ID: 1035310953

View in Genome Browser
Species Human (GRCh38)
Location 7:157968515-157968537
Sequence CTGGAAAAACAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1436
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 660}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035310953_1035310961 3 Left 1035310953 7:157968515-157968537 CCAGCCTCCTTCTGTTTTTCCAG 0: 1
1: 0
2: 4
3: 53
4: 660
Right 1035310961 7:157968541-157968563 ATCTAACAAGGCTCGAACGCTGG 0: 1
1: 0
2: 0
3: 0
4: 20
1035310953_1035310959 -9 Left 1035310953 7:157968515-157968537 CCAGCCTCCTTCTGTTTTTCCAG 0: 1
1: 0
2: 4
3: 53
4: 660
Right 1035310959 7:157968529-157968551 TTTTTCCAGGGGATCTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035310953 Original CRISPR CTGGAAAAACAGAAGGAGGC TGG (reversed) Intronic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
903053179 1:20616674-20616696 ATGAAAAAGCTGAAGGAGGCAGG + Intronic
903053179 1:20616674-20616696 ATGAAAAAGCTGAAGGAGGCAGG + Intronic
903356204 1:22749365-22749387 CTGGAAAAAAAGAGGAATGCAGG + Intronic
903356204 1:22749365-22749387 CTGGAAAAAAAGAGGAATGCAGG + Intronic
904076525 1:27847005-27847027 CTGCAAAAAGAGAAGAGGGCAGG - Intronic
904076525 1:27847005-27847027 CTGCAAAAAGAGAAGAGGGCAGG - Intronic
904092081 1:27952361-27952383 CTGGAACAAATGAGGGAGGCTGG - Intronic
904092081 1:27952361-27952383 CTGGAACAAATGAGGGAGGCTGG - Intronic
904244179 1:29174614-29174636 TTGGAAAAAAAAAAGGAGTCAGG + Intronic
904244179 1:29174614-29174636 TTGGAAAAAAAAAAGGAGTCAGG + Intronic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905392966 1:37650063-37650085 ATAGGAAAACTGAAGGAGGCTGG + Intergenic
905392966 1:37650063-37650085 ATAGGAAAACTGAAGGAGGCTGG + Intergenic
905716502 1:40155877-40155899 CTGAAAAAACAGGGGGAGGGAGG - Intergenic
905716502 1:40155877-40155899 CTGAAAAAACAGGGGGAGGGAGG - Intergenic
906265875 1:44428943-44428965 CTCTAAAAACAGAATGGGGCAGG - Intronic
906265875 1:44428943-44428965 CTCTAAAAACAGAATGGGGCAGG - Intronic
906824919 1:48969101-48969123 CTGGAAGAAAAGAGGGAGGGAGG - Intronic
906824919 1:48969101-48969123 CTGGAAGAAAAGAGGGAGGGAGG - Intronic
906860334 1:49352526-49352548 CTGGAAGGCCAGAAGGAGGGGGG - Intronic
906860334 1:49352526-49352548 CTGGAAGGCCAGAAGGAGGGGGG - Intronic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907955979 1:59228721-59228743 CTTGAAAACCTGAAGAAGGCCGG - Intergenic
907955979 1:59228721-59228743 CTTGAAAACCTGAAGAAGGCCGG - Intergenic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908185533 1:61649322-61649344 CTGGAAAATCATTAGGAGGAAGG - Intergenic
908185533 1:61649322-61649344 CTGGAAAATCATTAGGAGGAAGG - Intergenic
908424373 1:63991570-63991592 AAGGAAAGACAGAAAGAGGCAGG + Intronic
908424373 1:63991570-63991592 AAGGAAAGACAGAAAGAGGCAGG + Intronic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
908534409 1:65065699-65065721 CTGGAAAAGCAAAAGGGGCCAGG + Intergenic
908534409 1:65065699-65065721 CTGGAAAAGCAAAAGGGGCCAGG + Intergenic
908828054 1:68152411-68152433 CTGGAAAGATGGAAGGAGACAGG + Intronic
908828054 1:68152411-68152433 CTGGAAAGATGGAAGGAGACAGG + Intronic
910095559 1:83517671-83517693 CTGGAAAAACCTAGGGTGGCTGG + Intergenic
910095559 1:83517671-83517693 CTGGAAAAACCTAGGGTGGCTGG + Intergenic
910535005 1:88287728-88287750 CTAGAAAAACAGAATTAGGCTGG - Intergenic
910535005 1:88287728-88287750 CTAGAAAAACAGAATTAGGCTGG - Intergenic
911089823 1:94009566-94009588 CTGGAAACACATGCGGAGGCTGG - Intronic
911089823 1:94009566-94009588 CTGGAAACACATGCGGAGGCTGG - Intronic
912157375 1:106938434-106938456 ATGGGAAAAGAGAAGGATGCTGG - Intergenic
912157375 1:106938434-106938456 ATGGGAAAAGAGAAGGATGCTGG - Intergenic
912812735 1:112806180-112806202 CTGGACCAACAGAAGCAGCCGGG + Intergenic
912812735 1:112806180-112806202 CTGGACCAACAGAAGCAGCCGGG + Intergenic
912848746 1:113103000-113103022 CTGGCAAAAAAAAAGGAGGGGGG - Intronic
912848746 1:113103000-113103022 CTGGCAAAAAAAAAGGAGGGGGG - Intronic
913232648 1:116754518-116754540 ATTGAAAATCAGAAGGAAGCTGG - Exonic
913232648 1:116754518-116754540 ATTGAAAATCAGAAGGAAGCTGG - Exonic
913540119 1:119811437-119811459 CTGGAGACACTGAAGAAGGCAGG - Exonic
913540119 1:119811437-119811459 CTGGAGACACTGAAGAAGGCAGG - Exonic
913577664 1:120193485-120193507 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
913577664 1:120193485-120193507 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
913630506 1:120704855-120704877 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
913630506 1:120704855-120704877 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
913656099 1:120961609-120961631 CATGACAAACAGAAGGAAGCAGG - Intergenic
913656099 1:120961609-120961631 CATGACAAACAGAAGGAAGCAGG - Intergenic
914392888 1:147237539-147237561 CTGCCAACTCAGAAGGAGGCAGG + Intronic
914392888 1:147237539-147237561 CTGCCAACTCAGAAGGAGGCAGG + Intronic
914520657 1:148412841-148412863 CATGACAAACAGAAGGAAGCAGG - Intergenic
914520657 1:148412841-148412863 CATGACAAACAGAAGGAAGCAGG - Intergenic
914559577 1:148804916-148804938 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
914559577 1:148804916-148804938 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
914613256 1:149325307-149325329 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
914613256 1:149325307-149325329 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
914920793 1:151846208-151846230 CTGGAAATACAGAAAGAGGTGGG - Intergenic
914920793 1:151846208-151846230 CTGGAAATACAGAAAGAGGTGGG - Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915346339 1:155199112-155199134 CTCAAAAAAAAAAAGGAGGCCGG + Intronic
915346339 1:155199112-155199134 CTCAAAAAAAAAAAGGAGGCCGG + Intronic
916300987 1:163274293-163274315 CTGGGAAAAGAGAAGGGAGCTGG + Intronic
916300987 1:163274293-163274315 CTGGGAAAAGAGAAGGGAGCTGG + Intronic
916998374 1:170326963-170326985 GTGGAGACACTGAAGGAGGCAGG + Intergenic
916998374 1:170326963-170326985 GTGGAGACACTGAAGGAGGCAGG + Intergenic
917171818 1:172185015-172185037 TTGGAAAAAAAAAGGGAGGCTGG + Intronic
917171818 1:172185015-172185037 TTGGAAAAAAAAAGGGAGGCTGG + Intronic
917644846 1:177019712-177019734 ATAGAAATACAGAGGGAGGCTGG + Intronic
917644846 1:177019712-177019734 ATAGAAATACAGAGGGAGGCTGG + Intronic
917717091 1:177749254-177749276 CTGAAAAAACATTAGGATGCTGG + Intergenic
917717091 1:177749254-177749276 CTGAAAAAACATTAGGATGCTGG + Intergenic
918067643 1:181112319-181112341 CTGAAGAAACAGAAGCAGACAGG - Intergenic
918067643 1:181112319-181112341 CTGAAGAAACAGAAGCAGACAGG - Intergenic
918344547 1:183595208-183595230 CAGGAAACCCTGAAGGAGGCAGG + Intronic
918344547 1:183595208-183595230 CAGGAAACCCTGAAGGAGGCAGG + Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
919126217 1:193396392-193396414 ATGGAAAAAGAGAAGGCGTCAGG - Intergenic
919126217 1:193396392-193396414 ATGGAAAAAGAGAAGGCGTCAGG - Intergenic
919235761 1:194839973-194839995 GTGGAAAAAAAAAAGGAGTCAGG + Intergenic
919235761 1:194839973-194839995 GTGGAAAAAAAAAAGGAGTCAGG + Intergenic
919505477 1:198392982-198393004 CTGGAAGGAGAGAAGAAGGCAGG - Intergenic
919505477 1:198392982-198393004 CTGGAAGGAGAGAAGAAGGCAGG - Intergenic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
921045424 1:211473455-211473477 ATGGAAAAAAAGAAGGAGAAGGG + Intergenic
921045424 1:211473455-211473477 ATGGAAAAAAAGAAGGAGAAGGG + Intergenic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
922593108 1:226793505-226793527 CTTTAAAAACAGAAAGAGGCCGG + Intergenic
922593108 1:226793505-226793527 CTTTAAAAACAGAAAGAGGCCGG + Intergenic
923077548 1:230623437-230623459 ATGGAAAAAAAGAAGAAGGTGGG - Intergenic
923077548 1:230623437-230623459 ATGGAAAAAAAGAAGAAGGTGGG - Intergenic
923191075 1:231621375-231621397 CTGGAAAGCCAGAAGGACCCTGG - Intronic
923191075 1:231621375-231621397 CTGGAAAGCCAGAAGGACCCTGG - Intronic
923254969 1:232213953-232213975 GTGGAAAAAGTGAAGGAAGCAGG - Intergenic
923254969 1:232213953-232213975 GTGGAAAAAGTGAAGGAAGCAGG - Intergenic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
923504241 1:234591766-234591788 ATATAGAAACAGAAGGAGGCTGG - Intergenic
923504241 1:234591766-234591788 ATATAGAAACAGAAGGAGGCTGG - Intergenic
923687024 1:236160528-236160550 GTGGACAGACAGAAGGAGCCTGG - Intronic
923687024 1:236160528-236160550 GTGGACAGACAGAAGGAGCCTGG - Intronic
923766597 1:236897953-236897975 CTGTAAAAACAGAAAAAAGCAGG - Exonic
923766597 1:236897953-236897975 CTGTAAAAACAGAAAAAAGCAGG - Exonic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063881679 10:10538254-10538276 CTGGCAGACCAGAGGGAGGCAGG - Intergenic
1063881679 10:10538254-10538276 CTGGCAGACCAGAGGGAGGCAGG - Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064448851 10:15423356-15423378 CTGTAAAAACAGTGGGAGGGAGG + Intergenic
1064448851 10:15423356-15423378 CTGTAAAAACAGTGGGAGGGAGG + Intergenic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1064764206 10:18654287-18654309 CTGGAAGAACAGAAAAAGGGAGG - Intronic
1064764206 10:18654287-18654309 CTGGAAGAACAGAAAAAGGGAGG - Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1065441858 10:25761316-25761338 CTGAAATTACAGATGGAGGCTGG + Intergenic
1065441858 10:25761316-25761338 CTGAAATTACAGATGGAGGCTGG + Intergenic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1065913023 10:30326814-30326836 CTGGAGAAACAGAAGGCAACTGG - Intronic
1065913023 10:30326814-30326836 CTGGAGAAACAGAAGGCAACTGG - Intronic
1066324292 10:34340787-34340809 CCAGAAAAACAGTAGGAAGCAGG + Intronic
1066324292 10:34340787-34340809 CCAGAAAAACAGTAGGAAGCAGG + Intronic
1067420445 10:46140850-46140872 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1067420445 10:46140850-46140872 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1067425576 10:46208683-46208705 CTGGAAAGACAGAATGGGGCTGG - Intergenic
1067425576 10:46208683-46208705 CTGGAAAGACAGAATGGGGCTGG - Intergenic
1067505789 10:46847331-46847353 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1067505789 10:46847331-46847353 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1068416963 10:56735304-56735326 AAGGAAAGACAGAAGAAGGCAGG - Intergenic
1068416963 10:56735304-56735326 AAGGAAAGACAGAAGAAGGCAGG - Intergenic
1068802669 10:61160041-61160063 CTGGCATAACAGAATGAGGGTGG - Intergenic
1068802669 10:61160041-61160063 CTGGCATAACAGAATGAGGGTGG - Intergenic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1070912853 10:80133278-80133300 CTGGCAAGAGAGAAGGAGCCAGG + Intronic
1070912853 10:80133278-80133300 CTGGCAAGAGAGAAGGAGCCAGG + Intronic
1070992408 10:80744122-80744144 ATTGAAAAAGAGAAGTAGGCTGG + Intergenic
1070992408 10:80744122-80744144 ATTGAAAAAGAGAAGTAGGCTGG + Intergenic
