ID: 1035301861

View in Genome Browser
Species Human (GRCh38)
Location 7:157902444-157902466
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 3, 1: 2, 2: 0, 3: 33, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035301861_1035301872 21 Left 1035301861 7:157902444-157902466 CCAGCCCCGCGGTGGCCTGGAGA 0: 3
1: 2
2: 0
3: 33
4: 187
Right 1035301872 7:157902488-157902510 CGTGGCCTCAAGAGCACGTGGGG No data
1035301861_1035301867 3 Left 1035301861 7:157902444-157902466 CCAGCCCCGCGGTGGCCTGGAGA 0: 3
1: 2
2: 0
3: 33
4: 187
Right 1035301867 7:157902470-157902492 CGTGGAAATCAACCTCACCGTGG 0: 3
1: 0
2: 0
3: 1
4: 30
1035301861_1035301869 19 Left 1035301861 7:157902444-157902466 CCAGCCCCGCGGTGGCCTGGAGA 0: 3
1: 2
2: 0
3: 33
4: 187
Right 1035301869 7:157902486-157902508 ACCGTGGCCTCAAGAGCACGTGG No data
1035301861_1035301871 20 Left 1035301861 7:157902444-157902466 CCAGCCCCGCGGTGGCCTGGAGA 0: 3
1: 2
2: 0
3: 33
4: 187
Right 1035301871 7:157902487-157902509 CCGTGGCCTCAAGAGCACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035301861 Original CRISPR TCTCCAGGCCACCGCGGGGC TGG (reversed) Intronic
900188740 1:1344568-1344590 TCCCCAGGCCACCCAGGGCCAGG + Intronic
900323943 1:2098471-2098493 TCTCCAGGCCACTTCAGGACAGG - Intronic
902331928 1:15735068-15735090 TCTGCAGCCCACCCCGGGGCAGG + Intergenic
904033010 1:27544834-27544856 TCCCCAGGCCACCGTGGAGCAGG - Intronic
904577606 1:31514981-31515003 TCTCCAGGCCCCTGCGGTGAGGG + Intergenic
905189700 1:36224202-36224224 TCTCCAGGCCACCCAGGCGGGGG + Intergenic
905651380 1:39659321-39659343 TCTCCAGGCCCCAGCTGCGCAGG + Exonic
906479196 1:46189242-46189264 CCTCCAGGACCCTGCGGGGCTGG - Exonic
907420471 1:54343512-54343534 TGTCCAGGCCACCCAGTGGCAGG + Intronic
910384535 1:86666456-86666478 TCTCCAGACCTGCGCGGGGCTGG + Intergenic
914214046 1:145608231-145608253 TCTCCGGTCCTCCGCGGTGCGGG + Intronic
914465990 1:147928634-147928656 TCTCCGGTCCTCCGCGGTGCGGG + Intronic
922734386 1:227971593-227971615 TGTACAGGCCACCGGGCGGCAGG - Intergenic
922734675 1:227972725-227972747 TGTACAGGCCACCGGGCGGCAGG - Intergenic
922765062 1:228152297-228152319 TCTCCAGGCCCTCCCAGGGCAGG - Intronic
924343529 1:243055064-243055086 TGTACAGGCCACCGGGAGGCAGG + Intergenic
1065617690 10:27545766-27545788 TTTCCTGGCCACCCCGAGGCAGG + Intergenic
1066732586 10:38449040-38449062 TGTACAGGCCACCGGGAGGCAGG - Intergenic
1069660100 10:70117766-70117788 TCACCAGGCCAGGGCAGGGCAGG + Intronic
1069854339 10:71431417-71431439 TATCCAGGCCACTGCCGGGGAGG - Intronic
1072784012 10:98268282-98268304 ACTCCAGGCCCGCCCGGGGCGGG - Intergenic
1073049248 10:100656881-100656903 TCGCAAGGCCACCTCGGGGGCGG - Intergenic
1073266073 10:102229290-102229312 TCTCCAGGGCACCAAGAGGCTGG + Exonic
1073588808 10:104736274-104736296 TCAGGAGGCCACGGCGGGGCGGG + Intronic
