG - Intronic
980275956 4:130651051-130651073 TGACCCCTGAGCCTCCTGACTGG + Intergenic
980333497 4:131440046-131440068 AGCAACCTCAGCCTCATCTCAGG + Intergenic
985682831 5:1265419-1265441 TACACTCTGAGCCACCTCCCTGG + Intronic
985747290 5:1654582-1654604 TGCACCCTTATGCTCCCCTCAGG + Intergenic
985754234 5:1703668-1703690 TGCACCCTGTGCTTCCTGGCTGG - Intergenic
986107138 5:4670759-4670781 TGCACGCAGAGCCTCCACACTGG - Intergenic
986469575 5:8060691-8060713 TCCACCCTGAGGCTTCTCCCAGG + Intergenic
988594498 5:32579554-32579576 TGCTCCCTGTGTCTCCTCTTGGG + Intronic
991010768 5:61880928-61880950 TGCAACAGTAGCCTCCTCTCTGG - Intergenic
993502449 5:88678663-88678685 TGCACCAAGAGCCACCACTCTGG + Intergenic
994607504 5:101987894-101987916 TGCAACCTCCGCCTCCTCCCAGG - Intergenic
996146363 5:119981703-119981725 TGCACCCTGAGGTTCCTCTTTGG + Intergenic
997856666 5:137378945-137378967 TGTACCCTGAGCCACTTCCCAGG + Intronic
998085500 5:139318927-139318949 TGCGGCCTGAGCATCCTCTGTGG - Exonic
998922121 5:147081294-147081316 TGCAGACTGACCGTCCTCTCAGG - Intronic
999131089 5:149283899-149283921 GGGACCCTGAGCTTCCTCTGTGG - Intronic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
999423886 5:151469188-151469210 CCCACCCCGAGTCTCCTCTCAGG + Intronic
1000350129 5:160346540-160346562 TGAACCCTGAGGCTCCACCCAGG + Intergenic
1000513258 5:162209327-162209349 TGCTCCCTGAGGATTCTCTCTGG + Intergenic
1000739228 5:164945551-164945573 TGCGGCCTCAGCCTCCTATCTGG + Intergenic
1000951217 5:167485629-167485651 TGCACTCTGAACCACCTCCCAGG - Intronic
1002438680 5:179251775-179251797 TGCACACAGCACCTCCTCTCTGG - Intronic
1002935355 6:1667023-1667045 TGCACGCTAGGCCTCCTCTTTGG - Intronic
1003118246 6:3297741-3297763 TACACCCTGAGCCAGCGCTCTGG + Intronic
1003122410 6:3329027-3329049 TGCTCCCTGGGGCTCCTCCCTGG - Intronic
1006601799 6:35231278-35231300 TGCACCCAGAGCCACTTCCCAGG + Intronic
1007119355 6:39367349-39367371 GGCTCCCTGTGCCTCCTGTCAGG - Intronic
1007549171 6:42715922-42715944 AGCACCCAGCTCCTCCTCTCAGG + Intronic
1008056028 6:46946796-46946818 TGCACACACAGCCTGCTCTCAGG - Intronic
1009759914 6:67992035-67992057 TGCAGCCTGAAACTCCTCTTAGG - Intergenic
1010042926 6:71407733-71407755 TGCTCCAGGAGACTCCTCTCGGG + Intergenic
1011626879 6:89290387-89290409 GCCACCCTCAGCCACCTCTCAGG + Intronic
1013174285 6:107664039-107664061 TGCACACCGAGCCTCCCCCCCGG + Intergenic
1014069150 6:117161294-117161316 AGGACACTGAGGCTCCTCTCAGG + Intergenic
1015133798 6:129844739-129844761 TGCAGCCTCAGCCTCCTCCCTGG - Intronic
1017787629 6:157769574-157769596 TGGCCCCTGAGCCTCCTTACAGG - Intronic
1018839094 6:167506185-167506207 TCCATCCTGAGTCTCCTTTCTGG + Intergenic
