ID: 1035316139

View in Genome Browser
Species Human (GRCh38)
Location 7:157998471-157998493
Sequence GTCCAACACAGCATCTACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 37}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035316139 Original CRISPR GTCCAACACAGCATCTACGT TGG (reversed) Intronic
901847124 1:11990519-11990541 GTCCACCACATCATCTGAGTAGG - Intronic
1069632228 10:69903964-69903986 GCCGAACACAGCATCCACCTTGG + Intronic
1070266964 10:74912804-74912826 GTACAACACTACATCTACATGGG - Intronic
1072367205 10:94724421-94724443 GTGCACCACAGCATCTGTGTAGG - Exonic
1072378677 10:94842912-94842934 GTGCACCACAGCATCTGTGTAGG - Exonic
1072390545 10:94981258-94981280 GTGCACCACAGCATCTGTGTAGG - Exonic
1076723840 10:132404434-132404456 GTCCAACCCAGGACATACGTAGG + Intronic
1089825331 11:121270433-121270455 GTCCCACACAACATCTCCCTTGG + Intergenic
1093115103 12:15199445-15199467 GTCCAACTCTGAGTCTACGTTGG + Intronic
1122269531 14:100562350-100562372 GTCCTAGACAGCATCCAGGTTGG - Intronic
1141729459 16:85812077-85812099 GCCCGACACAGCATCTGCTTTGG + Intergenic
1141932430 16:87215022-87215044 GTCCATCAGAGCATCTGCCTTGG - Intronic
1143378180 17:6479515-6479537 GTCCAACAGTGCATCTGGGTCGG - Intronic
1147801585 17:43094289-43094311 GTCCAATACATCAGCTACTTTGG + Exonic
1151330212 17:73402059-73402081 TTTCAAGACAGCATCCACGTGGG - Exonic
1151933599 17:77248084-77248106 GTCCAGCTCAGCATCTTCCTTGG - Intergenic
1152015041 17:77744929-77744951 GCCAAACACAGCATCTAGGGAGG + Intergenic
1163175086 19:15558823-15558845 GTCCTACACAGCATCAGTGTGGG + Intergenic
1168872024 20:1137665-1137687 GTCCAACACTGCATTTTAGTTGG - Intronic
1179384173 21:40926507-40926529 TTCCAACAGAGCAACTACATTGG + Intergenic
950952417 3:17014514-17014536 GTCCATAACAGCATTTACTTTGG + Intronic
966595819 3:181724039-181724061 GCCCACCACGGCATCTACCTCGG + Intergenic
971331732 4:25686988-25687010 GCCCAGCACAGCAGCTACCTGGG + Intergenic
987238962 5:15973002-15973024 GTCCAACAAAGAATATAGGTTGG - Intergenic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
999217723 5:149949500-149949522 GTACAACACAGCAAATACGATGG - Intergenic
1005222250 6:23599752-23599774 GTGCAGCAAAGCATCTACTTTGG + Intergenic
1011005991 6:82646123-82646145 ACTCAACACAGCATCTACATGGG + Intergenic
1023368551 7:39489368-39489390 TTCCAAGACAGCACCTACATGGG - Intronic
1030408587 7:109145904-109145926 GTCCTACATAGCATCTAGATGGG - Intergenic
1035316139 7:157998471-157998493 GTCCAACACAGCATCTACGTTGG - Intronic
1043289406 8:78578631-78578653 GTCAAACAAAGCATCAATGTTGG - Intronic
1048145294 8:131836065-131836087 GTCCAATACACCAATTACGTGGG - Intergenic
1049801821 8:144521369-144521391 GTGCAACTCAGCTTCTACGCGGG - Exonic
1054144545 9:61552428-61552450 CTCAAACACAGCATCTAAGGAGG + Intergenic
1054261894 9:62875161-62875183 GCCCAAGACAGCACCTTCGTAGG - Intergenic
1055697727 9:78905224-78905246 GTCCAACAAAGGACCTAAGTAGG - Intergenic
1200287538 X:154838015-154838037 GTCACACACAGCATCTGTGTTGG + Intronic