ID: 1035293183

View in Genome Browser
Species Human (GRCh38)
Location 7:157853076-157853098
Sequence CCAGATCAGCAGGCAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035293177_1035293183 -10 Left 1035293177 7:157853063-157853085 CCTCTCTCCGCCTCCAGATCAGC 0: 1
1: 0
2: 2
3: 99
4: 2456
Right 1035293183 7:157853076-157853098 CCAGATCAGCAGGCAGTGGATGG No data
1035293170_1035293183 30 Left 1035293170 7:157853023-157853045 CCATGGGTGAATGGGGAGGGTGG 0: 1
1: 0
2: 2
3: 46
4: 380
Right 1035293183 7:157853076-157853098 CCAGATCAGCAGGCAGTGGATGG No data
1035293176_1035293183 -6 Left 1035293176 7:157853059-157853081 CCGTCCTCTCTCCGCCTCCAGAT 0: 1
1: 0
2: 5
3: 55
4: 625
Right 1035293183 7:157853076-157853098 CCAGATCAGCAGGCAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035293183 Original CRISPR CCAGATCAGCAGGCAGTGGA TGG Intronic
No off target data available for this crispr