1071296974 10:84228273-84228295 TGGGAAATACAGAAGGAGGGAGG - Intergenic
1071296974 10:84228273-84228295 TGGGAAATACAGAAGGAGGGAGG - Intergenic
1071369338 10:84935273-84935295 CTGGACATACATGAGGAGGCTGG + Intergenic
1071369338 10:84935273-84935295 CTGGACATACATGAGGAGGCTGG + Intergenic
1071465024 10:85931905-85931927 CTGGAGAAACTGAAGGACTCTGG - Intronic
1071465024 10:85931905-85931927 CTGGAGAAACTGAAGGACTCTGG - Intronic
1072078038 10:91998573-91998595 CTTGAAACACAGAAAGAGCCAGG + Intronic
1072078038 10:91998573-91998595 CTTGAAACACAGAAAGAGCCAGG + Intronic
1072606226 10:96984940-96984962 CCTGCAAAACAGAAGGGGGCCGG + Exonic
1072606226 10:96984940-96984962 CCTGCAAAACAGAAGGGGGCCGG + Exonic
1072688680 10:97555045-97555067 CTGGCAAAGAGGAAGGAGGCAGG + Intronic
1072688680 10:97555045-97555067 CTGGCAAAGAGGAAGGAGGCAGG + Intronic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1072914691 10:99530717-99530739 CTGGAAAAAGAAAAGGAGAAAGG - Intergenic
1072914691 10:99530717-99530739 CTGGAAAAAGAAAAGGAGAAAGG - Intergenic
1073043471 10:100622603-100622625 CTGGAAAGACTCAAGGAGGGAGG - Intergenic
1073043471 10:100622603-100622625 CTGGAAAGACTCAAGGAGGGAGG - Intergenic
1073075638 10:100824625-100824647 CTGGAAAAACACAAAGGGGAAGG - Intronic
1073075638 10:100824625-100824647 CTGGAAAAACACAAAGGGGAAGG - Intronic
1073359659 10:102887849-102887871 CTGGAAAAAGAAGAGGAGGAAGG - Intronic
1073359659 10:102887849-102887871 CTGGAAAAAGAAGAGGAGGAAGG - Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073517098 10:104086311-104086333 CTAGAAAAACTGAAGTTGGCAGG + Intergenic
1073517098 10:104086311-104086333 CTAGAAAAACTGAAGTTGGCAGG + Intergenic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074631846 10:115265533-115265555 CTGGAAAAAGAAAAGAAGGCAGG - Intronic
1074631846 10:115265533-115265555 CTGGAAAAAGAAAAGAAGGCAGG - Intronic
1074734058 10:116409635-116409657 CTGGAACAGAAGAAAGAGGCAGG - Intergenic
1074734058 10:116409635-116409657 CTGGAACAGAAGAAAGAGGCAGG - Intergenic
1074935247 10:118172138-118172160 CTGGAAAAACTGCAGAAGACTGG + Intergenic
1074935247 10:118172138-118172160 CTGGAAAAACTGCAGAAGACTGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075873172 10:125785967-125785989 CAGGAAGGACACAAGGAGGCTGG + Intronic
1075873172 10:125785967-125785989 CAGGAAGGACACAAGGAGGCTGG + Intronic
1076316517 10:129545628-129545650 TTGCAAAAGCAGAGGGAGGCTGG - Intronic
1076316517 10:129545628-129545650 TTGCAAAAGCAGAGGGAGGCTGG - Intronic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1076934383 10:133557797-133557819 CTGGTAGAGCAGAAAGAGGCAGG - Intronic
1076934383 10:133557797-133557819 CTGGTAGAGCAGAAAGAGGCAGG - Intronic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077474645 11:2780555-2780577 CTGAGAAAACAGTTGGAGGCTGG - Intronic
1077474645 11:2780555-2780577 CTGAGAAAACAGTTGGAGGCTGG - Intronic
1079481987 11:20890884-20890906 CTGGAGTACCAGAAGGAGACAGG + Intronic
1079481987 11:20890884-20890906 CTGGAGTACCAGAAGGAGACAGG + Intronic
1079498489 11:21074031-21074053 CTGGAAAACTAGAGGAAGGCTGG + Intronic
1079498489 11:21074031-21074053 CTGGAAAACTAGAGGAAGGCTGG + Intronic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1082826060 11:57579802-57579824 CTCAAAAAACAGAACAAGGCTGG + Intergenic
1082826060 11:57579802-57579824 CTCAAAAAACAGAACAAGGCTGG + Intergenic
1082874550 11:57974804-57974826 GTGGAGAAAGAAAAGGAGGCAGG - Intergenic
1082874550 11:57974804-57974826 GTGGAGAAAGAAAAGGAGGCAGG - Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083540665 11:63509755-63509777 CTGGAGAGACAGACAGAGGCTGG - Intronic
1083540665 11:63509755-63509777 CTGGAGAGACAGACAGAGGCTGG - Intronic
1083575637 11:63789092-63789114 CTAGAAAAGAAGAAAGAGGCTGG + Intergenic
1083575637 11:63789092-63789114 CTAGAAAAGAAGAAAGAGGCTGG + Intergenic
1084493925 11:69492918-69492940 CTGAAAAAAGAGAAAGTGGCTGG + Intergenic
1084493925 11:69492918-69492940 CTGAAAAAAGAGAAAGTGGCTGG + Intergenic
1085328538 11:75627497-75627519 CTGGCCAAACAGTAGGAGGAGGG + Intronic
1085328538 11:75627497-75627519 CTGGCCAAACAGTAGGAGGAGGG + Intronic
1085556085 11:77422950-77422972 GTAGAAAAACAGAAAGAGCCTGG + Intronic
1085556085 11:77422950-77422972 GTAGAAAAACAGAAAGAGCCTGG + Intronic
1085782536 11:79422737-79422759 CTGGTAGAACAGAGGGAGGGAGG + Intronic
1085782536 11:79422737-79422759 CTGGTAGAACAGAGGGAGGGAGG + Intronic
1086086787 11:82963642-82963664 CTGGAAAAAAAAAAAAAGGCCGG - Intronic
1086086787 11:82963642-82963664 CTGGAAAAAAAAAAAAAGGCCGG - Intronic
1086409968 11:86535251-86535273 CTGGAAGAACAGATGAAGGTAGG - Intronic
1086409968 11:86535251-86535273 CTGGAAGAACAGATGAAGGTAGG - Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087402172 11:97681672-97681694 CTGTAAAAAGACAAAGAGGCTGG - Intergenic
1087402172 11:97681672-97681694 CTGTAAAAAGACAAAGAGGCTGG - Intergenic
1087945504 11:104155446-104155468 CTGGAAATATAAGAGGAGGCAGG + Intronic
1087945504 11:104155446-104155468 CTGGAAATATAAGAGGAGGCAGG + Intronic
1088360713 11:108986077-108986099 CTGGTAATACAAAAGCAGGCAGG - Intergenic
1088360713 11:108986077-108986099 CTGGTAATACAAAAGCAGGCAGG - Intergenic
1088436452 11:109818374-109818396 CTTGAAAAAAAAAAGGAGGTGGG + Intergenic
1088436452 11:109818374-109818396 CTTGAAAAAAAAAAGGAGGTGGG + Intergenic
1089173158 11:116529394-116529416 CCAGAAAAGCAGTAGGAGGCTGG + Intergenic
1089173158 11:116529394-116529416 CCAGAAAAGCAGTAGGAGGCTGG + Intergenic
1089413318 11:118265451-118265473 CAGGAACAAGAGAAGGCGGCAGG + Intergenic
1089413318 11:118265451-118265473 CAGGAACAAGAGAAGGCGGCAGG + Intergenic
1089572451 11:119419521-119419543 CTGCAGAAAGAGAAGGGGGCCGG + Intronic
1089572451 11:119419521-119419543 CTGCAGAAAGAGAAGGGGGCCGG + Intronic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1091701992 12:2669540-2669562 CTCACAAAACAGAAGGAGACGGG + Intronic
1091701992 12:2669540-2669562 CTCACAAAACAGAAGGAGACGGG + Intronic
1091770234 12:3146665-3146687 GTGGAGAAAGATAAGGAGGCAGG - Intronic
1091770234 12:3146665-3146687 GTGGAGAAAGATAAGGAGGCAGG - Intronic
1092197251 12:6556716-6556738 CTGGGAAAACCCAAGGATGCAGG + Intergenic
1092197251 12:6556716-6556738 CTGGGAAAACCCAAGGATGCAGG + Intergenic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093261002 12:16937910-16937932 CTGGACCTACAGAAAGAGGCAGG - Intergenic
1093261002 12:16937910-16937932 CTGGACCTACAGAAAGAGGCAGG - Intergenic
1093270830 12:17058847-17058869 CTGGTGAAATAAAAGGAGGCAGG + Intergenic
1093270830 12:17058847-17058869 CTGGTGAAATAAAAGGAGGCAGG + Intergenic
1094526685 12:31235724-31235746 ATGGAAAGACATCAGGAGGCAGG + Intergenic
1094526685 12:31235724-31235746 ATGGAAAGACATCAGGAGGCAGG + Intergenic
1095575975 12:43739726-43739748 CTTGAAGAACAAAAGGATGCTGG + Intronic
1095575975 12:43739726-43739748 CTTGAAGAACAAAAGGATGCTGG + Intronic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1096697369 12:53358383-53358405 CTCAAAAAACAGAAAAAGGCAGG + Intergenic
1096697369 12:53358383-53358405 CTCAAAAAACAGAAAAAGGCAGG + Intergenic
1096987332 12:55768722-55768744 CTCAAAAAAAAGAAAGAGGCTGG - Intronic
1096987332 12:55768722-55768744 CTCAAAAAAAAGAAAGAGGCTGG - Intronic
1097606340 12:61759075-61759097 CTTGAAATACAGAAGGAAGCTGG - Intronic
1097606340 12:61759075-61759097 CTTGAAATACAGAAGGAAGCTGG - Intronic
1097749118 12:63332129-63332151 CTGGAGTACCAGAAGGAGACAGG + Intergenic
1097749118 12:63332129-63332151 CTGGAGTACCAGAAGGAGACAGG + Intergenic
1097994490 12:65872698-65872720 CAGGAAAACTAGTAGGAGGCTGG - Intronic
1097994490 12:65872698-65872720 CAGGAAAACTAGTAGGAGGCTGG - Intronic
1098528971 12:71519123-71519145 GTGGAATAACAGGAGGAGGATGG - Intronic
1098528971 12:71519123-71519145 GTGGAATAACAGGAGGAGGATGG - Intronic
1098624516 12:72646655-72646677 ATGGAAAAGCAGAAGAAAGCAGG + Intronic
1098624516 12:72646655-72646677 ATGGAAAAGCAGAAGAAAGCAGG + Intronic
1098809446 12:75067782-75067804 TTATGAAAACAGAAGGAGGCAGG - Intronic
1098809446 12:75067782-75067804 TTATGAAAACAGAAGGAGGCAGG - Intronic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1099684154 12:85864811-85864833 TTGGAGTAACTGAAGGAGGCAGG - Intergenic
1099684154 12:85864811-85864833 TTGGAGTAACTGAAGGAGGCAGG - Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100449322 12:94690251-94690273 CTGGAGTAATAGATGGAGGCTGG - Intergenic
1100449322 12:94690251-94690273 CTGGAGTAATAGATGGAGGCTGG - Intergenic
1100527472 12:95433122-95433144 CTTTTAAAACAGAAGCAGGCTGG + Intergenic
1100527472 12:95433122-95433144 CTTTTAAAACAGAAGCAGGCTGG + Intergenic
1100797078 12:98193610-98193632 CTAGAAAAACAGAAAAAGACTGG - Intergenic
1100797078 12:98193610-98193632 CTAGAAAAACAGAAAAAGACTGG - Intergenic
1100994058 12:100282920-100282942 CTAGAAAAACAGAAGGATAGTGG - Intronic
1100994058 12:100282920-100282942 CTAGAAAAACAGAAGGATAGTGG - Intronic
1101064533 12:101005920-101005942 CTGGAAGAAGAGGAGGAGGCAGG - Intronic
1101064533 12:101005920-101005942 CTGGAAGAAGAGGAGGAGGCAGG - Intronic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1101847387 12:108373412-108373434 CTGGAAAATGAGAAGCAGACAGG - Intergenic
1101847387 12:108373412-108373434 CTGGAAAATGAGAAGCAGACAGG - Intergenic
1102605498 12:114064560-114064582 CTGGTAAACCAGAGGGAGTCAGG - Intergenic
1102605498 12:114064560-114064582 CTGGTAAACCAGAGGGAGTCAGG - Intergenic
1103277390 12:119723992-119724014 CTTAAAAAAGAGAAGGTGGCCGG + Intronic
1103277390 12:119723992-119724014 CTTAAAAAAGAGAAGGTGGCCGG + Intronic
1103280687 12:119755820-119755842 CTTCAAAAACATAAGGAGGCTGG - Intronic
1103280687 12:119755820-119755842 CTTCAAAAACATAAGGAGGCTGG - Intronic
1103428580 12:120861349-120861371 CTAGAAAAACAGAAAAAGGAAGG + Intronic
1103428580 12:120861349-120861371 CTAGAAAAACAGAAAAAGGAAGG + Intronic
1103587102 12:121963942-121963964 CTGGAAAGAAGGATGGAGGCAGG + Intronic
1103587102 12:121963942-121963964 CTGGAAAGAAGGATGGAGGCAGG + Intronic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1105289280 13:19038031-19038053 CTTGAAAAACTGAAGAAGACGGG + Intergenic
1105289280 13:19038031-19038053 CTTGAAAAACTGAAGAAGACGGG + Intergenic
1105447800 13:20472801-20472823 CTGGAACAACACATGGATGCTGG + Intronic
1105447800 13:20472801-20472823 CTGGAACAACACATGGATGCTGG + Intronic
1105627337 13:22125568-22125590 ATGGAAAAACAGAAGAAAACAGG + Intergenic
1105627337 13:22125568-22125590 ATGGAAAAACAGAAGAAAACAGG + Intergenic
1105983809 13:25545929-25545951 CATAAAAAACAGAAGTAGGCTGG - Intronic
1105983809 13:25545929-25545951 CATAAAAAACAGAAGTAGGCTGG - Intronic
1108176593 13:47798740-47798762 CTGGAGAGGCAAAAGGAGGCAGG + Intergenic
1108176593 13:47798740-47798762 CTGGAGAGGCAAAAGGAGGCAGG + Intergenic