1019474788 7:1238836-1238858 TGCAGCCTGGGCCTCCCCACAGG + Intergenic
1020320479 7:6935762-6935784 AGCACACTCAGTCTCCTCTCGGG - Intergenic
1022030833 7:26490731-26490753 TGCACCCAGAGCTGCCTCACAGG - Intergenic
1022471133 7:30682467-30682489 TGCACTCGGCGGCTCCTCTCCGG - Intronic
1023058988 7:36311658-36311680 TGAACCCTGAGCCTCCAGGCTGG + Intergenic
1023742404 7:43292579-43292601 TGTCCCCTGAGCTCCCTCTCAGG - Intronic
1023828247 7:44024209-44024231 TGCCCCCTGGTTCTCCTCTCAGG - Intergenic
1024241254 7:47438382-47438404 CGCATCCTGAGTCTCCTCTCTGG - Intronic
1026533582 7:71221429-71221451 ACCTCCCGGAGCCTCCTCTCTGG + Intronic
1026867465 7:73832402-73832424 GGCAACCTGAGCCGCCTCTCTGG - Exonic
1028024233 7:85816728-85816750 TGCACCCTGATCATCCTCAGAGG - Intergenic
1028913032 7:96229010-96229032 TGCAGCCTGAGCCTCCCCAACGG + Intronic
1029119010 7:98253704-98253726 AGCACCCTGATCTTCCTCTGAGG - Intronic
1029280086 7:99429870-99429892 TCCAGCCTCAGCCTCCTCTGGGG - Intronic
1029604477 7:101590367-101590389 TGCACCCTGAGCCCCACCACGGG + Intergenic
1029756548 7:102577655-102577677 TGCCCCCTGGTTCTCCTCTCAGG - Intronic
1029774490 7:102676724-102676746 TGCCCCCTGGTTCTCCTCTCAGG - Intergenic
1030076471 7:105741196-105741218 GGCACTGTGGGCCTCCTCTCAGG + Intronic
1030132118 7:106210448-106210470 GGCAACCTGAGCTTTCTCTCTGG - Intergenic
1030933563 7:115556224-115556246 TTCATCCTGAGTTTCCTCTCGGG - Intergenic
1033288232 7:140060792-140060814 TCCACCCTCAGCCTCTTTTCAGG + Intronic
1035288061 7:157818945-157818967 TGCACCCCGAGCCACCTCTCAGG + Intronic
1035288075 7:157818997-157819019 TGCACCCTGAGCCTCCTCTCAGG + Intronic
1035931359 8:3783602-3783624 TGCATCCAGGGCTTCCTCTCAGG - Intronic
1036198382 8:6744370-6744392 TGCTCCCTGTGGCTGCTCTCAGG + Intronic
1037173722 8:15923597-15923619 TGCAGCCTGAGCCTCCTGAACGG + Intergenic
1037960814 8:23096654-23096676 TGCACCCTGATCGGTCTCTCTGG - Intronic
1038132676 8:24750360-24750382 TGCAACCTCAGCCTCCTGCCAGG - Intergenic
1038672274 8:29591965-29591987 TGCTCCCAGACCCTCCCCTCAGG + Intergenic
1039889433 8:41674111-41674133 TGCCCCCTCAGCCTCCGCTCGGG + Intronic
1045063502 8:98427080-98427102 CGCTCCCGGAGCCCCCTCTCCGG - Exonic
1045547194 8:103140073-103140095 AGCATCCTGAACCCCCTCTCTGG - Intronic
1045962058 8:107979868-107979890 TGGTCTCTGTGCCTCCTCTCTGG + Intronic
1047292273 8:123541081-123541103 TGCACCCCGAGCATCCGCCCCGG - Exonic
1047783134 8:128126007-128126029 TGCAGACTCAGCCTCCTCTTGGG + Intergenic
1048198664 8:132353276-132353298 TCCACCCTCTGCCTCCTCCCAGG - Intronic
1048918433 8:139205666-139205688 TGTACCCTGAGCCCCTTCTGGGG - Intergenic
1049778363 8:144416452-144416474 GGCACCCTGACCCTCCCCACAGG - Intronic