1075645093 10:124092027-124092049 CCTCCAGGCAACCGATGGGCCGG - Intronic
1076726767 10:132417473-132417495 CCTCCAGGACACTGCGAGGCAGG - Exonic
1076765618 10:132631357-132631379 TCTCCAGGTCCCTTCGGGGCTGG - Intronic
1077107262 11:847633-847655 TCACAAGGCCACCGAGGGTCAGG - Intronic
1077352732 11:2100401-2100423 TCTGCAGGCCTAGGCGGGGCAGG - Intergenic
1077488858 11:2851305-2851327 TCTCCCTGGCACCGAGGGGCAGG - Intergenic
1079116155 11:17641825-17641847 TCTACAGGCCAGGGCGGGGTGGG - Exonic
1083323953 11:61863930-61863952 TCTCCTGACCTCAGCGGGGCTGG - Intronic
1083341001 11:61958306-61958328 TCTCCAGGGCCCTGCTGGGCTGG + Intronic
1083680817 11:64351162-64351184 GCGCCAGGGCCCCGCGGGGCTGG + Exonic
1083771079 11:64867935-64867957 CCTCCAGGCCACTGCGGCTCTGG + Intronic
1084737335 11:71114012-71114034 TCTCCAGCCAAGCGGGGGGCTGG - Intronic
1085027869 11:73248653-73248675 TCTCCAGCCCTCTGTGGGGCAGG + Intergenic
1088095945 11:106101655-106101677 TTTCCAAGCCACTGCAGGGCAGG - Intergenic
1088462254 11:110093571-110093593 TCTCCAGGCCCAGGCGGGTCGGG + Intronic
1089993412 11:122882868-122882890 TCTCCAGGGCAGCGCCGGGGCGG + Exonic
1090013260 11:123062917-123062939 CCGCCAGGCCGCCGCGGGGTGGG + Intronic
1090807304 11:130210498-130210520 TCTCTAGGCCAGCAAGGGGCTGG + Intergenic
1101561567 12:105862406-105862428 TCTCCAGGCCACTCCCGGGGTGG + Intergenic
1104165843 12:126229072-126229094 TCCCCAGGTCACTGCGTGGCTGG - Intergenic
1107838816 13:44435236-44435258 GCTCCGGGCGAGCGCGGGGCGGG - Intronic
1110119530 13:71865558-71865580 TCTCCAGGCGCCCGCGCGCCCGG + Intronic
1113868917 13:113546302-113546324 ACCCCAGGCCGCCGTGGGGCTGG + Intronic
1113874361 13:113585073-113585095 TCCCCAGGTGACCGCGGGGCGGG + Intronic
1119552031 14:75522020-75522042 TCTCCAGACCACCCCGAGGCTGG + Intergenic
1122531646 14:102431989-102432011 GCTCCAGGCCACCCCTGAGCTGG + Exonic
1122625621 14:103084131-103084153 ACTCACGCCCACCGCGGGGCTGG - Intergenic
1123048857 14:105531143-105531165 GCTCCAGGCCACCTGGGGTCTGG + Intergenic
1202905419 14_GL000194v1_random:68808-68830 CCTCCTGGCAACCGTGGGGCGGG + Intergenic
1123493240 15:20799491-20799513 AGTCCAGGACACCGCGGGGCGGG - Intergenic
1123493608 15:20800905-20800927 TATCCAGGGTGCCGCGGGGCGGG - Intergenic
1123549747 15:21368593-21368615 AGTCCAGGACACCGCGGGGCGGG - Intergenic
1123550116 15:21370007-21370029 TATCCAGGGTGCCGCGGGGCGGG - Intergenic
1124167058 15:27337546-27337568 TCTCAAGGCCACCGTGCTGCTGG + Intronic
1126245291 15:46498121-46498143 TCACCTGGCCACAGCGGGGCTGG + Intergenic
1128146691 15:65335912-65335934 TCCCCAGGCCACCGTGGGTGAGG - Exonic
1128247795 15:66144672-66144694 TCCCCCAGCCACCCCGGGGCTGG + Intronic
1129399058 15:75269284-75269306 TCTCCAGTCCTCCCTGGGGCTGG - Intronic
1129402665 15:75293560-75293582 TCTCCAGTCCTCCCTGGGGCTGG - Intronic
1129728473 15:77916076-77916098 TCTCCAGTCCTCCCTGGGGCTGG + Intergenic
