ID: 1035301888

View in Genome Browser
Species Human (GRCh38)
Location 7:157902546-157902568
Sequence TCTCCAGACCACCGCGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 3, 2: 5, 3: 6, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035301888_1035301895 19 Left 1035301888 7:157902546-157902568 CCAGCCCCGCGGTGGTCTGGAGA 0: 1
1: 3
2: 5
3: 6
4: 136
Right 1035301895 7:157902588-157902610 ACCGTGGCCTCAAGAGCACGTGG No data
1035301888_1035301897 20 Left 1035301888 7:157902546-157902568 CCAGCCCCGCGGTGGTCTGGAGA 0: 1
1: 3
2: 5
3: 6
4: 136
Right 1035301897 7:157902589-157902611 CCGTGGCCTCAAGAGCACGTGGG 0: 3
1: 0
2: 0
3: 9
4: 83
1035301888_1035301893 3 Left 1035301888 7:157902546-157902568 CCAGCCCCGCGGTGGTCTGGAGA 0: 1
1: 3
2: 5
3: 6
4: 136
Right 1035301893 7:157902572-157902594 CGTGGAAATCAACCTCACCGTGG 0: 3
1: 0
2: 0
3: 1
4: 30
1035301888_1035301898 21 Left 1035301888 7:157902546-157902568 CCAGCCCCGCGGTGGTCTGGAGA 0: 1
1: 3
2: 5
3: 6
4: 136
Right 1035301898 7:157902590-157902612 CGTGGCCTCAAGAGCACGTGGGG 0: 3
1: 0
2: 0
3: 11
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035301888 Original CRISPR TCTCCAGACCACCGCGGGGC TGG (reversed) Intronic
900195947 1:1375468-1375490 TTTCCGGACCACCCAGGGGCCGG + Intronic
900674219 1:3874175-3874197 TCTGCAGACCACAGCGTGGGAGG - Intronic
900674247 1:3874409-3874431 TCTGCAGACCACAGCGTGGGAGG - Intronic
900674267 1:3874565-3874587 TCTGCAGACCACAGCGTGGGAGG - Intronic
900674277 1:3874643-3874665 TCTGCAGACCACAGCGTGGGAGG - Intronic
901815120 1:11789385-11789407 CCGCCAGAGCACCGCGGGGTTGG + Exonic
902271972 1:15311122-15311144 TTTCCAGACCACAGCAGGGAGGG + Intronic
902295593 1:15464732-15464754 TCCCCAGACAACCCTGGGGCAGG + Intronic
902331928 1:15735068-15735090 TCTGCAGCCCACCCCGGGGCAGG + Intergenic
903891259 1:26572017-26572039 TTTCCAGACCATCCTGGGGCGGG - Intronic
904033010 1:27544834-27544856 TCCCCAGGCCACCGTGGAGCAGG - Intronic
905150131 1:35920698-35920720 ACTCCAGACCTGGGCGGGGCGGG - Exonic
905905759 1:41617430-41617452 TCTCCAGACAACCCCTGGGGTGG + Intronic
910384535 1:86666456-86666478 TCTCCAGACCTGCGCGGGGCTGG + Intergenic
911348331 1:96722368-96722390 TCTCCCGACCACGGAGGGCCGGG - Intronic
914214046 1:145608231-145608253 TCTCCGGTCCTCCGCGGTGCGGG + Intronic
914465990 1:147928634-147928656 TCTCCGGTCCTCCGCGGTGCGGG + Intronic
914937480 1:151993638-151993660 CGTCCGGAGCACCGCGGGGCTGG - Intronic
915752910 1:158228605-158228627 TCTCCAGACCTGCCCAGGGCTGG + Intergenic
918647812 1:186922484-186922506 TCACCAGAGCAGCGCGTGGCAGG - Intronic
920093719 1:203472160-203472182 TCTCAGGACCACCACGGGGGAGG + Intergenic
921081808 1:211745754-211745776 TTTCCAGATCACAGAGGGGCTGG - Exonic
924636559 1:245793410-245793432 TTTCCAGAGCATGGCGGGGCAGG + Intronic
1063372928 10:5533426-5533448 TCTCCAGACCAGCCTGAGGCCGG - Intergenic
1069976246 10:72215782-72215804 TCTCCAAACCACCTCGAAGCAGG - Intronic
1071799356 10:89042167-89042189 TCTCCAGATCCACGCAGGGCTGG - Intergenic
1076217715 10:128710084-128710106 TCCCCAGACCACCCAGGGCCCGG + Intergenic
1077181605 11:1219527-1219549 TCCCCCGACCACAGCGGTGCAGG - Intergenic
1083323953 11:61863930-61863952 TCTCCTGACCTCAGCGGGGCTGG - Intronic
1084650027 11:70484007-70484029 TCTCCATACCCCTGCTGGGCAGG - Intronic
1084737335 11:71114012-71114034 TCTCCAGCCAAGCGGGGGGCTGG - Intronic
1085027869 11:73248653-73248675 TCTCCAGCCCTCTGTGGGGCAGG + Intergenic
1089338010 11:117738746-117738768 GCTCCAGACCACAGAGGGGTGGG - Intronic
1089499686 11:118925015-118925037 GCTCCAGAACACCGTGGGGAGGG - Intronic
1091461009 12:643274-643296 TCTCCAGACAGCCGCGCCGCCGG - Intronic
1104966693 12:132511539-132511561 TCTCCAGACCTCAGGGGAGCTGG + Intronic
1105242889 13:18623209-18623231 TTTACAAACCACCACGGGGCAGG - Intergenic
1107624986 13:42272549-42272571 TCTGAAGACCACCCCGGGGATGG - Intronic
1113874361 13:113585073-113585095 TCCCCAGGTGACCGCGGGGCGGG + Intronic
1119210154 14:72825556-72825578 TCACCTGAACACCGCAGGGCGGG + Intronic
1119552031 14:75522020-75522042 TCTCCAGACCACCCCGAGGCTGG + Intergenic
1120521747 14:85533368-85533390 CCTCCAGACCCACGCCGGGCGGG + Intronic
1122013754 14:98775653-98775675 TATCCAGACCAACGCTGGTCTGG + Intergenic
1122625621 14:103084131-103084153 ACTCACGCCCACCGCGGGGCTGG - Intergenic
1123493240 15:20799491-20799513 AGTCCAGGACACCGCGGGGCGGG - Intergenic
1123549747 15:21368593-21368615 AGTCCAGGACACCGCGGGGCGGG - Intergenic
1126245291 15:46498121-46498143 TCACCTGGCCACAGCGGGGCTGG + Intergenic
1127319171 15:57826102-57826124 GATCCAGACCACCAAGGGGCTGG - Intergenic
1127988832 15:64096156-64096178 ACTCACGACCACCGCGGCGCCGG - Exonic
1128760767 15:70214787-70214809 TCTCCTGACCACCCTGTGGCAGG - Intergenic
1129399058 15:75269284-75269306 TCTCCAGTCCTCCCTGGGGCTGG - Intronic
1129402665 15:75293560-75293582 TCTCCAGTCCTCCCTGGGGCTGG - Intronic
1129728473 15:77916076-77916098 TCTCCAGTCCTCCCTGGGGCTGG + Intergenic
1129942929 15:79513924-79513946 TCTCCAGCCCACCAGTGGGCAGG - Intergenic
1130046595 15:80450563-80450585 TCTCCTGACCACCTGGAGGCAGG - Intronic
1202958078 15_KI270727v1_random:95811-95833 AGTCCAGGACACCGCGGGGCGGG - Intergenic
1132788013 16:1668917-1668939 TCTCCAGCCCACCACGGAGAAGG - Intronic
1132791463 16:1691762-1691784 TCTCCAAAGCACTGCGGGGGTGG + Intronic
1135419885 16:22298441-22298463 CCTCCAGACCCCTGCGGGGAAGG - Intronic
1136108978 16:28052896-28052918 TCTCCAGAACACAGTTGGGCGGG - Intronic
1136419593 16:30123324-30123346 GCTCCAGGCCCACGCGGGGCCGG - Intronic
1139961306 16:70719055-70719077 GCTGCAGACCACCGCTGGCCTGG + Intronic
1140224417 16:73066676-73066698 TTTCCAGACCACTGCTGGGGCGG - Intergenic
1145393874 17:22478537-22478559 TCTGCACACCACTGCGGGGTTGG - Intergenic
1145752657 17:27366513-27366535 TCTCCCGGCCACCACTGGGCAGG - Intergenic
1145771053 17:27493489-27493511 TCTACCGAGCACCACGGGGCAGG - Intronic
1152528287 17:80902182-80902204 TCTGCAGACCACAACTGGGCAGG + Intronic
1152584064 17:81181371-81181393 TCTCCTGACCACAGCGGGGCTGG - Intergenic
1154450792 18:14474028-14474050 AGTCCAGGACACCGCGGGGCGGG - Intergenic
1156088805 18:33440745-33440767 TGTCCAGGCAACCGCGGGGGCGG + Intronic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1160803416 19:980568-980590 TCTCCAGACCACCCAGCGGCCGG - Intergenic
1160829283 19:1095416-1095438 ACGACAGACCAGCGCGGGGCGGG - Intergenic
1160859589 19:1232052-1232074 TCTCCAGACCAGGGTGGAGCTGG - Intronic
1163705100 19:18807907-18807929 TATCCTCACCACCACGGGGCTGG + Intergenic
1163826766 19:19528461-19528483 TCTCCAGACCTCCGTGGAGAAGG - Intronic
1166081416 19:40446061-40446083 TCTCCAGGCCACCTCTGGGAAGG + Intergenic
1168310797 19:55459617-55459639 TCTTCAGAGCAGTGCGGGGCGGG - Intronic
1168663364 19:58184093-58184115 CCTCCAGAGCACCTCGGGGAGGG + Intronic
928447273 2:31344585-31344607 TCTCCTGACCACAGCCTGGCAGG + Intronic
936433210 2:112482072-112482094 CCTCCAGAGCGCGGCGGGGCCGG + Intergenic
945461633 2:210116297-210116319 TCTCTAGACCCACCCGGGGCTGG + Intronic
945514289 2:210743593-210743615 TCTCAAGACAACCACTGGGCTGG + Intergenic
946614513 2:221495336-221495358 TCTCCTGACAGCCGTGGGGCTGG + Intronic
946898959 2:224354415-224354437 TCTGCAGACCTCCTCTGGGCCGG - Intergenic
947563974 2:231181960-231181982 TGTCCAGGCCACCATGGGGCAGG - Intergenic
948422719 2:237870362-237870384 TCTCCAGGCCTCCGTGGGGGCGG + Intronic
948479331 2:238240228-238240250 TCCCTAGACCCCCGCGGGGGCGG + Intronic
948840525 2:240646710-240646732 TCACCAGACACCCGCGGGGTGGG + Intergenic
1171021385 20:21587195-21587217 TTTCCAGACTCCCGTGGGGCTGG + Intergenic
1171444714 20:25195515-25195537 TCTCCAGTCCACAGCCGGGCTGG - Intergenic
1173076317 20:39823208-39823230 TCTCCAGACCTCTGCCTGGCTGG - Intergenic
1173638872 20:44585041-44585063 TCTCAAGATCCCAGCGGGGCTGG - Intronic
1175366679 20:58460889-58460911 TCTCCAGGCCACCGCAGCACAGG - Exonic
1175789991 20:61735097-61735119 TCTCCAGATCAGCCCAGGGCAGG - Intronic
1175988599 20:62776625-62776647 TCTCCAGGCCCCCGAGCGGCTGG - Intergenic
1176445440 21:6816546-6816568 AGTCCAGGACACCGCGGGGCGGG + Intergenic
1176823608 21:13681579-13681601 AGTCCAGGACACCGCGGGGCGGG + Intergenic
1183318553 22:37149858-37149880 TCTCCAGTCCTCCCCGGTGCTGG + Exonic
1183549112 22:38470845-38470867 GCTCAAGATCACCGGGGGGCTGG + Intronic
1184285533 22:43468983-43469005 TCTACAGAGCACCCCCGGGCTGG - Intronic
1185222404 22:49635789-49635811 GCTTCTGTCCACCGCGGGGCTGG + Intronic
951144775 3:19214114-19214136 ACTCCAGACCACCTCTGGCCTGG + Intronic
954450979 3:50571611-50571633 CCTCCAGACCAGTGCTGGGCAGG + Intronic
955749740 3:62175824-62175846 TCTCCAGATCTCTGTGGGGCTGG - Intronic
965358763 3:167710598-167710620 TCTCCAGACCATCTGGGGCCTGG + Intronic
965678375 3:171223997-171224019 TCTCCAGTCCACGCCTGGGCTGG - Intronic
968591127 4:1460153-1460175 TCCCCAGAGCAGGGCGGGGCTGG - Intergenic
969378725 4:6780550-6780572 TCCCCAGACCTCTGCGTGGCTGG - Intergenic