1051883490 9:21864833-21864855 TGCTCCTGGAGCCTCTTCTCTGG + Exonic
1053516537 9:38735219-38735241 TGCAGCCTCTGCCTCCTCCCGGG + Intergenic
1056713169 9:89007969-89007991 TGCACCTTGGGACTCCTCCCTGG - Intergenic
1057310776 9:93941730-93941752 TGCACAGTGAGCCTACTCTGGGG - Intergenic
1057452198 9:95174782-95174804 GGCACCCTTAGCCTCCACCCTGG - Intronic
1057859121 9:98625518-98625540 AAGACCCTGAGCCTCTTCTCTGG + Intronic
1059443561 9:114324507-114324529 AGCATCCCGAGCCTCCTCTCTGG + Intronic
1059444752 9:114331282-114331304 AGCATCCCGAGCCTCCTCTCTGG + Intronic
1059954654 9:119502859-119502881 TGAACCCTGTGCCTCCTGACTGG + Intronic
1060727815 9:126017432-126017454 TGCAGCCAAAGCCTCCTCACTGG - Intergenic
1061145278 9:128794088-128794110 CTCATCCTGAGCCTCCTCCCTGG - Intronic
1061750893 9:132776327-132776349 TGCTCCCTGAGCCTCCTTTGAGG - Intronic
1061898221 9:133659484-133659506 TGCCCTCTGAGCTGCCTCTCAGG + Intergenic
1062353439 9:136150159-136150181 TGTGGCCTGAGCCTCCTCCCAGG - Intergenic
1062516276 9:136938205-136938227 TGCTCCCTGACCCAGCTCTCTGG + Intronic
1062733531 9:138121925-138121947 TGCACCCTGGGACTCAGCTCGGG + Exonic
1203784710 EBV:121158-121180 CGCACTCTCAGCCTCCTCCCGGG - Intergenic
1203486177 Un_GL000224v1:57461-57483 TGCAACCTCCACCTCCTCTCTGG - Intergenic
1187144770 X:16627318-16627340 TGCACCCTGGGCAGCCTCTTAGG - Intronic
1187839876 X:23476349-23476371 TGAACCCTGTGCCTCCTGACTGG - Intergenic
1189064872 X:37796825-37796847 TGCAGCCTAAGCCACCTCTCTGG + Intronic
1189560595 X:42187904-42187926 TGCAGCCTGAGCCTCTCCCCTGG + Intergenic
1191088660 X:56597122-56597144 TGAACCCTGTACCTCCTGTCTGG - Intergenic
1192014907 X:67318905-67318927 TGCACCCTGCTCCTCATCACAGG - Intergenic
1192460716 X:71314682-71314704 TGCAGCCTCTGCCTCCTCCCAGG - Intergenic
1193571736 X:83152353-83152375 TGACCCCTGAGCCTCCTGACTGG + Intergenic
1193764522 X:85510192-85510214 TGCAACCTCCGCCTCCTCACTGG - Intergenic
1194091027 X:89581951-89581973 TCCTCCCGGAGCCTCCCCTCGGG - Intergenic
1194672172 X:96747265-96747287 TGCAACCTGAACCTCCACTTGGG - Intronic
1198516487 X:137413519-137413541 TGAACCCTGAGCTGACTCTCAGG - Intergenic
1199903964 X:152206259-152206281 TGCAGCCTCAGCCTCCTCCTGGG + Intronic
1199978840 X:152909709-152909731 TGCAGCCTGGGCCTCTTCCCGGG - Intergenic
1201416495 Y:13752932-13752954 CGCACCCAGAGCCTCCGCGCAGG - Intergenic
1202333237 Y:23777407-23777429 TGTAACCTGACCCTTCTCTCTGG + Intergenic
1202339251 Y:23843769-23843791 TGGACCTCGAGCCTCATCTCAGG - Intergenic
1202531515 Y:25826303-25826325 TGGACCTCGAGCCTCATCTCAGG + Intergenic
1202537532 Y:25892656-25892678 TGTAACCTGACCCTTCTCTCTGG - Intergenic