1129942929 15:79513924-79513946 TCTCCAGCCCACCAGTGGGCAGG - Intergenic
1130147186 15:81283021-81283043 TCTCCAGGCCACTGGGAGGGTGG + Intronic
1202958078 15_KI270727v1_random:95811-95833 AGTCCAGGACACCGCGGGGCGGG - Intergenic
1202958446 15_KI270727v1_random:97225-97247 TATCCAGGGTGCCGCGGGGCGGG - Intergenic
1132788013 16:1668917-1668939 TCTCCAGCCCACCACGGAGAAGG - Intronic
1135571102 16:23549902-23549924 CCCCCAGGTCACCACGGGGCTGG + Intronic
1136419593 16:30123324-30123346 GCTCCAGGCCCACGCGGGGCCGG - Intronic
1137401439 16:48156934-48156956 TCTCCAGGAAGCGGCGGGGCCGG - Intergenic
1142001205 16:87665388-87665410 TCAGCAGGTCACAGCGGGGCTGG - Intronic
1142757572 17:2025008-2025030 TCACCATGCCCCTGCGGGGCCGG - Exonic
1143501518 17:7342156-7342178 GTTCCAGGCCACAGCAGGGCTGG + Intronic
1145752657 17:27366513-27366535 TCTCCCGGCCACCACTGGGCAGG - Intergenic
1147423650 17:40334877-40334899 TCTCCAGGTCACTGTGGGGAGGG + Intronic
1148462897 17:47848278-47848300 TCTCCAGGCTGCAGCGGGGAGGG + Exonic
1151552401 17:74829755-74829777 TCTCCAGGCCTGGGCGGGGAGGG - Intronic
1151620359 17:75241239-75241261 TCTCCAGGCCTCCGGGAAGCCGG + Intronic
1152191707 17:78892113-78892135 TGTCCAGGCCACCGACGTGCAGG + Exonic
1152584064 17:81181371-81181393 TCTCCTGACCACAGCGGGGCTGG - Intergenic
1152743317 17:82028071-82028093 GCTCCTGGCCACAGCGGAGCAGG + Exonic
1153900503 18:9614194-9614216 CTGCCAGGCCACCGCGAGGCCGG + Intronic
1154450792 18:14474028-14474050 AGTCCAGGACACCGCGGGGCGGG - Intergenic
1155250656 18:23950212-23950234 TCTGGAGGCCACAGCGGGTCAGG + Intronic
1156088805 18:33440745-33440767 TGTCCAGGCAACCGCGGGGGCGG + Intronic
1156461327 18:37322919-37322941 TCCCAAGGCCACCACGTGGCAGG + Intronic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1160803416 19:980568-980590 TCTCCAGACCACCCAGCGGCCGG - Intergenic
1160978979 19:1807787-1807809 GGTCCAGGCCAGCGTGGGGCCGG - Intronic
1161550645 19:4910298-4910320 TACCATGGCCACCGCGGGGCGGG + Intronic
1162108991 19:8390201-8390223 TCTCCAGGACACCGAGGGCGAGG + Exonic
1162158299 19:8694697-8694719 TCTCCAGGACACAGTGGGACAGG + Intergenic
1162546811 19:11335768-11335790 TGTCCAGGACACAGCGGGCCAGG - Exonic
1163529939 19:17843154-17843176 TCACCAGGTCACTGCGGTGCTGG + Exonic
1164160644 19:22623620-22623642 TATGCTGGCCACCGCCGGGCAGG - Intergenic
1164179543 19:22807131-22807153 TATGCTGGCCACCGCCGGGCAGG + Intergenic
1166081416 19:40446061-40446083 TCTCCAGGCCACCTCTGGGAAGG + Intergenic
1166107353 19:40603931-40603953 GCCCCAGGCCACCTCTGGGCGGG - Intronic
1166249957 19:41563319-41563341 TGTCCTGGCCACCCCGGGACAGG + Intronic
1168092836 19:54096874-54096896 GCTCCAGGACATCGCTGGGCTGG + Exonic
925542008 2:4976609-4976631 TCCCCAGGCCACCATGGGGATGG - Intergenic
927576587 2:24206550-24206572 TCTGAAGGCCACGGTGGGGCAGG + Intronic
927932303 2:27052914-27052936 TCTCAGGGCCAGAGCGGGGCAGG + Exonic
930011450 2:46941145-46941167 TCCCCACGCCCCCGCGGGGGTGG + Intronic
933667099 2:84971975-84971997 CCTGCGGGCGACCGCGGGGCTGG + Intronic
934783170 2:96986027-96986049 TCCACAGGCCACTGCGCGGCCGG - Intronic
935904644 2:107828415-107828437 CATCGAGGCCGCCGCGGGGCCGG - Intronic
935904771 2:107828915-107828937 CATCGAGGCCGCCGCGGGGCCGG - Intronic
935904866 2:107829275-107829297 CATCCAGGCCGCCGCCGGGCCGG - Intronic
938216682 2:129523479-129523501 TTTCCAGGCAACCGGTGGGCAGG + Intergenic
939862376 2:147435644-147435666 TCCCCAGGTCACTGTGGGGCTGG - Intergenic
947563974 2:231181960-231181982 TGTCCAGGCCACCATGGGGCAGG - Intergenic
948422719 2:237870362-237870384 TCTCCAGGCCTCCGTGGGGGCGG + Intronic
1171444714 20:25195515-25195537 TCTCCAGTCCACAGCCGGGCTGG - Intergenic
1172457922 20:35092518-35092540 TTTCCAGGCCGCCGCTGGACGGG - Intronic
1175366679 20:58460889-58460911 TCTCCAGGCCACCGCAGCACAGG - Exonic
1175716056 20:61254340-61254362 TCTCCAGGTCACCGGGAGGGAGG - Intronic
1175928361 20:62481655-62481677 TCCCCGGGCCACAGCTGGGCAGG + Intergenic
1175988599 20:62776625-62776647 TCTCCAGGCCCCCGAGCGGCTGG - Intergenic
1176370237 21:6057997-6058019 GCTCCAGGCCATCGCTGTGCAGG + Intergenic
1176445440 21:6816546-6816568 AGTCCAGGACACCGCGGGGCGGG + Intergenic
1176823608 21:13681579-13681601 AGTCCAGGACACCGCGGGGCGGG + Intergenic
1178351213 21:31873941-31873963 TCTCCCGGGCGCCGTGGGGCTGG + Intronic
1179753282 21:43480544-43480566 GCTCCAGGCCATCGCTGTGCAGG - Intergenic
1179790925 21:43755572-43755594 TCTCCGAGCCACCGGGGAGCCGG - Intronic
1180013982 21:45071165-45071187 TGTCCTGGCCACCGCGGCCCAGG + Intergenic
1180059195 21:45375919-45375941 TCTCCAGGCCACCTCCACGCAGG - Intergenic
1180696434 22:17754172-17754194 TCTCCAGGACTCTGCCGGGCGGG + Intronic
1183318553 22:37149858-37149880 TCTCCAGTCCTCCCCGGTGCTGG + Exonic
1183706401 22:39477289-39477311 TCTGCAGGCCTCGGCTGGGCCGG + Intronic
1184233256 22:43169598-43169620 TGTACAGGCCTCCGCTGGGCCGG + Intronic
1184649603 22:45913508-45913530 TCTCCAGGCCCCCCCAGGGGTGG - Intergenic
1184973973 22:48047797-48047819 TCTCCATGGCTCCGCTGGGCTGG + Intergenic
1185222404 22:49635789-49635811 GCTTCTGTCCACCGCGGGGCTGG + Intronic
1185226489 22:49656608-49656630 TCACCGGGCAAGCGCGGGGCGGG - Exonic
950114589 3:10442403-10442425 TCTGCAGGCCACGGGGTGGCAGG - Intronic
952872018 3:37909465-37909487 GCTCCAGGGCAGTGCGGGGCAGG - Intronic
959591858 3:108090767-108090789 TCTTCAGGGCGCCGCCGGGCTGG + Intronic
959849743 3:111072036-111072058 CCTCCAGGACACAGCGGGGACGG - Exonic
961441624 3:126957036-126957058 TATCCTGGGCACAGCGGGGCGGG + Intronic
965678375 3:171223997-171224019 TCTCCAGTCCACGCCTGGGCTGG - Intronic
967826156 3:193879328-193879350 TCTCCTGGACACCCCGGGTCAGG - Intergenic
967847945 3:194058605-194058627 TCTCCAGGGCCCTGCGGGGTGGG + Intergenic
968132091 3:196197865-196197887 TCAGGAGGCCACCGTGGGGCTGG - Intronic
968503341 4:961111-961133 CCTCAAGGCCACCCCGGTGCAGG - Exonic
968573203 4:1353257-1353279 TCTGCAGGCCACCCCAGAGCGGG + Exonic
969691254 4:8705393-8705415 TCCCCAGGCCACCCTGGGGTGGG - Intergenic
979649691 4:123115116-123115138 GCTCCAGGCCATCGCTGGGCTGG + Intronic
980955138 4:139420341-139420363 TCTCCAGGGCAAGGCTGGGCAGG + Intergenic
996056447 5:118988278-118988300 GCTGCAGGTGACCGCGGGGCTGG - Exonic
1002051798 5:176575596-176575618 TCCCCAGGCCAGGGCTGGGCCGG + Intronic
1002065505 5:176649768-176649790 CCTCCAGGGCCCCGCGGGGCCGG + Intronic
1002102005 5:176862340-176862362 TCGCCAGGCCACCTCGGTGCTGG + Intronic
1004660579 6:17706244-17706266 CCGCCAGGCCACCGCGGCGTCGG + Intronic
1006579586 6:35069078-35069100 TCTCCAGGACAGAGTGGGGCAGG + Intronic
1015309335 6:131748856-131748878 TTTCCAGGCCATGGTGGGGCAGG - Intergenic
1015752884 6:136578580-136578602 TCTTCAGGCCACCGAGAGTCTGG - Intronic
1015925697 6:138308408-138308430 TCTACAGGGCACAGCAGGGCAGG - Intronic
1019923158 7:4175440-4175462 TCTCCCGGTCACCCCGGGGCAGG - Intronic
1022098798 7:27157047-27157069 CCACAAGGCCACCGCGGGGCAGG - Intronic
1023401004 7:39793022-39793044 TGTACAGGCCACCGGGAGGCAGG - Intergenic
1023846485 7:44123718-44123740 TTTCCTGGGCAACGCGGGGCGGG + Intronic
1024261606 7:47577819-47577841 TCTCCACCCCAGCGCTGGGCAGG - Intronic
1024648628 7:51387755-51387777 TGTACAGGCCACCGGGAGGCAGG + Intergenic
1025052333 7:55741677-55741699 TCTACAGGCCACTGGGAGGCAGG - Intergenic
1025129287 7:56367360-56367382 TGTACAGGCCACCGGGAGGCAGG - Intergenic
1025130312 7:56371461-56371483 TGTACAGGCCACCGGGAGGCAGG - Intergenic
1025130632 7:56372759-56372781 TGTACAGGCCACCGGGAGGCAGG - Intergenic
1025130948 7:56374053-56374075 TGTACAGGCCACCGGGAGGCAGG - Intergenic
1025176184 7:56803600-56803622 TGTGCAGGCCACCGCGAGGCAGG + Intergenic
1025178156 7:56812225-56812247 TGTACAGGCCACCGGGAGGCAGG + Intergenic
1025178587 7:56813964-56813986 TGTACAGGCCACCGGGAGGCAGG + Intergenic
1025179025 7:56815754-56815776 TGTACAGGCCACCGGGAGGCAGG + Intergenic
1025179481 7:56817640-56817662 TGTACAGGCCACCGGGAGGCAGG + Intergenic
1025179930 7:56819478-56819500 TGTACAGGCCACCGGGAGGCAGG + Intergenic
1025180405 7:56821460-56821482 TGTACAGGCCACCGGGAGGCAGG + Intergenic
1025180848 7:56823298-56823320 TGTACAGGCCACCGGGAGGCAGG + Exonic
1025181275 7:56825049-56825071 TGTACAGGCCACCGGGAGGCAGG + Intronic
1025181721 7:56826887-56826909 TGTACAGGCCACCGGGAGGCAGG + Intronic
1025690196 7:63750108-63750130 TGTACAGGCCACCGGGAGGCAGG - Intergenic
1025690643 7:63751931-63751953 TGTACAGGCCACCGGGAGGCAGG - Intergenic
1025691094 7:63753754-63753776 TGTACAGGCCACCGGGAGGCAGG - Intergenic
1025691528 7:63755530-63755552 TGTACAGGCCACCGGGAGGCAGG - Intergenic
1025691968 7:63757353-63757375 TGTACAGGCCACCGGGAGGCAGG - Exonic
1025692417 7:63759176-63759198 TGTACAGGCCACCGGGAGGCAGG - Intergenic
1025692861 7:63760999-63761021 TGTACAGGCCACCGGGAGGCAGG - Intergenic
1025693277 7:63762678-63762700 TGTACAGGCCACCGGGAGGCAGG - Intergenic
1025693720 7:63764501-63764523 TGTACAGGCCACCGGGAGGCAGG - Intergenic
1026825309 7:73578146-73578168 TCTCCTGGCCACCCCGGGGACGG + Intronic
1029364400 7:100107665-100107687 TCGCCAGGCCTCTGGGGGGCAGG - Intronic
1029590653 7:101504646-101504668 TCTCCAGGGCACCCAGAGGCTGG + Intronic
1029604493 7:101590418-101590440 GCACCAGGCCACCGCGGGGGTGG - Intergenic
1033422587 7:141216933-141216955 CCTCCAGGACACAGCGGGACAGG + Intronic
1034342666 7:150368503-150368525 TCCCCGGGCGACCGCGTGGCTGG - Intronic
1034540770 7:151756554-151756576 TGTCCAGGCTCCCGCTGGGCAGG + Intronic
1035282892 7:157788507-157788529 TCCACAGGCCTCCACGGGGCTGG + Intronic
1035301824 7:157902308-157902330 TCTCCAGGCCACTGCAGGGTTGG - Intronic
1035301834 7:157902342-157902364 TCTCCAGGCCACCGCGGGGCTGG - Intronic
1035301850 7:157902410-157902432 TCTCCAGGCCACCGCGGGGCTGG - Intronic
1035301861 7:157902444-157902466 TCTCCAGGCCACCGCGGGGCTGG - Intronic
1035301877 7:157902512-157902534 TCTCCAGGCCACCACGGGGCTGG - Intronic
1035301888 7:157902546-157902568 TCTCCAGACCACCGCGGGGCTGG - Intronic
1035681820 8:1493972-1493994 TCTCCTGACCACGGAGGGGCTGG + Intergenic
1038150907 8:24942000-24942022 GCACCAGGCCACCGGGAGGCGGG - Intergenic
1038311482 8:26449289-26449311 GCGCCAGGACACTGCGGGGCGGG + Intronic
1038760913 8:30384164-30384186 GGTCCAGGCCCCGGCGGGGCAGG + Intergenic
1049071510 8:140359103-140359125 TCTGCAGGCCACGGCAGTGCAGG + Intronic
1049429186 8:142551296-142551318 TCTCCAAGCCAGCAGGGGGCGGG - Intergenic
1049549117 8:143248464-143248486 ACTCCACTCCACGGCGGGGCGGG - Intronic
1053903998 9:42823043-42823065 TCTCCAGACCCCTGTGGGGCAGG + Intergenic
1056279776 9:85029821-85029843 GCTCCAGGCCACCGAGAGACTGG + Intergenic
1056581278 9:87889352-87889374 TTCCCAGGCTACCACGGGGCAGG - Intergenic
1060114481 9:120929234-120929256 TCCCCAGACCGCCGCGGGGCGGG + Intergenic
1061196139 9:129108238-129108260 TCTCCAGGCCCCAGAGAGGCGGG - Intronic
1061377906 9:130236896-130236918 TCACCAGGCCCCTGCGAGGCAGG - Exonic
1061537322 9:131258258-131258280 TGTCCACGCCAGGGCGGGGCTGG + Exonic
1062146987 9:134995019-134995041 TCTCCAGGCCCCCATGGGCCAGG + Intergenic
1203523755 Un_GL000213v1:67979-68001 AGTCCAGGACACCGCGGGGCGGG - Intergenic
1203561773 Un_KI270744v1:63978-64000 CCTCCTGGCAACCGTGGGGCGGG - Intergenic
1186493427 X:9992922-9992944 TCTCCCGGCCACCGCTGAGGCGG - Intergenic
1186496724 X:10016460-10016482 TCATCTCGCCACCGCGGGGCTGG - Intronic
1190385352 X:49878904-49878926 TCCCTCGGCCACTGCGGGGCTGG - Intergenic
1201161298 Y:11168989-11169011 CCTCCTGGCAACCGTGGGGCGGG + Intergenic