ID: 1035303263

View in Genome Browser
Species Human (GRCh38)
Location 7:157911851-157911873
Sequence CAGGGTTAGCAGAAGACGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035303263_1035303269 16 Left 1035303263 7:157911851-157911873 CCTTCCGTCTTCTGCTAACCCTG 0: 1
1: 0
2: 0
3: 8
4: 170
Right 1035303269 7:157911890-157911912 TTCGGTTTTGCATGTCATGGTGG No data
1035303263_1035303267 -2 Left 1035303263 7:157911851-157911873 CCTTCCGTCTTCTGCTAACCCTG 0: 1
1: 0
2: 0
3: 8
4: 170
Right 1035303267 7:157911872-157911894 TGTGTTCTGAGACTCAGATTCGG No data
1035303263_1035303268 13 Left 1035303263 7:157911851-157911873 CCTTCCGTCTTCTGCTAACCCTG 0: 1
1: 0
2: 0
3: 8
4: 170
Right 1035303268 7:157911887-157911909 AGATTCGGTTTTGCATGTCATGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035303263 Original CRISPR CAGGGTTAGCAGAAGACGGA AGG (reversed) Intronic
901510921 1:9717692-9717714 GAGGGGTAGCAGAGGAAGGAGGG + Intronic
907483378 1:54760079-54760101 CAGGGTTTGCAAGAGACAGATGG - Intronic
908152480 1:61316585-61316607 CAGGGTTATCAGCATTCGGAGGG - Intronic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
914245792 1:145885196-145885218 AAGGGTTAGCAGAAGGCACAGGG + Intronic
915062231 1:153195727-153195749 CAGGCTTAGGAGCAGACTGAGGG - Intergenic
920181975 1:204137630-204137652 CAAGGTTAGCATAAGACCTAGGG - Intronic
921165290 1:212502562-212502584 AAGGGTGAGGAGAAGAAGGAGGG + Intergenic
921686790 1:218098499-218098521 CACGGTAAGCAGAAGTCGGAGGG - Intergenic
923017229 1:230136335-230136357 CAGGGTTATCAGAGGATGGCTGG - Intronic
924920060 1:248619482-248619504 CAGGGGCTGCAGAAGAGGGAGGG + Intergenic
1063382094 10:5591840-5591862 CAGGGCTAGCAGCAAAGGGAAGG + Intergenic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1065588190 10:27240686-27240708 CATGTCTAGCAGAAGACAGAGGG + Exonic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066648575 10:37634932-37634954 GAGGGTCAGCAGAAGAATGAGGG + Intergenic
1067018253 10:42773380-42773402 CAGGGATGGGAGAAGACAGAAGG - Intergenic
1072211233 10:93248832-93248854 CCAGGTTAGCAGAGGCCGGATGG + Intergenic
1075664438 10:124220693-124220715 CAGGGCTGGCAGAGGGCGGAAGG - Intergenic
1078153141 11:8776048-8776070 CAGGGCTGGCTGAAGAGGGAAGG - Intronic
1082239707 11:49857085-49857107 CAGGGAGAGAAGAAGACAGAGGG - Intergenic
1083273127 11:61581848-61581870 CAGGGTTGGAAGGAGAAGGAGGG - Intergenic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1085038377 11:73312870-73312892 CAGGGATAGCTGAAGCCAGAAGG - Intronic
1086033967 11:82394587-82394609 CAGGGTTCCCAGAAGAAAGATGG + Intergenic
1088695931 11:112365892-112365914 TAGGGCTAGGAGAAGAAGGAAGG + Intergenic
1089498669 11:118920436-118920458 CAGCCTGAGCAGAAGACGGAGGG - Intronic
1089705900 11:120277379-120277401 CAGGGTTAGAAGGAGGTGGAGGG - Intronic
1093843296 12:23933216-23933238 CAGGGTTAGCTGGAGCAGGATGG - Intronic
1094113111 12:26882349-26882371 CAGGGTGTGGAGAAGAAGGAAGG + Intergenic
1094393452 12:29978478-29978500 CAGAGTTAGCAGCAGACGATGGG + Intergenic