1108224806 13:48277554-48277576 CTGGAAAGAAAGAAGGAGGGAGG + Intergenic
1108224806 13:48277554-48277576 CTGGAAAGAAAGAAGGAGGGAGG + Intergenic
1108228964 13:48318247-48318269 CTGGAAAGACAGAAGCCCGCCGG - Intronic
1108228964 13:48318247-48318269 CTGGAAAGACAGAAGCCCGCCGG - Intronic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108350208 13:49585158-49585180 CTCAAAAAAGAGAGGGAGGCAGG + Intronic
1108350208 13:49585158-49585180 CTCAAAAAAGAGAGGGAGGCAGG + Intronic
1108382113 13:49864216-49864238 CTGGAAAACAGGATGGAGGCTGG + Intergenic
1108382113 13:49864216-49864238 CTGGAAAACAGGATGGAGGCTGG + Intergenic
1108715402 13:53073363-53073385 CTGGGGAAACAGAAGAGGGCTGG + Intergenic
1108715402 13:53073363-53073385 CTGGGGAAACAGAAGAGGGCTGG + Intergenic
1109024300 13:57140336-57140358 CGGGAAACACAGCAGGACGCTGG - Intergenic
1109024300 13:57140336-57140358 CGGGAAACACAGCAGGACGCTGG - Intergenic
1109025205 13:57146441-57146463 CGGGAAACACAGCAGGACGCTGG - Intronic
1109025205 13:57146441-57146463 CGGGAAACACAGCAGGACGCTGG - Intronic
1109026195 13:57153014-57153036 CGGGAAACACAGCAGGACGCTGG - Intronic
1109026195 13:57153014-57153036 CGGGAAACACAGCAGGACGCTGG - Intronic
1109027187 13:57159585-57159607 CGGGAAACACAGCAGGACGCTGG - Intergenic
1109027187 13:57159585-57159607 CGGGAAACACAGCAGGACGCTGG - Intergenic
1109028173 13:57166150-57166172 CGGGAAACACAGCAGGACGCTGG - Intergenic
1109028173 13:57166150-57166172 CGGGAAACACAGCAGGACGCTGG - Intergenic
1109029160 13:57172721-57172743 CGGGAAACACAGCAGGACGCTGG - Intergenic
1109029160 13:57172721-57172743 CGGGAAACACAGCAGGACGCTGG - Intergenic
1109399922 13:61813029-61813051 TTTGAAAAATAGAAGTAGGCCGG - Intergenic
1109399922 13:61813029-61813051 TTTGAAAAATAGAAGTAGGCCGG - Intergenic
1109642850 13:65213024-65213046 CAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1109642850 13:65213024-65213046 CAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1111194209 13:84851239-84851261 CTGGAAAAGCAAAGAGAGGCAGG - Intergenic
1111194209 13:84851239-84851261 CTGGAAAAGCAAAGAGAGGCAGG - Intergenic
1111232890 13:85366933-85366955 CAGAAACAACAGAAGGAGACGGG - Intergenic
1111232890 13:85366933-85366955 CAGAAACAACAGAAGGAGACGGG - Intergenic
1112198934 13:97256510-97256532 CTGGAAAAAGTGAAGCAGACAGG + Intronic
1112198934 13:97256510-97256532 CTGGAAAAAGTGAAGCAGACAGG + Intronic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113188572 13:107717985-107718007 CTGGAACAACAGCAGGTGGAGGG - Intronic
1113188572 13:107717985-107718007 CTGGAACAACAGCAGGTGGAGGG - Intronic
1113217204 13:108055929-108055951 CTGGAAAAACAGAAATACGAAGG + Intergenic
1113217204 13:108055929-108055951 CTGGAAAAACAGAAATACGAAGG + Intergenic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1114046557 14:18881191-18881213 CTGGCAAGAGAGAAGGAGCCAGG + Intergenic
1114046557 14:18881191-18881213 CTGGCAAGAGAGAAGGAGCCAGG + Intergenic
1114117655 14:19638257-19638279 CTGGCAAGAGAGAAGGAGCCAGG - Intergenic
1114117655 14:19638257-19638279 CTGGCAAGAGAGAAGGAGCCAGG - Intergenic
1114512409 14:23273626-23273648 CTGGAAAAACAGAAAATAGCAGG + Exonic
1114512409 14:23273626-23273648 CTGGAAAAACAGAAAATAGCAGG + Exonic
1115184841 14:30674641-30674663 CTCAAAAAAAAGAAGGAGGGAGG + Intronic
1115184841 14:30674641-30674663 CTCAAAAAAAAGAAGGAGGGAGG + Intronic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1115772890 14:36685026-36685048 CTGGAATAACAGGAGGGTGCCGG - Intronic
1115772890 14:36685026-36685048 CTGGAATAACAGGAGGGTGCCGG - Intronic
1115863141 14:37711994-37712016 CTGGACAAAAAGAAGGAAGCAGG + Intronic
1115863141 14:37711994-37712016 CTGGACAAAAAGAAGGAAGCAGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117679293 14:58186868-58186890 GGTGAGAAACAGAAGGAGGCAGG + Intronic
1117679293 14:58186868-58186890 GGTGAGAAACAGAAGGAGGCAGG + Intronic
1117964268 14:61190653-61190675 GTGGAAACACAGCAAGAGGCAGG - Intronic
1117964268 14:61190653-61190675 GTGGAAACACAGCAAGAGGCAGG - Intronic
1118674058 14:68163618-68163640 CTTGGGAAACAGAAGAAGGCAGG - Intronic
1118674058 14:68163618-68163640 CTTGGGAAACAGAAGAAGGCAGG - Intronic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1119085684 14:71736943-71736965 CTGGACAGACACAACGAGGCTGG - Intronic
1119085684 14:71736943-71736965 CTGGACAGACACAACGAGGCTGG - Intronic
1119563461 14:75608981-75609003 CTGGAAAGACATAGGGAAGCTGG - Intronic
1119563461 14:75608981-75609003 CTGGAAAGACATAGGGAAGCTGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119898363 14:78239568-78239590 CTTGAAGAACAGCAGGAGGTAGG - Intergenic
1119898363 14:78239568-78239590 CTTGAAGAACAGCAGGAGGTAGG - Intergenic
1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG + Intronic
1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG + Intronic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1123414699 15:20086809-20086831 CTTAAAAAAAAGAAAGAGGCTGG + Intergenic
1123414699 15:20086809-20086831 CTTAAAAAAAAGAAAGAGGCTGG + Intergenic
1123463075 15:20492444-20492466 CTACAAAAACTGAAGGATGCTGG - Intergenic
1123463075 15:20492444-20492466 CTACAAAAACTGAAGGATGCTGG - Intergenic
1123524041 15:21093923-21093945 CTTAAAAAAAAGAAAGAGGCTGG + Intergenic
1123524041 15:21093923-21093945 CTTAAAAAAAAGAAAGAGGCTGG + Intergenic
1123654986 15:22507970-22507992 CTACAAAAACTGAAGGATGCTGG + Intergenic
1123654986 15:22507970-22507992 CTACAAAAACTGAAGGATGCTGG + Intergenic
1124273917 15:28309847-28309869 CTACAAAAACTGAAGGATGCTGG - Intronic
1124273917 15:28309847-28309869 CTACAAAAACTGAAGGATGCTGG - Intronic
1124308894 15:28603171-28603193 CTACAAAAACTGAAGGATGCTGG + Intergenic
1124308894 15:28603171-28603193 CTACAAAAACTGAAGGATGCTGG + Intergenic
1124590496 15:31049343-31049365 CTAGAAAAAGGGAAGGAAGCGGG - Intronic
1124590496 15:31049343-31049365 CTAGAAAAAGGGAAGGAAGCGGG - Intronic
1124666294 15:31595765-31595787 CTGGCACACCTGAAGGAGGCTGG - Intronic
1124666294 15:31595765-31595787 CTGGCACACCTGAAGGAGGCTGG - Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1126196397 15:45936649-45936671 ATGGAGAAATAGTAGGAGGCAGG - Intergenic
1126196397 15:45936649-45936671 ATGGAGAAATAGTAGGAGGCAGG - Intergenic
1127481871 15:59385156-59385178 CCTCAAAAACAAAAGGAGGCTGG - Intronic
1127481871 15:59385156-59385178 CCTCAAAAACAAAAGGAGGCTGG - Intronic
1127495047 15:59502878-59502900 TTGTAAAAAAAGAAGCAGGCTGG - Intronic
1127495047 15:59502878-59502900 TTGTAAAAAAAGAAGCAGGCTGG - Intronic
1128172692 15:65526823-65526845 CTGGAAAAAAAAAATTAGGCTGG + Intergenic
1128172692 15:65526823-65526845 CTGGAAAAAAAAAATTAGGCTGG + Intergenic
1128256187 15:66198778-66198800 CTCTAGAAACAAAAGGAGGCTGG - Intronic
1128256187 15:66198778-66198800 CTCTAGAAACAAAAGGAGGCTGG - Intronic
1128635749 15:69301298-69301320 CTGGAAAAGCACATGGGGGCTGG - Intronic
1128635749 15:69301298-69301320 CTGGAAAAGCACATGGGGGCTGG - Intronic
1128735454 15:70051287-70051309 CAGGAAGAACAGGAGGAGCCTGG - Intronic
1128735454 15:70051287-70051309 CAGGAAGAACAGGAGGAGCCTGG - Intronic
1128879800 15:71232559-71232581 CTGGAAGTACAGAAGTAGGTAGG + Intronic
1128879800 15:71232559-71232581 CTGGAAGTACAGAAGTAGGTAGG + Intronic
1129518999 15:76174029-76174051 ACAGAAAAACAGAAGGAGCCTGG - Intronic
1129518999 15:76174029-76174051 ACAGAAAAACAGAAGGAGCCTGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129943854 15:79522383-79522405 CTGGAAAAACAATAGAAGGTGGG - Intergenic
1129943854 15:79522383-79522405 CTGGAAAAACAATAGAAGGTGGG - Intergenic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1130894947 15:88162776-88162798 CTGGAGAAAGAGGAGGAAGCTGG - Intronic
1130894947 15:88162776-88162798 CTGGAGAAAGAGGAGGAAGCTGG - Intronic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131144234 15:90001374-90001396 CTGGAAGAAGGGAATGAGGCAGG - Exonic
1131144234 15:90001374-90001396 CTGGAAGAAGGGAATGAGGCAGG - Exonic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1132608690 16:804415-804437 CTGGAAGGACAGAAGCAGGCTGG + Intergenic
1132608690 16:804415-804437 CTGGAAGGACAGAAGCAGGCTGG + Intergenic
1132805328 16:1772647-1772669 CTGCAAAGCCAGAAGGAAGCGGG + Intronic
1132805328 16:1772647-1772669 CTGCAAAGCCAGAAGGAAGCGGG + Intronic
1133036905 16:3038638-3038660 CTAGAAAAATAGGAGGAGGGTGG + Intergenic
1133036905 16:3038638-3038660 CTAGAAAAATAGGAGGAGGGTGG + Intergenic
1135140401 16:19916354-19916376 GCAGAAAGACAGAAGGAGGCTGG + Intergenic
1135140401 16:19916354-19916376 GCAGAAAGACAGAAGGAGGCTGG + Intergenic
1136548566 16:30969307-30969329 CCTGAACAAGAGAAGGAGGCTGG + Exonic
1136548566 16:30969307-30969329 CCTGAACAAGAGAAGGAGGCTGG + Exonic
1136580793 16:31149732-31149754 CTGGAAAGACAGAGGTAGGCAGG + Intronic
1136580793 16:31149732-31149754 CTGGAAAGACAGAGGTAGGCAGG + Intronic
1137421552 16:48339176-48339198 CGGGAAAAACAGAAAGGGACTGG + Intronic
1137421552 16:48339176-48339198 CGGGAAAAACAGAAAGGGACTGG + Intronic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138354584 16:56367125-56367147 GTGGAAGGACAGAAGGAAGCTGG - Intronic
1138354584 16:56367125-56367147 GTGGAAGGACAGAAGGAAGCTGG - Intronic
1138525010 16:57600189-57600211 CTGGACAAACTCAAGAAGGCAGG + Intergenic
1138525010 16:57600189-57600211 CTGGACAAACTCAAGAAGGCAGG + Intergenic
1138901478 16:61275727-61275749 CTGGAAAAACTGGAAGAGGAAGG - Intergenic
1138901478 16:61275727-61275749 CTGGAAAAACTGGAAGAGGAAGG - Intergenic
1139133425 16:64173585-64173607 CTGGAAAAAAAAAAAGAGGTTGG - Intergenic
1139133425 16:64173585-64173607 CTGGAAAAAAAAAAAGAGGTTGG - Intergenic
1140245273 16:73242734-73242756 CTGGACAAACTGGATGAGGCTGG + Intergenic
1140245273 16:73242734-73242756 CTGGACAAACTGGATGAGGCTGG + Intergenic
1140862619 16:79031364-79031386 CCTGAAGAAAAGAAGGAGGCAGG - Intronic
1140862619 16:79031364-79031386 CCTGAAGAAAAGAAGGAGGCAGG - Intronic
1140973876 16:80040863-80040885 CTGGAGAAAAAGAAGAAAGCGGG - Intergenic
1140973876 16:80040863-80040885 CTGGAGAAAAAGAAGAAAGCGGG - Intergenic
1140989718 16:80198324-80198346 CAGGAACAAAAGAATGAGGCTGG - Intergenic
1140989718 16:80198324-80198346 CAGGAACAAAAGAATGAGGCTGG - Intergenic
1141368922 16:83469444-83469466 CAGGAAAAACATATTGAGGCTGG + Intronic
1141368922 16:83469444-83469466 CAGGAAAAACATATTGAGGCTGG + Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1143274459 17:5699834-5699856 CTGCAAGAAAAGAAGGAGGGGGG + Intergenic
1143274459 17:5699834-5699856 CTGCAAGAAAAGAAGGAGGGGGG + Intergenic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1143375557 17:6464772-6464794 CTGGAAGGACAGAAAGAAGCTGG + Intronic
1143375557 17:6464772-6464794 CTGGAAGGACAGAAAGAAGCTGG + Intronic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143551747 17:7634573-7634595 CTGGAAAAAGGGGTGGAGGCAGG + Intergenic
1143551747 17:7634573-7634595 CTGGAAAAAGGGGTGGAGGCAGG + Intergenic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144190748 17:12843240-12843262 GGGGAGAAACAGAGGGAGGCAGG - Intronic
1144190748 17:12843240-12843262 GGGGAGAAACAGAGGGAGGCAGG - Intronic
1144406616 17:14958055-14958077 CTGGAAAAAGAATAGGAGGAAGG + Intergenic
1144406616 17:14958055-14958077 CTGGAAAAAGAATAGGAGGAAGG + Intergenic
1145093102 17:20001951-20001973 CTTGAAAATAAGAAAGAGGCCGG - Intergenic
1145093102 17:20001951-20001973 CTTGAAAATAAGAAAGAGGCCGG - Intergenic
1146469764 17:33114859-33114881 GTGGAAAAACTGAGAGAGGCTGG - Intronic
1146469764 17:33114859-33114881 GTGGAAAAACTGAGAGAGGCTGG - Intronic
1146478989 17:33187708-33187730 TTACAAAAACAGAAGGGGGCTGG + Intronic
1146478989 17:33187708-33187730 TTACAAAAACAGAAGGGGGCTGG + Intronic
1147308428 17:39579259-39579281 TGGGAAAAACAGAAGGAGAGAGG + Intergenic
1147308428 17:39579259-39579281 TGGGAAAAACAGAAGGAGAGAGG + Intergenic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147321100 17:39646689-39646711 CAGGACAAACAGGAGGTGGCTGG - Intronic
1147321100 17:39646689-39646711 CAGGACAAACAGGAGGTGGCTGG - Intronic
1147535137 17:41315871-41315893 CTGGATAAACAGCAGTTGGCAGG - Intergenic
1147535137 17:41315871-41315893 CTGGATAAACAGCAGTTGGCAGG - Intergenic
1147643793 17:42021541-42021563 CTTGAAGAACAGAAGCACGCTGG - Intronic
1147643793 17:42021541-42021563 CTTGAAGAACAGAAGCACGCTGG - Intronic
1147702323 17:42403939-42403961 ATGGAAAAATAGAAGAAGGTCGG - Exonic
1147702323 17:42403939-42403961 ATGGAAAAATAGAAGAAGGTCGG - Exonic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148011961 17:44489666-44489688 CTAGAAAAACAAAAAGAGGAAGG + Intronic
1148011961 17:44489666-44489688 CTAGAAAAACAAAAAGAGGAAGG + Intronic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148866134 17:50629693-50629715 GTGGAGAAAATGAAGGAGGCTGG + Intergenic
1148866134 17:50629693-50629715 GTGGAGAAAATGAAGGAGGCTGG + Intergenic
1149099564 17:52887541-52887563 ATTGAAAACAAGAAGGAGGCTGG + Intronic
1149099564 17:52887541-52887563 ATTGAAAACAAGAAGGAGGCTGG + Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149452587 17:56761362-56761384 CTCGAAGAGCAGAAGTAGGCTGG - Intergenic
1149452587 17:56761362-56761384 CTCGAAGAGCAGAAGTAGGCTGG - Intergenic
1149516653 17:57286047-57286069 AGGGAAAGACAGAAAGAGGCTGG - Intronic
1149516653 17:57286047-57286069 AGGGAAAGACAGAAAGAGGCTGG - Intronic
1149726056 17:58895807-58895829 CTCAAAAAAGAAAAGGAGGCCGG + Intronic
1149726056 17:58895807-58895829 CTCAAAAAAGAAAAGGAGGCCGG + Intronic
1149946631 17:60934860-60934882 ATGTAAAAACAGTAAGAGGCTGG + Intronic
1149946631 17:60934860-60934882 ATGTAAAAACAGTAAGAGGCTGG + Intronic
1151737718 17:75955163-75955185 CTCAAAAAAAAAAAGGAGGCTGG - Intronic
1151737718 17:75955163-75955185 CTCAAAAAAAAAAAGGAGGCTGG - Intronic
1151800356 17:76375870-76375892 CTGGAAAAAGACATGGAGCCCGG - Intronic
1151800356 17:76375870-76375892 CTGGAAAAAGACATGGAGCCCGG - Intronic
1152393757 17:80019038-80019060 TTTGAAACACAGAAGGAGGTGGG - Intronic
1152393757 17:80019038-80019060 TTTGAAACACAGAAGGAGGTGGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153179118 18:2413172-2413194 CTGGAAAAACCGCCTGAGGCAGG + Intergenic
1153179118 18:2413172-2413194 CTGGAAAAACCGCCTGAGGCAGG + Intergenic
1154203503 18:12317586-12317608 TTAGAAATACAGAAAGAGGCTGG - Intronic
1154203503 18:12317586-12317608 TTAGAAATACAGAAAGAGGCTGG - Intronic
1155391701 18:25345130-25345152 CTTTAAAAATAGAGGGAGGCAGG + Intronic
1155391701 18:25345130-25345152 CTTTAAAAATAGAGGGAGGCAGG + Intronic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156598822 18:38579708-38579730 CCAGAAGAACAGAAGGAGGTGGG + Intergenic
1156598822 18:38579708-38579730 CCAGAAGAACAGAAGGAGGTGGG + Intergenic
1157043186 18:44063482-44063504 CTGGAAGAATAAAATGAGGCTGG + Intergenic
1157043186 18:44063482-44063504 CTGGAAGAATAAAATGAGGCTGG + Intergenic
1157273504 18:46294279-46294301 CTGGAACCAGAGAAGGATGCTGG + Intergenic
1157273504 18:46294279-46294301 CTGGAACCAGAGAAGGATGCTGG + Intergenic
1157678619 18:49586496-49586518 TTGGATAGACAGAAGGAAGCAGG + Intronic
1157678619 18:49586496-49586518 TTGGATAGACAGAAGGAAGCAGG + Intronic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158443721 18:57500621-57500643 CTAGAGAAACAGAAGCACGCAGG + Intergenic
1158443721 18:57500621-57500643 CTAGAGAAACAGAAGCACGCAGG + Intergenic
1158619286 18:59017524-59017546 ATATAAAAACAGAAGGAGGGTGG - Intergenic
1158619286 18:59017524-59017546 ATATAAAAACAGAAGGAGGGTGG - Intergenic
1159466789 18:68794266-68794288 CTTGAACAAGACAAGGAGGCTGG - Intronic
1159466789 18:68794266-68794288 CTTGAACAAGACAAGGAGGCTGG - Intronic
1160239427 18:77112559-77112581 CTGGAAACAGAGAAGGGGGAGGG - Intronic
1160239427 18:77112559-77112581 CTGGAAACAGAGAAGGGGGAGGG - Intronic
1161085702 19:2333989-2334011 CTGGTAGAACAGCAGGAAGCAGG - Intronic
1161085702 19:2333989-2334011 CTGGTAGAACAGCAGGAAGCAGG - Intronic
1161622125 19:5303572-5303594 CTGGAAAAAGAGAGGGGGACTGG + Intronic
1161622125 19:5303572-5303594 CTGGAAAAAGAGAGGGGGACTGG + Intronic
1161645923 19:5453417-5453439 GTGGAAAAACAGAAGCAGAGAGG - Intergenic
1161645923 19:5453417-5453439 GTGGAAAAACAGAAGCAGAGAGG - Intergenic
1161769137 19:6222036-6222058 CTGGAACAGCGGAAGGAGGTGGG - Intronic
1161769137 19:6222036-6222058 CTGGAACAGCGGAAGGAGGTGGG - Intronic
1162018163 19:7856756-7856778 CTGGAAAAACTGTGGGGGGCAGG - Intronic
1162018163 19:7856756-7856778 CTGGAAAAACTGTGGGGGGCAGG - Intronic
1162407706 19:10485579-10485601 CTTGAAAAAAAAAAGTAGGCCGG + Intergenic
1162407706 19:10485579-10485601 CTTGAAAAAAAAAAGTAGGCCGG + Intergenic
1162657705 19:12143968-12143990 CTGGAAAAAGATTAGAAGGCCGG + Intronic
1162657705 19:12143968-12143990 CTGGAAAAAGATTAGAAGGCCGG + Intronic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1162957332 19:14106797-14106819 CTGGTGAAACACAAGGAGACCGG - Exonic
1162957332 19:14106797-14106819 CTGGTGAAACACAAGGAGACCGG - Exonic
1163162120 19:15470938-15470960 CTCGAAAAGAAGAAGGAGGCCGG - Intronic
1163162120 19:15470938-15470960 CTCGAAAAGAAGAAGGAGGCCGG - Intronic
1163173724 19:15550495-15550517 TGTGAACAACAGAAGGAGGCAGG + Intronic
1163173724 19:15550495-15550517 TGTGAACAACAGAAGGAGGCAGG + Intronic
1163458715 19:17423906-17423928 CTGTAAAGACTGAAGGAGCCAGG + Intronic
1163458715 19:17423906-17423928 CTGTAAAGACTGAAGGAGCCAGG + Intronic
1163576393 19:18113285-18113307 CTCAAAAAAAAAAAGGAGGCAGG - Intronic
1163576393 19:18113285-18113307 CTCAAAAAAAAAAAGGAGGCAGG - Intronic
1163983183 19:20921073-20921095 AAAGAAAAACAGAAGCAGGCCGG - Intergenic
1163983183 19:20921073-20921095 AAAGAAAAACAGAAGCAGGCCGG - Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164986542 19:32652630-32652652 GAGGAAAAACAAAAGGAGACAGG + Intronic
1164986542 19:32652630-32652652 GAGGAAAAACAAAAGGAGACAGG + Intronic
1165084926 19:33337911-33337933 GAGGAAAGAGAGAAGGAGGCCGG + Intergenic
1165084926 19:33337911-33337933 GAGGAAAGAGAGAAGGAGGCCGG + Intergenic
1165400348 19:35595756-35595778 CTTAAAAAATAGAAGTAGGCCGG + Intergenic
1165400348 19:35595756-35595778 CTTAAAAAATAGAAGTAGGCCGG + Intergenic
1166131855 19:40750434-40750456 CTGGAAAAAGGAAAGGAGTCAGG + Intronic
1166131855 19:40750434-40750456 CTGGAAAAAGGAAAGGAGTCAGG + Intronic
1166944087 19:46386519-46386541 CTGGAAGGGAAGAAGGAGGCCGG + Intronic
1166944087 19:46386519-46386541 CTGGAAGGGAAGAAGGAGGCCGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167259067 19:48447675-48447697 TTCTAAAAACTGAAGGAGGCCGG - Intronic
1167259067 19:48447675-48447697 TTCTAAAAACTGAAGGAGGCCGG - Intronic
1167320817 19:48796324-48796346 CTGGTACTACTGAAGGAGGCTGG + Intronic
1167320817 19:48796324-48796346 CTGGTACTACTGAAGGAGGCTGG + Intronic
1168058133 19:53874935-53874957 GTGGAAAAAGAGAAACAGGCTGG - Exonic
1168058133 19:53874935-53874957 GTGGAAAAAGAGAAACAGGCTGG - Exonic
1168084463 19:54035141-54035163 CTGGACAATTTGAAGGAGGCAGG + Intergenic
1168084463 19:54035141-54035163 CTGGACAATTTGAAGGAGGCAGG + Intergenic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG + Intronic
1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG + Intronic
1168482426 19:56732725-56732747 CTGGAAATACAGGATGAGGTTGG + Intergenic
1168482426 19:56732725-56732747 CTGGAAATACAGGATGAGGTTGG + Intergenic
1168722064 19:58559597-58559619 CTGGAAAAGGGGATGGAGGCGGG + Intergenic
1168722064 19:58559597-58559619 CTGGAAAAGGGGATGGAGGCGGG + Intergenic
925071321 2:969929-969951 CTGGAGAACCAGAAGCAGACAGG - Intronic
925071321 2:969929-969951 CTGGAGAACCAGAAGCAGACAGG - Intronic
925352357 2:3210342-3210364 CTGGAAAAACAGATGTGGGTGGG - Intronic
925352357 2:3210342-3210364 CTGGAAAAACAGATGTGGGTGGG - Intronic
926626178 2:15091827-15091849 TTAAAAAAACACAAGGAGGCTGG - Intergenic
926626178 2:15091827-15091849 TTAAAAAAACACAAGGAGGCTGG - Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927139100 2:20117865-20117887 CTGGAAGAGCAGGAGGAGCCCGG + Intergenic
927139100 2:20117865-20117887 CTGGAAGAGCAGGAGGAGCCCGG + Intergenic
927139175 2:20118159-20118181 CTGGAAGATCAGGAGGAGGGTGG + Intergenic
927139175 2:20118159-20118181 CTGGAAGATCAGGAGGAGGGTGG + Intergenic
927971574 2:27308791-27308813 CTGGAAAAAGATAAGAATGCTGG - Intergenic
927971574 2:27308791-27308813 CTGGAAAAAGATAAGAATGCTGG - Intergenic
928242854 2:29601673-29601695 CTGAAAAAACAAAAGCAGGCAGG + Intronic
928242854 2:29601673-29601695 CTGAAAAAACAAAAGCAGGCAGG + Intronic
928269500 2:29843418-29843440 CTGGAAGAAAAGAAGGAAGGAGG + Intronic
928269500 2:29843418-29843440 CTGGAAGAAAAGAAGGAAGGAGG + Intronic
928400656 2:30976371-30976393 TTAGAAAAACAGAAGGATCCTGG - Intronic
928400656 2:30976371-30976393 TTAGAAAAACAGAAGGATCCTGG - Intronic
928762362 2:34599805-34599827 ATGGAAAAACAGAAGGTAGGAGG - Intergenic
928762362 2:34599805-34599827 ATGGAAAAACAGAAGGTAGGAGG - Intergenic
929199898 2:39223892-39223914 ATTAAAAAAGAGAAGGAGGCTGG - Intronic
929199898 2:39223892-39223914 ATTAAAAAAGAGAAGGAGGCTGG - Intronic
929209651 2:39341360-39341382 CTGAAAAAACTTCAGGAGGCCGG + Intronic
929209651 2:39341360-39341382 CTGAAAAAACTTCAGGAGGCCGG + Intronic
929789543 2:45013099-45013121 AGGGAAAAAGAGAAGGGGGCGGG + Intergenic
929789543 2:45013099-45013121 AGGGAAAAAGAGAAGGGGGCGGG + Intergenic
929897333 2:45973444-45973466 ATGGAAAAACAGAAGGTCACAGG - Intronic
929897333 2:45973444-45973466 ATGGAAAAACAGAAGGTCACAGG - Intronic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
931364547 2:61607811-61607833 CTGAAAAAATAGAAGCAGCCTGG + Intergenic
931364547 2:61607811-61607833 CTGAAAAAATAGAAGCAGCCTGG + Intergenic
931781141 2:65580166-65580188 GTGGAGAAAGAAAAGGAGGCAGG - Intergenic
931781141 2:65580166-65580188 GTGGAGAAAGAAAAGGAGGCAGG - Intergenic
931784861 2:65609469-65609491 CTAGAAACAAAGAAGGAGGTGGG - Intergenic
931784861 2:65609469-65609491 CTAGAAACAAAGAAGGAGGTGGG - Intergenic
931819685 2:65938813-65938835 CTTGAAAAAACGAAGGAGGCTGG + Intergenic
931819685 2:65938813-65938835 CTTGAAAAAACGAAGGAGGCTGG + Intergenic
932115775 2:69045571-69045593 TTGGAAAAAGAAAAGGAGGAAGG + Intronic
932115775 2:69045571-69045593 TTGGAAAAAGAAAAGGAGGAAGG + Intronic
932198115 2:69801760-69801782 CTTGCAAAGCAGAAGTAGGCTGG + Intronic
932198115 2:69801760-69801782 CTTGCAAAGCAGAAGTAGGCTGG + Intronic
932777611 2:74537375-74537397 CTGGAATAACTGAATGAGTCAGG + Intronic
932777611 2:74537375-74537397 CTGGAATAACTGAATGAGTCAGG + Intronic
933162558 2:79041896-79041918 CTGGAAAACAAGAAGGAACCAGG - Intergenic
933162558 2:79041896-79041918 CTGGAAAACAAGAAGGAACCAGG - Intergenic
933331409 2:80896969-80896991 CTGAAAGAACAGGAGTAGGCAGG - Intergenic
933331409 2:80896969-80896991 CTGAAAGAACAGGAGTAGGCAGG - Intergenic
935400087 2:102651219-102651241 TTTGAAAAACAGAAGCAGGCAGG - Intronic
935400087 2:102651219-102651241 TTTGAAAAACAGAAGCAGGCAGG - Intronic
935506572 2:103911984-103912006 CTGGAGTACCAGAAGGAGACAGG + Intergenic
935506572 2:103911984-103912006 CTGGAGTACCAGAAGGAGACAGG + Intergenic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
936066730 2:109338026-109338048 CATCAAAAACAGAAGGAGCCTGG - Intronic
936066730 2:109338026-109338048 CATCAAAAACAGAAGGAGCCTGG - Intronic
937020473 2:118646336-118646358 CTGGAATTACAGGAGGAGGTGGG + Intergenic
937020473 2:118646336-118646358 CTGGAATTACAGGAGGAGGTGGG + Intergenic
937202127 2:120210422-120210444 CTGAAAACAGAGAAGGTGGCTGG + Intergenic
937202127 2:120210422-120210444 CTGAAAACAGAGAAGGTGGCTGG + Intergenic
937213947 2:120298574-120298596 TTGGAAAAACACAGGGAGGGAGG - Intergenic
937213947 2:120298574-120298596 TTGGAAAAACACAGGGAGGGAGG - Intergenic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
937931664 2:127209890-127209912 CTGGAGCACCAGAAGGAGACGGG + Intronic
937931664 2:127209890-127209912 CTGGAGCACCAGAAGGAGACGGG + Intronic
937993625 2:127677583-127677605 CTGGAAAAAGGGGAGGTGGCAGG + Intronic
937993625 2:127677583-127677605 CTGGAAAAAGGGGAGGTGGCAGG + Intronic
939345622 2:140963658-140963680 CTAGAAAAGCAAAAGCAGGCTGG + Intronic
939345622 2:140963658-140963680 CTAGAAAAGCAAAAGCAGGCTGG + Intronic
939692756 2:145285986-145286008 CTGGAAGAGAAGAGGGAGGCTGG - Intergenic
939692756 2:145285986-145286008 CTGGAAGAGAAGAGGGAGGCTGG - Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
940827349 2:158427867-158427889 CTGAAAAAAAAGAAGGAAGTGGG + Intronic
940827349 2:158427867-158427889 CTGAAAAAAAAGAAGGAAGTGGG + Intronic
940961312 2:159789296-159789318 CATGAAAAACTGAAGTAGGCTGG - Intronic
940961312 2:159789296-159789318 CATGAAAAACTGAAGTAGGCTGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
942202696 2:173587760-173587782 GTGGAAAAATGTAAGGAGGCAGG - Intergenic
942202696 2:173587760-173587782 GTGGAAAAATGTAAGGAGGCAGG - Intergenic
942417974 2:175778568-175778590 CTGGTATAACAGAAGGAAGCTGG - Intergenic
942417974 2:175778568-175778590 CTGGTATAACAGAAGGAAGCTGG - Intergenic
942442975 2:176055225-176055247 CTTTAAAAAGAGAAGGTGGCAGG - Intergenic
942442975 2:176055225-176055247 CTTTAAAAAGAGAAGGTGGCAGG - Intergenic
942924239 2:181412630-181412652 TTGGAATACCAGAAGGAGACAGG + Intergenic
942924239 2:181412630-181412652 TTGGAATACCAGAAGGAGACAGG + Intergenic
942932376 2:181511014-181511036 CTAGAAAGTCAGAAGGAGCCAGG - Intronic
942932376 2:181511014-181511036 CTAGAAAGTCAGAAGGAGCCAGG - Intronic
943763125 2:191631544-191631566 TTGGTAAATAAGAAGGAGGCTGG - Intergenic
943763125 2:191631544-191631566 TTGGTAAATAAGAAGGAGGCTGG - Intergenic
943771254 2:191720297-191720319 CTGGACAGACAGAACGAGGCAGG + Intergenic
943771254 2:191720297-191720319 CTGGACAGACAGAACGAGGCAGG + Intergenic
943844467 2:192626185-192626207 CGAGAAAAAGAGAAGGTGGCGGG + Intergenic
943844467 2:192626185-192626207 CGAGAAAAAGAGAAGGTGGCGGG + Intergenic
944147154 2:196518142-196518164 CTTGAAAAACAGAAGAAAGGAGG - Intronic
944147154 2:196518142-196518164 CTTGAAAAACAGAAGAAAGGAGG - Intronic
944984636 2:205161535-205161557 CTGGAACAACAGTAGGAGAATGG - Intronic
944984636 2:205161535-205161557 CTGGAACAACAGTAGGAGAATGG - Intronic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
945984418 2:216342359-216342381 CTGGAACAAGAGAAGGCAGCTGG + Intronic
945984418 2:216342359-216342381 CTGGAACAAGAGAAGGCAGCTGG + Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946613782 2:221487333-221487355 CTGTAAAAACAGGACAAGGCAGG - Intronic
946613782 2:221487333-221487355 CTGTAAAAACAGGACAAGGCAGG - Intronic
946954017 2:224908791-224908813 TTGAAAGAACAGAAGCAGGCTGG - Intronic
946954017 2:224908791-224908813 TTGAAAGAACAGAAGCAGGCTGG - Intronic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
947165279 2:227255319-227255341 CTGGAAAAACGGAAGCAGCAGGG + Intronic
947165279 2:227255319-227255341 CTGGAAAAACGGAAGCAGCAGGG + Intronic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947323904 2:228953811-228953833 CCAGAAAAACAGAAGAAAGCTGG + Intronic
947323904 2:228953811-228953833 CCAGAAAAACAGAAGAAAGCTGG + Intronic
947732221 2:232437559-232437581 CTGGTAAAAGAGACGGAGGCTGG + Intergenic
947732221 2:232437559-232437581 CTGGTAAAAGAGACGGAGGCTGG + Intergenic
947737173 2:232461679-232461701 CTCAAAAAAAAGAAGGAGGGAGG + Intergenic
947737173 2:232461679-232461701 CTCAAAAAAAAGAAGGAGGGAGG + Intergenic
947942733 2:234072686-234072708 CTGAAATCACAGAATGAGGCTGG + Intronic
947942733 2:234072686-234072708 CTGAAATCACAGAATGAGGCTGG + Intronic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
1168891344 20:1296942-1296964 ATGGAAAACCAGAAGAAGGCTGG - Intronic
1168891344 20:1296942-1296964 ATGGAAAACCAGAAGAAGGCTGG - Intronic
1169982049 20:11395574-11395596 CTTGAATAAGTGAAGGAGGCAGG + Intergenic
1169982049 20:11395574-11395596 CTTGAATAAGTGAAGGAGGCAGG + Intergenic
1170923581 20:20702216-20702238 CTGGAAAAACTGTAGATGGCAGG + Intronic
1170923581 20:20702216-20702238 CTGGAAAAACTGTAGATGGCAGG + Intronic
1171084093 20:22219958-22219980 CTGGAGAAAGATAAGGAGCCAGG - Intergenic
1171084093 20:22219958-22219980 CTGGAGAAAGATAAGGAGCCAGG - Intergenic
1172246681 20:33450242-33450264 CTTTAAAAACAAAAAGAGGCTGG - Intergenic
1172246681 20:33450242-33450264 CTTTAAAAACAAAAAGAGGCTGG - Intergenic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1172551658 20:35805197-35805219 CTGGAAAAATAAAAATAGGCCGG - Intronic
1172551658 20:35805197-35805219 CTGGAAAAATAAAAATAGGCCGG - Intronic
1172728200 20:37063806-37063828 CAAGAAAAAAAGAAAGAGGCCGG - Intronic
1172728200 20:37063806-37063828 CAAGAAAAAAAGAAAGAGGCCGG - Intronic
1173018030 20:39244481-39244503 CTGGAAGCACAGAAGGAGTCAGG - Intergenic
1173018030 20:39244481-39244503 CTGGAAGCACAGAAGGAGTCAGG - Intergenic
1173074176 20:39800954-39800976 CTGGAGAACCAAAAGGAAGCAGG - Intergenic
1173074176 20:39800954-39800976 CTGGAGAACCAAAAGGAAGCAGG - Intergenic
1173110187 20:40180097-40180119 CTGGAAAATCAAAAGGGGGTGGG - Intergenic
1173110187 20:40180097-40180119 CTGGAAAATCAAAAGGGGGTGGG - Intergenic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173256833 20:41399743-41399765 CTGGAAAAACAGGATAAGGAAGG - Intergenic
1173256833 20:41399743-41399765 CTGGAAAAACAGGATAAGGAAGG - Intergenic
1173327151 20:42044383-42044405 TTGGAAAACCAGAATGAGCCTGG - Intergenic
1173327151 20:42044383-42044405 TTGGAAAACCAGAATGAGCCTGG - Intergenic
1173890923 20:46509600-46509622 ATGGAAAATGAGAAGGAGGTGGG - Intronic
1173890923 20:46509600-46509622 ATGGAAAATGAGAAGGAGGTGGG - Intronic
1174247419 20:49192048-49192070 CTCAAAAAACAAAATGAGGCTGG + Intergenic
1174247419 20:49192048-49192070 CTCAAAAAACAAAATGAGGCTGG + Intergenic
1174563651 20:51448963-51448985 GTGGAAAAACAGTAGGAGAGGGG - Intronic
1174563651 20:51448963-51448985 GTGGAAAAACAGTAGGAGAGGGG - Intronic
1175141644 20:56865060-56865082 ATGGAAAAGCAGGGGGAGGCTGG + Intergenic
1175141644 20:56865060-56865082 ATGGAAAAGCAGGGGGAGGCTGG + Intergenic
1175167181 20:57053162-57053184 GCAGAAAAACAGAAGGAGCCTGG - Intergenic
1175167181 20:57053162-57053184 GCAGAAAAACAGAAGGAGCCTGG - Intergenic
1175579025 20:60084824-60084846 CTGGAAGAAGATAGGGAGGCAGG - Intergenic
1175579025 20:60084824-60084846 CTGGAAGAAGATAGGGAGGCAGG - Intergenic
1175709622 20:61208963-61208985 CTGGAAAAAAAAAAGGGGGGGGG - Intergenic
1175709622 20:61208963-61208985 CTGGAAAAAAAAAAGGGGGGGGG - Intergenic
1175789821 20:61734245-61734267 TTGGAAAAACAAAAGAAGCCGGG + Intronic
1175789821 20:61734245-61734267 TTGGAAAAACAAAAGAAGCCGGG + Intronic
1177150259 21:17448450-17448472 TTAGAAAAATAGAAGGACGCCGG - Intronic
1177150259 21:17448450-17448472 TTAGAAAAATAGAAGGACGCCGG - Intronic
1178387629 21:32166489-32166511 CTCAAAAAACAGAAGGATGGAGG + Intergenic
1178387629 21:32166489-32166511 CTCAAAAAACAGAAGGATGGAGG + Intergenic
1179290227 21:40012074-40012096 TTTAAAAAACAGCAGGAGGCTGG + Exonic
1179290227 21:40012074-40012096 TTTAAAAAACAGCAGGAGGCTGG + Exonic
1179935884 21:44603058-44603080 GTGGAGACAGAGAAGGAGGCTGG + Intronic
1179935884 21:44603058-44603080 GTGGAGACAGAGAAGGAGGCTGG + Intronic
1180024874 21:45155371-45155393 CTGGCACCAGAGAAGGAGGCTGG - Intronic
1180024874 21:45155371-45155393 CTGGCACCAGAGAAGGAGGCTGG - Intronic
1180208876 21:46281523-46281545 CTGTAAAAACAAAAGGGGGTTGG + Intronic
1180208876 21:46281523-46281545 CTGTAAAAACAAAAGGGGGTTGG + Intronic
1180465095 22:15603829-15603851 CTGGCAAGAGAGAAGGAGCCAGG + Intergenic
1180465095 22:15603829-15603851 CTGGCAAGAGAGAAGGAGCCAGG + Intergenic
1180606825 22:17065216-17065238 ATGGAAAGATAGAAGGAGCCTGG + Intergenic
1180606825 22:17065216-17065238 ATGGAAAGATAGAAGGAGCCTGG + Intergenic
1181752313 22:24997340-24997362 CAGGAAAAAGAGAAGGCGACTGG + Intronic
1181752313 22:24997340-24997362 CAGGAAAAAGAGAAGGCGACTGG + Intronic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182160203 22:28114020-28114042 CTGGAAAAGGATATGGAGGCTGG - Intronic
1182160203 22:28114020-28114042 CTGGAAAAGGATATGGAGGCTGG - Intronic
1182227203 22:28808170-28808192 GGGGAAAGACAGAAGGAGTCTGG + Intergenic
1182227203 22:28808170-28808192 GGGGAAAGACAGAAGGAGTCTGG + Intergenic
1182237224 22:28884590-28884612 CTGGACAAGCAGCAGCAGGCAGG + Intronic
1182237224 22:28884590-28884612 CTGGACAAGCAGCAGCAGGCAGG + Intronic
1182640077 22:31759977-31759999 CTTTAAAACCAGAAAGAGGCTGG - Intronic
1182640077 22:31759977-31759999 CTTTAAAACCAGAAAGAGGCTGG - Intronic
1182663426 22:31941255-31941277 CTGTAAAACGGGAAGGAGGCCGG + Intronic
1182663426 22:31941255-31941277 CTGTAAAACGGGAAGGAGGCCGG + Intronic
1183293074 22:37014724-37014746 CTGGAAAAGGAGACTGAGGCTGG + Intronic
1183293074 22:37014724-37014746 CTGGAAAAGGAGACTGAGGCTGG + Intronic
1183580122 22:38719755-38719777 TTGTAAAAACAGTAGGAGACAGG - Intronic
1183580122 22:38719755-38719777 TTGTAAAAACAGTAGGAGACAGG - Intronic
1183652998 22:39169754-39169776 CTGGAAAAAGGGGAGGAGGAGGG - Intergenic
1183652998 22:39169754-39169776 CTGGAAAAAGGGGAGGAGGAGGG - Intergenic
1184791077 22:46700427-46700449 ATGCAAAATCAGAAGTAGGCCGG + Intronic
1184791077 22:46700427-46700449 ATGCAAAATCAGAAGTAGGCCGG + Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185121418 22:48973879-48973901 CTGGAAGAGCAGTAGGAGGGAGG - Intergenic
1185121418 22:48973879-48973901 CTGGAAGAGCAGTAGGAGGGAGG - Intergenic
949205480 3:1433175-1433197 CAGGAAAAACAGAGAGAGGGAGG - Intergenic
949205480 3:1433175-1433197 CAGGAAAAACAGAGAGAGGGAGG - Intergenic
949207139 3:1453869-1453891 ATGGAAAAACAGAAGGAAATTGG + Intergenic
949207139 3:1453869-1453891 ATGGAAAAACAGAAGGAAATTGG + Intergenic
949679956 3:6501850-6501872 ATAGAAGAAAAGAAGGAGGCTGG - Intergenic
949679956 3:6501850-6501872 ATAGAAGAAAAGAAGGAGGCTGG - Intergenic
950076949 3:10194028-10194050 CTGGCAGAACTGAAGGAGGGTGG + Intronic
950076949 3:10194028-10194050 CTGGCAGAACTGAAGGAGGGTGG + Intronic
950348870 3:12327145-12327167 GTGGTAAAAGAGAAGGAGACTGG + Intronic
950348870 3:12327145-12327167 GTGGTAAAAGAGAAGGAGACTGG + Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950820574 3:15753940-15753962 CTCAAAAAACAGAAGGTGGCTGG + Intronic
950820574 3:15753940-15753962 CTCAAAAAACAGAAGGTGGCTGG + Intronic
952287101 3:31980296-31980318 GTTTAAAAACAGAAAGAGGCCGG - Intronic
952287101 3:31980296-31980318 GTTTAAAAACAGAAAGAGGCCGG - Intronic
953329770 3:42043291-42043313 CTGGACAAAAAGGAGGAGACGGG - Intronic
953329770 3:42043291-42043313 CTGGACAAAAAGGAGGAGACGGG - Intronic
953436559 3:42881875-42881897 CAGGAAAAACAGAAGGAACCTGG - Intronic
953436559 3:42881875-42881897 CAGGAAAAACAGAAGGAACCTGG - Intronic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
954030204 3:47813815-47813837 CTGGAGATACACAAGGAGGCAGG - Intronic
954030204 3:47813815-47813837 CTGGAGATACACAAGGAGGCAGG - Intronic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
954152200 3:48663136-48663158 CTGGAAGGACAGAAAAAGGCTGG - Intergenic
954152200 3:48663136-48663158 CTGGAAGGACAGAAAAAGGCTGG - Intergenic
954181598 3:48885507-48885529 CAAGAAAAACAGAACAAGGCTGG + Intronic
954181598 3:48885507-48885529 CAAGAAAAACAGAACAAGGCTGG + Intronic
954652435 3:52173353-52173375 GAGGCAAAACAGAAGGATGCAGG + Intergenic
954652435 3:52173353-52173375 GAGGCAAAACAGAAGGATGCAGG + Intergenic
955820480 3:62891056-62891078 CTAGAAAAACAAAAGTAGCCGGG + Intergenic
955820480 3:62891056-62891078 CTAGAAAAACAAAAGTAGCCGGG + Intergenic
956449808 3:69363118-69363140 GTGGAAAAATAGAAGAAGCCTGG - Intronic
956449808 3:69363118-69363140 GTGGAAAAATAGAAGAAGCCTGG - Intronic
956896395 3:73665037-73665059 GTGAAAAGACAGAAGGTGGCTGG - Intergenic
956896395 3:73665037-73665059 GTGAAAAGACAGAAGGTGGCTGG - Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960208239 3:114929264-114929286 CTGAAAAAACAGAAGCAGAGAGG + Intronic
960208239 3:114929264-114929286 CTGAAAAAACAGAAGCAGAGAGG + Intronic
960274255 3:115709227-115709249 CTGCAAAAGCAAGAGGAGGCAGG - Intronic
960274255 3:115709227-115709249 CTGCAAAAGCAAGAGGAGGCAGG - Intronic
960608250 3:119530465-119530487 CTGGAAACACAGAACAAGTCTGG + Intronic
960608250 3:119530465-119530487 CTGGAAACACAGAACAAGTCTGG + Intronic
960864466 3:122185057-122185079 CAGGAAATACACATGGAGGCTGG - Intronic
960864466 3:122185057-122185079 CAGGAAATACACATGGAGGCTGG - Intronic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
962930852 3:140034598-140034620 CTGGCAAAAGAGAGGAAGGCAGG - Intronic
962930852 3:140034598-140034620 CTGGCAAAAGAGAGGAAGGCAGG - Intronic
962974929 3:140437610-140437632 CTGTGACAACAGAAAGAGGCTGG + Intronic
962974929 3:140437610-140437632 CTGTGACAACAGAAAGAGGCTGG + Intronic
963047326 3:141112347-141112369 ATCAAAAGACAGAAGGAGGCCGG + Intronic
963047326 3:141112347-141112369 ATCAAAAGACAGAAGGAGGCCGG + Intronic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963768951 3:149368950-149368972 CTGGAAAAAAAAAAGGGGGGGGG + Intergenic
963768951 3:149368950-149368972 CTGGAAAAAAAAAAGGGGGGGGG + Intergenic
963783599 3:149511047-149511069 CTCTACAAAAAGAAGGAGGCTGG - Intergenic
963783599 3:149511047-149511069 CTCTACAAAAAGAAGGAGGCTGG - Intergenic
963836268 3:150060925-150060947 TTGGAAATAGAGAAGGAGGCTGG - Intergenic
963836268 3:150060925-150060947 TTGGAAATAGAGAAGGAGGCTGG - Intergenic
964008439 3:151860055-151860077 CTGGAAAAAGGAATGGAGGCAGG + Intergenic
964008439 3:151860055-151860077 CTGGAAAAAGGAATGGAGGCAGG + Intergenic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
964139820 3:153384835-153384857 CAGAAAAAACAGAAGCAAGCAGG + Intergenic
964139820 3:153384835-153384857 CAGAAAAAACAGAAGCAAGCAGG + Intergenic
964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG + Intergenic
964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG + Intergenic
965076007 3:163977309-163977331 CTGGAATAAAAGAAGGAGAAGGG - Intergenic
965076007 3:163977309-163977331 CTGGAATAAAAGAAGGAGAAGGG - Intergenic
965510062 3:169558363-169558385 CTAGAAAAACAGCAGGATGGAGG - Intronic
965510062 3:169558363-169558385 CTAGAAAAACAGCAGGATGGAGG - Intronic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
965577053 3:170228301-170228323 ATAGAAATACAGAAAGAGGCTGG + Intronic
965577053 3:170228301-170228323 ATAGAAATACAGAAAGAGGCTGG + Intronic
965845275 3:172953805-172953827 CTTGAAAAGGAGAAGGAAGCTGG + Intronic
965845275 3:172953805-172953827 CTTGAAAAGGAGAAGGAAGCTGG + Intronic
966195071 3:177304953-177304975 CTTAAAGATCAGAAGGAGGCCGG - Intergenic
966195071 3:177304953-177304975 CTTAAAGATCAGAAGGAGGCCGG - Intergenic
966250350 3:177859057-177859079 TTGGAATACCAGAAGGAGACAGG - Intergenic
966250350 3:177859057-177859079 TTGGAATACCAGAAGGAGACAGG - Intergenic
966458040 3:180140551-180140573 ATGGAAAGACAGAAAGAGTCTGG - Intergenic
966458040 3:180140551-180140573 ATGGAAAGACAGAAAGAGTCTGG - Intergenic
967356511 3:188577922-188577944 CTGGAAAGAAGGAAGGCGGCAGG - Intronic
967356511 3:188577922-188577944 CTGGAAAGAAGGAAGGCGGCAGG - Intronic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968566039 4:1313431-1313453 CTTAAAGAACAGAAGCAGGCTGG + Intronic
968566039 4:1313431-1313453 CTTAAAGAACAGAAGCAGGCTGG + Intronic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968666637 4:1825959-1825981 CAGGAGAAACAGCAGGTGGCAGG - Intronic
968666637 4:1825959-1825981 CAGGAGAAACAGCAGGTGGCAGG - Intronic
968692278 4:1998676-1998698 CTGGAGTACCAGAAGGAGACGGG + Intronic
968692278 4:1998676-1998698 CTGGAGTACCAGAAGGAGACGGG + Intronic
969584938 4:8086021-8086043 CTGAGAAAACTAAAGGAGGCTGG + Intronic
969584938 4:8086021-8086043 CTGAGAAAACTAAAGGAGGCTGG + Intronic
970407767 4:15779477-15779499 CTTGTAAAACAGAAGAAGCCGGG + Intronic
970407767 4:15779477-15779499 CTTGTAAAACAGAAGAAGCCGGG + Intronic
970430665 4:15986281-15986303 CTGGAAACTCACAACGAGGCAGG + Intronic
970430665 4:15986281-15986303 CTGGAAACTCACAACGAGGCAGG + Intronic
971324900 4:25635715-25635737 CCGGAAAACCAGAAGGACTCAGG + Intergenic
971324900 4:25635715-25635737 CCGGAAAACCAGAAGGACTCAGG + Intergenic
971574091 4:28251884-28251906 GTGGAGAAAGAGAAGGAAGCTGG + Intergenic
971574091 4:28251884-28251906 GTGGAGAAAGAGAAGGAAGCTGG + Intergenic
972229770 4:37058084-37058106 CTGCTGAAACAAAAGGAGGCAGG + Intergenic
972229770 4:37058084-37058106 CTGCTGAAACAAAAGGAGGCAGG + Intergenic
972339331 4:38137405-38137427 CTGGAAGGAGAGAAGGAAGCGGG + Exonic
972339331 4:38137405-38137427 CTGGAAGGAGAGAAGGAAGCGGG + Exonic
972570122 4:40303100-40303122 CAGGAAGGAGAGAAGGAGGCCGG + Intergenic
972570122 4:40303100-40303122 CAGGAAGGAGAGAAGGAGGCCGG + Intergenic
974144543 4:57930641-57930663 ATGAGAAGACAGAAGGAGGCCGG + Intergenic
974144543 4:57930641-57930663 ATGAGAAGACAGAAGGAGGCCGG + Intergenic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
977232344 4:94466699-94466721 CTGAAAAATCAGGAAGAGGCTGG - Intronic
977232344 4:94466699-94466721 CTGAAAAATCAGGAAGAGGCTGG - Intronic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
980047378 4:128004133-128004155 CTAAAAAAACAAAAAGAGGCAGG - Intronic
980047378 4:128004133-128004155 CTAAAAAAACAAAAAGAGGCAGG - Intronic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
981766640 4:148258337-148258359 AAGGAAAGAGAGAAGGAGGCAGG + Intronic
981766640 4:148258337-148258359 AAGGAAAGAGAGAAGGAGGCAGG + Intronic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
984662923 4:182392682-182392704 GTGGAAACAGAGAAGGAGGCAGG + Intronic
984662923 4:182392682-182392704 GTGGAAACAGAGAAGGAGGCAGG + Intronic
984678559 4:182579089-182579111 GTGGAGATACAGAAGAAGGCAGG - Intronic
984678559 4:182579089-182579111 GTGGAGATACAGAAGAAGGCAGG - Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
985571360 5:647302-647324 CTGGAAATCCAGAAACAGGCAGG + Intronic
985571360 5:647302-647324 CTGGAAATCCAGAAACAGGCAGG + Intronic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
986202776 5:5593023-5593045 GAGGAAAAAAAGAAGGAAGCTGG - Intergenic
986202776 5:5593023-5593045 GAGGAAAAAAAGAAGGAAGCTGG - Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
986576074 5:9214204-9214226 CGGGAAAAATAGCAGGAGCCAGG + Intronic
986576074 5:9214204-9214226 CGGGAAAAATAGCAGGAGCCAGG + Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987332497 5:16869566-16869588 CGCTAAAAACAGAAGGTGGCCGG + Intronic
987332497 5:16869566-16869588 CGCTAAAAACAGAAGGTGGCCGG + Intronic
987446274 5:18023284-18023306 ATAGAAAAACAAAAAGAGGCCGG - Intergenic
987446274 5:18023284-18023306 ATAGAAAAACAAAAAGAGGCCGG - Intergenic
988059646 5:26150046-26150068 CTGGAGTACCAGAAGGAGACAGG + Intergenic
988059646 5:26150046-26150068 CTGGAGTACCAGAAGGAGACAGG + Intergenic
988186682 5:27873380-27873402 CTGAAAAAAAATAAGCAGGCCGG + Intergenic
988186682 5:27873380-27873402 CTGAAAAAAAATAAGCAGGCCGG + Intergenic
988385804 5:30563543-30563565 CTGGCAAGTCAGATGGAGGCTGG + Intergenic
988385804 5:30563543-30563565 CTGGCAAGTCAGATGGAGGCTGG + Intergenic
988717501 5:33842638-33842660 CTGGAAAAACAGAGGAAAGTGGG + Intronic
988717501 5:33842638-33842660 CTGGAAAAACAGAGGAAAGTGGG + Intronic
989235354 5:39141907-39141929 CTGGAGAAAAGGAAGGAGTCAGG - Intronic
989235354 5:39141907-39141929 CTGGAGAAAAGGAAGGAGTCAGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990050490 5:51494189-51494211 CTTGAGAAACACAAGAAGGCTGG - Intergenic
990050490 5:51494189-51494211 CTTGAGAAACACAAGAAGGCTGG - Intergenic
990378233 5:55194731-55194753 CTGAAAGGACAGAAAGAGGCTGG - Intergenic
990378233 5:55194731-55194753 CTGAAAGGACAGAAAGAGGCTGG - Intergenic
991087125 5:62657925-62657947 ATGGAAAAACAAAAAAAGGCAGG + Intergenic
991087125 5:62657925-62657947 ATGGAAAAACAAAAAAAGGCAGG + Intergenic
991985726 5:72284487-72284509 ATGGAAAAAGAGAAGGGGGGAGG + Intronic
991985726 5:72284487-72284509 ATGGAAAAAGAGAAGGGGGGAGG + Intronic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992484845 5:77184681-77184703 CTTAAAAAATAGAAAGAGGCTGG + Intergenic
992484845 5:77184681-77184703 CTTAAAAAATAGAAAGAGGCTGG + Intergenic
992728881 5:79638092-79638114 ATGTAAGAACAGAAGAAGGCTGG - Intronic
992728881 5:79638092-79638114 ATGTAAGAACAGAAGAAGGCTGG - Intronic
993247618 5:85470915-85470937 GTGAAAAAAAAGAAGGCGGCTGG + Intergenic
993247618 5:85470915-85470937 GTGAAAAAAAAGAAGGCGGCTGG + Intergenic
994368831 5:98946612-98946634 CTGGGAAAACAGAAAAAAGCTGG - Intergenic
994368831 5:98946612-98946634 CTGGGAAAACAGAAAAAAGCTGG - Intergenic
994650439 5:102520259-102520281 ATAGAAAGACAGAGGGAGGCTGG + Intergenic
994650439 5:102520259-102520281 ATAGAAAGACAGAGGGAGGCTGG + Intergenic
995233535 5:109798986-109799008 TTTAAAAAACAGAATGAGGCTGG - Intronic
995233535 5:109798986-109799008 TTTAAAAAACAGAATGAGGCTGG - Intronic
995864479 5:116676700-116676722 GGAGAAAAAGAGAAGGAGGCTGG - Intergenic
995864479 5:116676700-116676722 GGAGAAAAAGAGAAGGAGGCTGG - Intergenic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997813022 5:136990547-136990569 CTGGAAAAAAAAAAAGAGGGGGG - Intronic
997813022 5:136990547-136990569 CTGGAAAAAAAAAAAGAGGGGGG - Intronic
998020871 5:138769185-138769207 CAGGAAAACAAGAAGGAGCCAGG - Intronic
998020871 5:138769185-138769207 CAGGAAAACAAGAAGGAGCCAGG - Intronic
998516873 5:142763835-142763857 ATGGGAAAACAGAGGGAGCCAGG - Intergenic
998516873 5:142763835-142763857 ATGGGAAAACAGAGGGAGCCAGG - Intergenic
998520327 5:142794361-142794383 CTATAAATACAGAAGGAGGGGGG + Intronic
998520327 5:142794361-142794383 CTATAAATACAGAAGGAGGGGGG + Intronic
998586017 5:143428482-143428504 TTGGAAAGGCAGAAGGAGTCAGG - Intronic
998586017 5:143428482-143428504 TTGGAAAGGCAGAAGGAGTCAGG - Intronic
998675590 5:144404156-144404178 CTGGAAAAAGAGTAAGAGGATGG + Intronic
998675590 5:144404156-144404178 CTGGAAAAAGAGTAAGAGGATGG + Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999493023 5:152070339-152070361 TTGAAAAAACAGAAGGAAGCAGG - Intergenic
999493023 5:152070339-152070361 TTGAAAAAACAGAAGGAAGCAGG - Intergenic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999938853 5:156518158-156518180 ATGGAAAAACAGAAAAAAGCAGG + Intronic
999938853 5:156518158-156518180 ATGGAAAAACAGAAAAAAGCAGG + Intronic
1000004649 5:157172083-157172105 CTGAAAAAACAGAAGAAAACAGG + Intronic
1000004649 5:157172083-157172105 CTGAAAAAACAGAAGAAAACAGG + Intronic
1001546002 5:172570869-172570891 ATGGAAAAAAGGAAGGAGGGAGG + Intergenic
1001546002 5:172570869-172570891 ATGGAAAAAAGGAAGGAGGGAGG + Intergenic
1002169194 5:177366056-177366078 CTGGAAAGATAGCAGGTGGCAGG - Intronic
1002169194 5:177366056-177366078 CTGGAAAGATAGCAGGTGGCAGG - Intronic
1002658814 5:180775918-180775940 CTAGAAAGAAAGAGGGAGGCAGG + Intergenic
1002658814 5:180775918-180775940 CTAGAAAGAAAGAGGGAGGCAGG + Intergenic
1003637519 6:7846510-7846532 GGGGAAACACAGAAGGAGGAAGG + Intronic
1003637519 6:7846510-7846532 GGGGAAACACAGAAGGAGGAAGG + Intronic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004551071 6:16647777-16647799 CTGGAAAAATAAAATAAGGCCGG + Intronic
1004551071 6:16647777-16647799 CTGGAAAAATAAAATAAGGCCGG + Intronic
1004884620 6:20039652-20039674 CTATAAAAACAGAATGAGGCCGG + Intergenic
1004884620 6:20039652-20039674 CTATAAAAACAGAATGAGGCCGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006292246 6:33147293-33147315 TTGGTAAAACAGAAGAAAGCAGG + Intergenic
1006292246 6:33147293-33147315 TTGGTAAAACAGAAGAAAGCAGG + Intergenic
1006677558 6:35775402-35775424 CTTCAAAAGCAGAAGCAGGCTGG + Intergenic
1006677558 6:35775402-35775424 CTTCAAAAGCAGAAGCAGGCTGG + Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1008015088 6:46509546-46509568 ATGGAAAAGCACAAGCAGGCTGG - Intergenic
1008015088 6:46509546-46509568 ATGGAAAAGCACAAGCAGGCTGG - Intergenic
1008037666 6:46762985-46763007 CTGGTAAAACAAAAGAAGGAAGG - Intergenic
1008037666 6:46762985-46763007 CTGGTAAAACAAAAGAAGGAAGG - Intergenic
1008241853 6:49123415-49123437 TTGGAAAGACAGAAGGTGTCTGG - Intergenic
1008241853 6:49123415-49123437 TTGGAAAGACAGAAGGTGTCTGG - Intergenic
1008603643 6:53119577-53119599 CTGGGAAGACAGAATGTGGCAGG - Intergenic
1008603643 6:53119577-53119599 CTGGGAAGACAGAATGTGGCAGG - Intergenic
1009568347 6:65345139-65345161 CTGGAAAAAAAGAAGGAGCTAGG + Intronic
1009568347 6:65345139-65345161 CTGGAAAAAAAGAAGGAGCTAGG + Intronic
1010351540 6:74880911-74880933 TTGGATAAACACCAGGAGGCTGG + Intergenic
1010351540 6:74880911-74880933 TTGGATAAACACCAGGAGGCTGG + Intergenic
1010364665 6:75035423-75035445 CTGGAAAAGCAGGAGAATGCTGG + Intergenic
1010364665 6:75035423-75035445 CTGGAAAAGCAGGAGAATGCTGG + Intergenic
1010591043 6:77712673-77712695 AAGGAACAACAAAAGGAGGCCGG + Intronic
1010591043 6:77712673-77712695 AAGGAACAACAAAAGGAGGCCGG + Intronic
1010841686 6:80653948-80653970 TTATAAAAACAGAAGTAGGCTGG + Intergenic
1010841686 6:80653948-80653970 TTATAAAAACAGAAGTAGGCTGG + Intergenic
1011013175 6:82724829-82724851 CTGGACAACCTCAAGGAGGCGGG + Intergenic
1011013175 6:82724829-82724851 CTGGACAACCTCAAGGAGGCGGG + Intergenic
1011420723 6:87169335-87169357 CTGGAAAAAAAAAAGGAGGCTGG - Intronic
1011420723 6:87169335-87169357 CTGGAAAAAAAAAAGGAGGCTGG - Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1014332991 6:120094737-120094759 CTAGAAAAACAGAGTTAGGCAGG + Intergenic
1014332991 6:120094737-120094759 CTAGAAAAACAGAGTTAGGCAGG + Intergenic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1015882559 6:137883640-137883662 CAGGAAAGAGAGAAGTAGGCAGG + Intergenic
1015882559 6:137883640-137883662 CAGGAAAGAGAGAAGTAGGCAGG + Intergenic
1016689563 6:146921169-146921191 CTGGAAACTCAGAAGGGAGCGGG + Intergenic
1016689563 6:146921169-146921191 CTGGAAACTCAGAAGGGAGCGGG + Intergenic
1016879629 6:148898137-148898159 CTAGCAAGACAGAATGAGGCTGG + Intronic
1016879629 6:148898137-148898159 CTAGCAAGACAGAATGAGGCTGG + Intronic
1017161472 6:151369674-151369696 CTTAAAAAACAGGTGGAGGCTGG + Intronic
1017161472 6:151369674-151369696 CTTAAAAAACAGGTGGAGGCTGG + Intronic
1017614679 6:156232284-156232306 CAGTTAAAACAGAAAGAGGCTGG - Intergenic
1017614679 6:156232284-156232306 CAGTTAAAACAGAAAGAGGCTGG - Intergenic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018728286 6:166630111-166630133 CTGGACAGACAAGAGGAGGCGGG + Intronic
1018728286 6:166630111-166630133 CTGGACAGACAAGAGGAGGCGGG + Intronic
1019080460 6:169426102-169426124 CTGGAAAAACTGAGGGGCGCAGG - Intergenic
1019080460 6:169426102-169426124 CTGGAAAAACTGAGGGGCGCAGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1020121003 7:5503351-5503373 CTCAAAAAACAGAAACAGGCTGG - Intronic
1020121003 7:5503351-5503373 CTCAAAAAACAGAAACAGGCTGG - Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020907677 7:14084653-14084675 AAGGAAAACCAGAAGGAGACAGG - Intergenic
1020907677 7:14084653-14084675 AAGGAAAACCAGAAGGAGACAGG - Intergenic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021111135 7:16696033-16696055 CTTCAAAAGCAGAAGGAGCCGGG - Intronic
1021111135 7:16696033-16696055 CTTCAAAAGCAGAAGGAGCCGGG - Intronic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1021950502 7:25769546-25769568 ATGGAAAGAAAGAAGGAGGGAGG + Intergenic
1021950502 7:25769546-25769568 ATGGAAAGAAAGAAGGAGGGAGG + Intergenic
1022244439 7:28544780-28544802 CTGGAAACAGAGAAGGGAGCTGG + Intronic
1022244439 7:28544780-28544802 CTGGAAACAGAGAAGGGAGCTGG + Intronic
1023322905 7:39018945-39018967 CTGCAATACAAGAAGGAGGCAGG - Intronic
1023322905 7:39018945-39018967 CTGCAATACAAGAAGGAGGCAGG - Intronic
1023613045 7:41990955-41990977 CTGGAAGAAAGGAAGGAGGCAGG + Intronic
1023613045 7:41990955-41990977 CTGGAAGAAAGGAAGGAGGCAGG + Intronic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1024512195 7:50212990-50213012 CTGGAGAAAGAGTGGGAGGCAGG + Intergenic
1024512195 7:50212990-50213012 CTGGAGAAAGAGTGGGAGGCAGG + Intergenic
1025843760 7:65176736-65176758 ATGGAAAAGCACAGGGAGGCCGG - Intergenic
1025843760 7:65176736-65176758 ATGGAAAAGCACAGGGAGGCCGG - Intergenic
1026230247 7:68476571-68476593 CTGGAAAAGGAGAGGGAGACTGG + Intergenic
1026230247 7:68476571-68476593 CTGGAAAAGGAGAGGGAGACTGG + Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026849117 7:73713979-73714001 CTGGCAAAACAGGTGGAGCCTGG - Intronic
1026849117 7:73713979-73714001 CTGGCAAAACAGGTGGAGCCTGG - Intronic
1026973442 7:74481453-74481475 CTTTAAAAACAAAAGCAGGCTGG - Intronic
1026973442 7:74481453-74481475 CTTTAAAAACAAAAGCAGGCTGG - Intronic
1027605815 7:80297191-80297213 CAGGAATAACAGAAAGAGGCAGG - Intergenic
1027605815 7:80297191-80297213 CAGGAATAACAGAAAGAGGCAGG - Intergenic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031863106 7:127005932-127005954 ATGGAAACATAGAAGGATGCTGG - Intronic
1031863106 7:127005932-127005954 ATGGAAACATAGAAGGATGCTGG - Intronic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1031957066 7:127953421-127953443 CAGGAAAAATAGAAGTAGGTGGG - Intronic
1031957066 7:127953421-127953443 CAGGAAAAATAGAAGTAGGTGGG - Intronic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032707210 7:134431821-134431843 CAGGAAGAAAAGAAAGAGGCTGG + Intergenic
1032707210 7:134431821-134431843 CAGGAAGAAAAGAAAGAGGCTGG + Intergenic
1033017314 7:137684964-137684986 ATGAAAAGCCAGAAGGAGGCAGG - Intronic
1033017314 7:137684964-137684986 ATGAAAAGCCAGAAGGAGGCAGG - Intronic
1033879569 7:145863747-145863769 CTGGAGTAACTGAAGGAGACAGG + Intergenic
1033879569 7:145863747-145863769 CTGGAGTAACTGAAGGAGACAGG + Intergenic
1035066394 7:156108327-156108349 CTGCAAAACCAGATGGATGCTGG - Intergenic
1035066394 7:156108327-156108349 CTGCAAAACCAGATGGATGCTGG - Intergenic
1035077643 7:156191532-156191554 CTGCAAAACCAGACAGAGGCTGG - Intergenic
1035077643 7:156191532-156191554 CTGCAAAACCAGACAGAGGCTGG - Intergenic
1035138284 7:156729767-156729789 TTGGGAAAATAGAAGGGGGCTGG - Intronic
1035138284 7:156729767-156729789 TTGGGAAAATAGAAGGGGGCTGG - Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1036460480 8:8948243-8948265 CTGGAAAGAGAGAAGTTGGCAGG - Intergenic
1036460480 8:8948243-8948265 CTGGAAAGAGAGAAGTTGGCAGG - Intergenic
1036468356 8:9024719-9024741 CTATAAAAACATAAAGAGGCTGG - Intronic
1036468356 8:9024719-9024741 CTATAAAAACATAAAGAGGCTGG - Intronic
1036701620 8:11016828-11016850 CTGGAAAAACAGAAGAGGAGAGG - Intronic
1036701620 8:11016828-11016850 CTGGAAAAACAGAAGAGGAGAGG - Intronic
1036799712 8:11781266-11781288 CTGGAAGTTCAGAAGGAGGGTGG + Intronic
1036799712 8:11781266-11781288 CTGGAAGTTCAGAAGGAGGGTGG + Intronic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037786973 8:21909088-21909110 GTGGAAAAAGAGTAGGAGGAGGG + Exonic
1037786973 8:21909088-21909110 GTGGAAAAAGAGTAGGAGGAGGG + Exonic
1037934295 8:22904251-22904273 CTGGAAGAGGAGAAGGAGCCAGG + Intronic
1037934295 8:22904251-22904273 CTGGAAGAGGAGAAGGAGCCAGG + Intronic
1038724664 8:30069893-30069915 CTGCAGAAACTGAAGGAGTCTGG - Exonic
1038724664 8:30069893-30069915 CTGCAGAAACTGAAGGAGTCTGG - Exonic
1039052147 8:33504924-33504946 CTGTAAAAAGAAAAAGAGGCTGG + Intronic
1039052147 8:33504924-33504946 CTGTAAAAAGAAAAAGAGGCTGG + Intronic
1039997908 8:42550434-42550456 CTAGAAAAACAGAACCATGCAGG - Intronic
1039997908 8:42550434-42550456 CTAGAAAAACAGAACCATGCAGG - Intronic
1040873419 8:52124688-52124710 CTGGAAAGACTGGAAGAGGCAGG + Intronic
1040873419 8:52124688-52124710 CTGGAAAGACTGGAAGAGGCAGG + Intronic
1041172738 8:55161501-55161523 CTGAAAAAACAGAAAAGGGCAGG + Exonic
1041172738 8:55161501-55161523 CTGAAAAAACAGAAAAGGGCAGG + Exonic
1041342758 8:56863419-56863441 GGGGAAAAAGAGAAGGAGGAGGG + Intergenic
1041342758 8:56863419-56863441 GGGGAAAAAGAGAAGGAGGAGGG + Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041552179 8:59115665-59115687 CTGGACAGACACATGGAGGCTGG - Intronic
1041552179 8:59115665-59115687 CTGGACAGACACATGGAGGCTGG - Intronic
1041866670 8:62582084-62582106 AAGGAAAGACAGAAGGAGGGAGG - Intronic
1041866670 8:62582084-62582106 AAGGAAAGACAGAAGGAGGGAGG - Intronic
1042413293 8:68490044-68490066 CTAGAAAAGCAGAACAAGGCCGG - Intronic
1042413293 8:68490044-68490066 CTAGAAAAGCAGAACAAGGCCGG - Intronic
1042811143 8:72826439-72826461 CTGGAAGAAGAGAAGGCTGCGGG + Intronic
1042811143 8:72826439-72826461 CTGGAAGAAGAGAAGGCTGCGGG + Intronic
1042811908 8:72834950-72834972 TTGGAAAACCAGCAGGAGGAAGG + Intronic
1042811908 8:72834950-72834972 TTGGAAAACCAGCAGGAGGAAGG + Intronic
1043612805 8:82086657-82086679 CTGCAAAAACAGTAGAAGTCTGG + Intergenic
1043612805 8:82086657-82086679 CTGCAAAAACAGTAGAAGTCTGG + Intergenic
1044708673 8:95033815-95033837 CTTAAAGAACAGAAGAAGGCAGG + Intronic
1044708673 8:95033815-95033837 CTTAAAGAACAGAAGAAGGCAGG + Intronic
1046643265 8:116755923-116755945 CTGGAAAACAGGAGGGAGGCGGG - Intronic
1046643265 8:116755923-116755945 CTGGAAAACAGGAGGGAGGCGGG - Intronic
1047441110 8:124879482-124879504 ATTGAAAAACAGACGTAGGCAGG + Intergenic
1047441110 8:124879482-124879504 ATTGAAAAACAGACGTAGGCAGG + Intergenic
1047649185 8:126901205-126901227 CTTTAAAAAAAGATGGAGGCTGG + Intergenic
1047649185 8:126901205-126901227 CTTTAAAAAAAGATGGAGGCTGG + Intergenic
1047944158 8:129858348-129858370 CTGGAAGAACCAAAGGAAGCTGG + Intronic
1047944158 8:129858348-129858370 CTGGAAGAACCAAAGGAAGCTGG + Intronic
1048073828 8:131047072-131047094 AAGGAAAAACAGAAGAAGGCAGG - Intergenic
1048073828 8:131047072-131047094 AAGGAAAAACAGAAGAAGGCAGG - Intergenic
1048527809 8:135219952-135219974 CAGGATACACAGAAGGATGCAGG + Intergenic
1048527809 8:135219952-135219974 CAGGATACACAGAAGGATGCAGG + Intergenic
1048621218 8:136134749-136134771 TTGGAAAAAGAGCAGAAGGCAGG - Intergenic
1048621218 8:136134749-136134771 TTGGAAAAAGAGCAGAAGGCAGG - Intergenic
1048645197 8:136412103-136412125 CTTGAATAACTGCAGGAGGCAGG - Intergenic
1048645197 8:136412103-136412125 CTTGAATAACTGCAGGAGGCAGG - Intergenic
1049012830 8:139898821-139898843 TTGAAAAAACAGAAACAGGCCGG + Intronic
1049012830 8:139898821-139898843 TTGAAAAAACAGAAACAGGCCGG + Intronic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049441760 8:142612842-142612864 CCGGAAAGACAGACGGAGGGAGG + Exonic
1049441760 8:142612842-142612864 CCGGAAAGACAGACGGAGGGAGG + Exonic
1049568415 8:143355811-143355833 CTGGAAAAAGAACACGAGGCAGG + Intronic
1049568415 8:143355811-143355833 CTGGAAAAAGAACACGAGGCAGG + Intronic
1049845996 8:144801733-144801755 TTAGAAAAATAGAAAGAGGCCGG + Intronic
1049845996 8:144801733-144801755 TTAGAAAAATAGAAAGAGGCCGG + Intronic
1050810364 9:9738559-9738581 CTGTAATCACAGAAGGAGGCTGG - Intronic
1050810364 9:9738559-9738581 CTGTAATCACAGAAGGAGGCTGG - Intronic
1050960721 9:11726903-11726925 CAGGAAAGACAGAACAAGGCTGG - Intergenic
1050960721 9:11726903-11726925 CAGGAAAGACAGAACAAGGCTGG - Intergenic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1052081925 9:24216838-24216860 CTGGAAAAAAAGAAGGAAGTTGG - Intergenic
1052081925 9:24216838-24216860 CTGGAAAAAAAGAAGGAAGTTGG - Intergenic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1055187835 9:73476148-73476170 CTGACAAAAAAAAAGGAGGCTGG - Intergenic
1055187835 9:73476148-73476170 CTGACAAAAAAAAAGGAGGCTGG - Intergenic
1055307705 9:74947378-74947400 CTGGGAAAACAGGGGGAAGCAGG + Exonic
1055307705 9:74947378-74947400 CTGGGAAAACAGGGGGAAGCAGG + Exonic
1055517003 9:77043578-77043600 GTTGAAAAACTGAAGTAGGCTGG + Intergenic
1055517003 9:77043578-77043600 GTTGAAAAACTGAAGTAGGCTGG + Intergenic
1056282763 9:85058119-85058141 CTGGAAAAAAAGAAAGGGGCAGG + Intergenic
1056282763 9:85058119-85058141 CTGGAAAAAAAGAAAGGGGCAGG + Intergenic
1057412028 9:94825288-94825310 CAGGCAAAACAGCAGGATGCGGG - Intronic
1057412028 9:94825288-94825310 CAGGCAAAACAGCAGGATGCGGG - Intronic
1057658556 9:96978948-96978970 CTTAAAAAACAAAAGGAGGCCGG + Intronic
1057658556 9:96978948-96978970 CTTAAAAAACAAAAGGAGGCCGG + Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058203176 9:102068733-102068755 CTGAAAAAAACGAAAGAGGCTGG + Intergenic
1058203176 9:102068733-102068755 CTGAAAAAAACGAAAGAGGCTGG + Intergenic
1058706828 9:107644528-107644550 CTGGATAAACGGAAGAAAGCTGG + Intergenic
1058706828 9:107644528-107644550 CTGGATAAACGGAAGAAAGCTGG + Intergenic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1059631003 9:116122154-116122176 CTAGAAAAACTAAAGGATGCTGG - Intergenic
1059631003 9:116122154-116122176 CTAGAAAAACTAAAGGATGCTGG - Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060789296 9:126475053-126475075 GTGGAATAACAGCAGGAGACAGG - Intronic
1060789296 9:126475053-126475075 GTGGAATAACAGCAGGAGACAGG - Intronic
1060838562 9:126776897-126776919 TTATAAAAACAGGAGGAGGCTGG - Intergenic
1060838562 9:126776897-126776919 TTATAAAAACAGGAGGAGGCTGG - Intergenic
1060914021 9:127374003-127374025 CTCAAAAAAAAAAAGGAGGCTGG + Intronic
1060914021 9:127374003-127374025 CTCAAAAAAAAAAAGGAGGCTGG + Intronic
1061036772 9:128118613-128118635 ATGGAAAAATAGAGGGATGCAGG + Intergenic
1061036772 9:128118613-128118635 ATGGAAAAATAGAGGGATGCAGG + Intergenic
1061938172 9:133870150-133870172 CTGGAAAAACAAAAGCGAGCAGG + Intronic
1061938172 9:133870150-133870172 CTGGAAAAACAAAAGCGAGCAGG + Intronic
1186145590 X:6621193-6621215 TTACAAAAACAGAAGCAGGCTGG - Intergenic
1186145590 X:6621193-6621215 TTACAAAAACAGAAGCAGGCTGG - Intergenic
1187479899 X:19645861-19645883 CTGGAAAAATGGAAGTAGGAGGG + Intronic
1187479899 X:19645861-19645883 CTGGAAAAATGGAAGTAGGAGGG + Intronic
1188092323 X:25978288-25978310 CTGGAATACCTGAAGGAGACAGG + Intergenic
1188092323 X:25978288-25978310 CTGGAATACCTGAAGGAGACAGG + Intergenic
1188581874 X:31723759-31723781 TTTGAAAAGCAGAAGGAAGCTGG - Intronic
1188581874 X:31723759-31723781 TTTGAAAAGCAGAAGGAAGCTGG - Intronic
1188655980 X:32695846-32695868 TTGGAAGAACAGAAAGAGCCAGG + Intronic
1188655980 X:32695846-32695868 TTGGAAGAACAGAAAGAGCCAGG + Intronic
1189630236 X:42944621-42944643 AAGGAAAAACACAAGCAGGCTGG + Intergenic
1189630236 X:42944621-42944643 AAGGAAAAACACAAGCAGGCTGG + Intergenic
1190303914 X:49071876-49071898 CTGGGACAAGAGCAGGAGGCTGG - Exonic
1190303914 X:49071876-49071898 CTGGGACAAGAGCAGGAGGCTGG - Exonic
1190429286 X:50363601-50363623 CTTGAAAACCAAAAGAAGGCTGG + Intergenic
1190429286 X:50363601-50363623 CTTGAAAACCAAAAGAAGGCTGG + Intergenic
1190936639 X:55003900-55003922 CTGGACAAACAGAATCAGTCAGG - Intronic
1190936639 X:55003900-55003922 CTGGACAAACAGAATCAGTCAGG - Intronic
1194837889 X:98703797-98703819 CTGAACAAAAAGAACGAGGCTGG - Intergenic
1194837889 X:98703797-98703819 CTGAACAAAAAGAACGAGGCTGG - Intergenic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1195679163 X:107530797-107530819 CTGGAAAAAAACAAAGGGGCTGG - Intronic
1195679163 X:107530797-107530819 CTGGAAAAAAACAAAGGGGCTGG - Intronic
1195778290 X:108432537-108432559 CTTAAAAAACAAGAGGAGGCCGG + Intronic
1195778290 X:108432537-108432559 CTTAAAAAACAAGAGGAGGCCGG + Intronic
1196320415 X:114333657-114333679 CTGAACAAACAGAACGAAGCTGG - Intergenic
1196320415 X:114333657-114333679 CTGAACAAACAGAACGAAGCTGG - Intergenic
1196349544 X:114710021-114710043 CTGGAAAAGAAGCAGGAGACTGG + Intronic
1196349544 X:114710021-114710043 CTGGAAAAGAAGCAGGAGACTGG + Intronic
1196414652 X:115458012-115458034 ATGGAAAGATAGAAGGAGCCTGG + Intergenic
1196414652 X:115458012-115458034 ATGGAAAGATAGAAGGAGCCTGG + Intergenic
1196810591 X:119626082-119626104 CTGGAAGTACAGAAGAAGACAGG + Intronic
1196810591 X:119626082-119626104 CTGGAAGTACAGAAGAAGACAGG + Intronic
1197744528 X:129922711-129922733 AAGGAAAAAAAAAAGGAGGCTGG - Intronic
1197744528 X:129922711-129922733 AAGGAAAAAAAAAAGGAGGCTGG - Intronic
1197827448 X:130605361-130605383 CTGGAAAAAAAAAAGTAGTCTGG - Intergenic
1197827448 X:130605361-130605383 CTGGAAAAAAAAAAGTAGTCTGG - Intergenic
1197949883 X:131882858-131882880 CTGGAAGTAGAGAAGGAGGGCGG + Intergenic
1197949883 X:131882858-131882880 CTGGAAGTAGAGAAGGAGGGCGG + Intergenic
1198483596 X:137064081-137064103 CTGGAAAAATTGAGGGTGGCTGG + Intergenic
1198483596 X:137064081-137064103 CTGGAAAAATTGAGGGTGGCTGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic
1199922982 X:152429286-152429308 CTGGAGAAAGAGAGGGAGGGAGG - Intronic
1199922982 X:152429286-152429308 CTGGAGAAAGAGAGGGAGGGAGG - Intronic
1200158295 X:153990023-153990045 GTAGAGAAACACAAGGAGGCTGG - Intergenic
1200158295 X:153990023-153990045 GTAGAGAAACACAAGGAGGCTGG - Intergenic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic
1201346933 Y:12994763-12994785 CGAGAAAAACAGAACGGGGCAGG + Intergenic
1201346933 Y:12994763-12994785 CGAGAAAAACAGAACGGGGCAGG + Intergenic
1201585917 Y:15560907-15560929 CTAGAAATACAAAAGGAGGCTGG - Intergenic
1201585917 Y:15560907-15560929 CTAGAAATACAAAAGGAGGCTGG - Intergenic
1202584220 Y:26407549-26407571 TTTGAAAAACAGGAGGGGGCCGG + Intergenic
1202584220 Y:26407549-26407571 TTTGAAAAACAGGAGGGGGCCGG + Intergenic