970004351 4:11396422-11396444 TGTCCAGACCACCCCGGCCCGGG - Exonic
972511479 4:39771497-39771519 TTTCCCCACCCCCGCGGGGCCGG + Intronic
979649691 4:123115116-123115138 GCTCCAGGCCATCGCTGGGCTGG + Intronic
1002065505 5:176649768-176649790 CCTCCAGGGCCCCGCGGGGCCGG + Intronic
1002102005 5:176862340-176862362 TCGCCAGGCCACCTCGGTGCTGG + Intronic
1008043998 6:46833218-46833240 TGTCCAGACCCCTGTGGGGCAGG - Exonic
1012028639 6:94029861-94029883 TCTCCCCACCAGCTCGGGGCTGG - Intergenic
1012352184 6:98265977-98265999 TCTCCAGAACACCTCTGGCCTGG - Intergenic
1012937574 6:105384163-105384185 CCCCCAGACCACGGCTGGGCAGG + Intronic
1015097411 6:129432160-129432182 TCTCCAGACCACAGTAGGCCAGG - Intronic
1019148555 6:169989026-169989048 TCTCCAGACCAGCCTGGTGCTGG - Intergenic
1019279283 7:192190-192212 TCCCCAGAGGAGCGCGGGGCCGG - Intergenic
1019516283 7:1441598-1441620 TCACCAGACCACCACCGGGGGGG + Intronic
1019923158 7:4175440-4175462 TCTCCCGGTCACCCCGGGGCAGG - Intronic
1022098798 7:27157047-27157069 CCACAAGGCCACCGCGGGGCAGG - Intronic
1024261606 7:47577819-47577841 TCTCCACCCCAGCGCTGGGCAGG - Intronic
1025176184 7:56803600-56803622 TGTGCAGGCCACCGCGAGGCAGG + Intergenic
1026825309 7:73578146-73578168 TCTCCTGGCCACCCCGGGGACGG + Intronic
1026911640 7:74094736-74094758 TCACCGGATCACCGCGGGGGTGG - Intronic
1029457065 7:100676686-100676708 CCTCCAGATCACAGCTGGGCTGG + Exonic
1029482195 7:100819923-100819945 TCTCCCCACCACCGCAGAGCAGG - Intronic
1029604493 7:101590418-101590440 GCACCAGGCCACCGCGGGGGTGG - Intergenic
1035301824 7:157902308-157902330 TCTCCAGGCCACTGCAGGGTTGG - Intronic
1035301834 7:157902342-157902364 TCTCCAGGCCACCGCGGGGCTGG - Intronic
1035301850 7:157902410-157902432 TCTCCAGGCCACCGCGGGGCTGG - Intronic
1035301861 7:157902444-157902466 TCTCCAGGCCACCGCGGGGCTGG - Intronic
1035301877 7:157902512-157902534 TCTCCAGGCCACCACGGGGCTGG - Intronic
1035301888 7:157902546-157902568 TCTCCAGACCACCGCGGGGCTGG - Intronic
1035681820 8:1493972-1493994 TCTCCTGACCACGGAGGGGCTGG + Intergenic
1041226621 8:55706714-55706736 TCGCCAGAGCAGCGCGTGGCAGG + Intronic
1043847248 8:85177392-85177414 GGGCCCGACCACCGCGGGGCCGG + Exonic
1049432321 8:142571128-142571150 TCTTCAGAGCACCGAGGAGCGGG - Intergenic
1049549117 8:143248464-143248486 ACTCCACTCCACGGCGGGGCGGG - Intronic
1049705388 8:144039847-144039869 CCTCCAGACCACGGCGAGGGTGG - Intronic
1050066025 9:1760230-1760252 TCCCCAGACCACCTCGGAGAGGG - Intergenic
1051445543 9:17135451-17135473 TTTCCCCACCACAGCGGGGCCGG + Intronic
1053653600 9:40193753-40193775 TGTCCAGACCCCTGTGGGGCAGG + Intergenic
1053903998 9:42823043-42823065 TCTCCAGACCCCTGTGGGGCAGG + Intergenic
1054530987 9:66182471-66182493 TGTCCAGACCCCTGTGGGGCAGG - Intergenic
1060114481 9:120929234-120929256 TCCCCAGACCGCCGCGGGGCGGG + Intergenic
1060194968 9:121617619-121617641 TGTCCAGACCTCAGCGGGGAGGG - Intronic
1203523755 Un_GL000213v1:67979-68001 AGTCCAGGACACCGCGGGGCGGG - Intergenic