1099423916 12:82499751-82499773 CAGCGGTAGCAGAAGAAGGTGGG + Intergenic
1100346639 12:93738197-93738219 CAGGGTTAGAGGAAAAAGGAAGG + Intronic
1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG + Intergenic
1104579189 12:129997297-129997319 CAGAGGTAGCAGAGGAAGGAAGG + Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106650785 13:31688075-31688097 GAGGGTGAGCAGAAGAGGGTGGG + Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1112724086 13:102282037-102282059 CAGGGTTAGGAGAAGCGGCAAGG - Intronic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124426094 15:29564422-29564444 CAAGTTAAGCAGAAGACAGATGG - Intronic
1125399408 15:39284201-39284223 CAGGTTTAGCAGAAAAAGTATGG + Intergenic
1125599094 15:40906056-40906078 CTGGCTTAGGAGAAGACAGAAGG - Intergenic
1126890952 15:53203675-53203697 CAGGGTGAGGAGAAGAGTGAGGG - Intergenic
1127484504 15:59406824-59406846 CTGGCTTAGCACAAGAAGGAAGG + Intronic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1130917207 15:88314498-88314520 CAGGGTTAGCAGAAGGCCAATGG + Intergenic
1131987669 15:98061393-98061415 CAGGCTCAGAAGAAGACAGAAGG - Intergenic
1132110159 15:99096966-99096988 CAGGCCTAGCAGAGGGCGGATGG + Intergenic
1137476385 16:48812996-48813018 AATGGCTAGCAGAAGAAGGATGG + Intergenic
1137603525 16:49772211-49772233 CAAGGGCAGGAGAAGACGGATGG + Intronic
1138478832 16:57288213-57288235 CAGGGTTGGAAGAACAAGGATGG - Intergenic
1138509975 16:57503102-57503124 CTGGGTAAGGTGAAGACGGAAGG + Intergenic
1139521811 16:67487041-67487063 CAGGGAGAGGAGAAGATGGATGG + Intergenic
1140253507 16:73315689-73315711 CAAGGTTAGCAAAAGAGGAAAGG + Intergenic
1143855416 17:9844450-9844472 CAGGGGTGGAAGAAGAGGGAGGG + Intronic
1146727230 17:35166330-35166352 CAGGGTGAGCAGAAGCCGTGGGG - Intronic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1148319293 17:46736486-46736508 CAGGGTAAGGAGTAGAGGGAGGG - Intronic
1150007208 17:61477183-61477205 AAGGGTTAACAGAAGCCGCAGGG + Intronic
1150724731 17:67642433-67642455 AGGGGGTAGCAGAAGAGGGAAGG - Intronic
1151849751 17:76683368-76683390 AAGGGTTAGCAGACAACGGCCGG - Intronic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155567129 18:27147585-27147607 AAGGGTTAGTAGTAAACGGAGGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1159892445 18:73965377-73965399 CAGGCTTAACAGAAAATGGATGG + Intergenic
1160461997 18:79046489-79046511 CAGGGTCAGCAGGAGACCCAGGG + Intergenic
1160847711 19:1173783-1173805 AAGGGTTACCAGAAAACGAAAGG + Intronic
1162631774 19:11933525-11933547 TAGGGGTGGCAGAAGAGGGAGGG - Intronic
1162739770 19:12767301-12767323 CGGGGCTAGCAGAAGATGGGAGG + Intronic
1163435502 19:17292826-17292848 CAGGATCTGCAGAAGACGCAGGG + Exonic
1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG + Exonic
1164526446 19:29016858-29016880 CAGGGTTGGAAGAAAATGGAGGG + Intergenic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1166796811 19:45431218-45431240 CAGGCTTAACAGAAGACAGCTGG - Intronic
1167924913 19:52813549-52813571 AAAGGTGAGGAGAAGACGGAGGG - Intronic
927292923 2:21422282-21422304 CAGGGAGAGGAGAAGAAGGAGGG + Intergenic
928177907 2:29047430-29047452 CAGAGTTAACAGAAGACCTATGG - Intronic
929314342 2:40459458-40459480 CAGGGTCAGCAGCAGAGGCATGG + Intronic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929958485 2:46478783-46478805 CAAGGTCAGGAGAAGACTGACGG - Intronic
933660071 2:84920427-84920449 CAAGGTCAGAAGAAGAAGGATGG - Intergenic
933762403 2:85681426-85681448 CAGGAATCCCAGAAGACGGAGGG + Intergenic
937735260 2:125280213-125280235 CAGGGATAGCCTAAGACAGAAGG - Intergenic
940905755 2:159167916-159167938 GAGGGTTTTCAGAAGACAGATGG + Intronic
943446376 2:187992755-187992777 CAGGGTAGGCAGAATACTGATGG + Intergenic
946507501 2:220317480-220317502 CAGGGTTAACAGTAGATGGTCGG - Intergenic
948560192 2:238847181-238847203 GCGGGTCAGCAGAGGACGGAGGG - Intergenic
948899712 2:240950156-240950178 CAGGGTCAGCAGAGCAGGGAGGG - Intronic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1173007942 20:39155484-39155506 CAGGGGTAGGAGATGACTGATGG + Intergenic
1173408803 20:42791396-42791418 CAGGGTTGGCAGGAGAAGGTGGG + Exonic
1173465028 20:43274027-43274049 GAGGGTTGGAAGAAGAGGGAGGG + Intergenic
1173490113 20:43472807-43472829 AATGGTTAGCGTAAGACGGAGGG - Intergenic
1173974140 20:47174521-47174543 CAGGGACAGTAGAAGACGCAGGG - Intronic
1174160195 20:48545173-48545195 CAGGATTAGCAGATGCTGGAAGG - Intergenic
1177558540 21:22721039-22721061 CTGGGTTAGAAGAATAAGGATGG + Intergenic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1181007445 22:20020776-20020798 CAGGGTGAGCAGGTGACAGATGG + Intronic
1181019959 22:20094547-20094569 CAGGGTCAGGAGAGGACAGAAGG - Intronic
1182018860 22:27064032-27064054 CAGGGTGAGAAGAAGAAAGAAGG + Intergenic
1183108010 22:35628501-35628523 CTGTGTTAGCAGAATAAGGATGG - Intronic
1184979870 22:48088434-48088456 CTGGTTTAACAGAAGACAGATGG - Intergenic
949295321 3:2514917-2514939 AGGGGGTAGCAGAAGATGGAGGG - Intronic
951650904 3:24950660-24950682 CAGGGTTAGTGGAAGACCTAGGG + Intergenic
955921184 3:63957060-63957082 CAGGGTTAGCAGATGACTTGTGG + Intronic
956420461 3:69081459-69081481 CAGGCTTTGCAGAAGGCTGAAGG - Intergenic
956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
956856795 3:73282991-73283013 TAGGGGTAGCTGAAGAGGGAAGG + Intergenic
959534526 3:107470203-107470225 GAGGGTGAGCAGAAGAAGGGTGG + Intergenic
960822901 3:121753026-121753048 CAGGGGAAGAAGAAGAGGGAAGG + Intergenic
960939767 3:122925975-122925997 CAGGGTTACCAGAAGACTGCTGG + Intronic
961111236 3:124285028-124285050 TAGGGGTAGCAGGAGAAGGAGGG + Intronic
961319636 3:126063834-126063856 CAGGGTTAGCAGGAGGCACATGG + Intronic
964292068 3:155192609-155192631 CAGGATTCCCAGAAGAGGGAAGG - Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
970004700 4:11399568-11399590 CAGGATGAGCAGCAGCCGGATGG + Exonic
971874060 4:32281657-32281679 CAGGGTTAGAAAAAGAAGCATGG + Intergenic
973954352 4:56048854-56048876 CAGGCTTTGCAGAAGCCGGGAGG + Intergenic
974596711 4:64022933-64022955 CAGGGTTAGCAGGACACAGTTGG - Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
981889716 4:149720245-149720267 CAGAGTTAGCAGAAGAAAAATGG + Intergenic
983751409 4:171277274-171277296 CAGGTTTAGCAAAAGACTTAAGG - Intergenic
985278922 4:188268385-188268407 CAGGGTTAGCACCACAGGGAGGG + Intergenic
987719289 5:21614234-21614256 CAGGGTATGCAGAAGAGGCATGG - Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
999298752 5:150477147-150477169 CAGGGGTGGCAGAAGACGTTTGG - Intergenic
999871451 5:155755685-155755707 CAGGGTTACAAGAACACAGAAGG - Intergenic
1000329879 5:160198069-160198091 GAGGGATTGCAGAAGACAGAAGG + Intronic
1003014304 6:2455714-2455736 CAGGTCTAGCAAAAGAAGGAGGG - Intergenic
1004067345 6:12261796-12261818 CAGGGTTTCCAGAAGACATATGG + Intergenic
1005276466 6:24224585-24224607 CTGGGGTGGCAGAAGCCGGAAGG + Intronic
1005441455 6:25873550-25873572 CAGAGTCAGCAGAAGATGGTAGG - Intronic
1011025187 6:82860963-82860985 CAGGCTCATCAGAAGATGGAAGG + Intergenic
1011750420 6:90449617-90449639 CAGAGTTGGCAGAAGACAGCAGG + Intergenic
1012335716 6:98054401-98054423 CAGGATTAGCAGAACAGGGTGGG - Intergenic
1018108628 6:160513532-160513554 GAGGGTTAGCAGAAGCAGGCTGG + Intergenic
1021332352 7:19354557-19354579 CAAGGACAGGAGAAGACGGATGG - Intergenic
1023335539 7:39165234-39165256 AAGGGTTAACAGATGAAGGAGGG - Intronic
1024444941 7:49466146-49466168 CAGTGTTAGGAGCAGAGGGAAGG + Intergenic
1024953964 7:54896518-54896540 TAGGGGTTGCAGAGGACGGAGGG - Intergenic
1031360495 7:120843783-120843805 CAGAGCTAGCAGAAGACTGTTGG + Intronic
1034416874 7:150969965-150969987 CAGGGTCAGTAGAAGAGGGAGGG - Intronic
1035303263 7:157911851-157911873 CAGGGTTAGCAGAAGACGGAAGG - Intronic
1035731196 8:1854515-1854537 CAGTGTTTGCAGAGGATGGAGGG + Intronic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1040625747 8:49147987-49148009 CTGGGTTGGCAGAGGAGGGACGG + Intergenic
1044655832 8:94547443-94547465 CAGGGATAGAAGAATAAGGAAGG - Intronic
1047548579 8:125844203-125844225 CAGGGTGAGCAAAAAAAGGATGG - Intergenic
1049738390 8:144222156-144222178 CAGGGTGAGCCCCAGACGGAGGG + Intronic
1050280829 9:4048297-4048319 CATGTTTAGCAGAAGATGGAAGG + Intronic
1056014026 9:82363316-82363338 CAGGGGTGCCAGAAGAGGGAGGG + Intergenic
1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
1058767363 9:108194812-108194834 CTGGGTTTTCAGAAGACTGAGGG - Intergenic
1185837636 X:3360217-3360239 CAGGGTCCGTAGAAGAGGGAAGG - Intergenic
1186434424 X:9530983-9531005 AAGGGTTAGCTGCTGACGGAGGG - Intronic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1188488523 X:30710332-30710354 CTAGGTTAGCAGATGAAGGAAGG - Intronic
1189290614 X:39882962-39882984 AAGGGTTAAGAGAAGTCGGAGGG + Intergenic
1189496669 X:41514861-41514883 GAGGGTTAAAAGAAGAGGGATGG - Intergenic
1192701837 X:73482466-73482488 AAGGGTGAGCAGAAGAAGGGTGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1199611837 X:149624331-149624353 CAGGGTTGGGAGAATAGGGAGGG + Intronic
1201238189 Y:11931518-11931540 CAGGGTCCGTAGAAGAGGGAAGG + Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic