ID: 1035316855

View in Genome Browser
Species Human (GRCh38)
Location 7:158001937-158001959
Sequence CAGCTTGGCCAGCTTCCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035316855_1035316860 -8 Left 1035316855 7:158001937-158001959 CCAGCCGGAAGCTGGCCAAGCTG 0: 1
1: 0
2: 1
3: 19
4: 161
Right 1035316860 7:158001952-158001974 CCAAGCTGTCTCCAGGTCCTGGG 0: 1
1: 0
2: 3
3: 29
4: 293
1035316855_1035316863 10 Left 1035316855 7:158001937-158001959 CCAGCCGGAAGCTGGCCAAGCTG 0: 1
1: 0
2: 1
3: 19
4: 161
Right 1035316863 7:158001970-158001992 CTGGGATCACGTTGTTTCAGTGG No data
1035316855_1035316858 -9 Left 1035316855 7:158001937-158001959 CCAGCCGGAAGCTGGCCAAGCTG 0: 1
1: 0
2: 1
3: 19
4: 161
Right 1035316858 7:158001951-158001973 GCCAAGCTGTCTCCAGGTCCTGG 0: 1
1: 0
2: 2
3: 21
4: 248
1035316855_1035316864 19 Left 1035316855 7:158001937-158001959 CCAGCCGGAAGCTGGCCAAGCTG 0: 1
1: 0
2: 1
3: 19
4: 161
Right 1035316864 7:158001979-158002001 CGTTGTTTCAGTGGAGACGATGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035316855 Original CRISPR CAGCTTGGCCAGCTTCCGGC TGG (reversed) Intronic
900394257 1:2446700-2446722 CAGGTTGGCCAGCTCTCAGCTGG - Intronic
900763449 1:4488194-4488216 AGACTTGGCCAGCTTCCAGCAGG - Intergenic
901016668 1:6235842-6235864 CAGCCTCGCCACCTTCCTGCTGG - Exonic
901079328 1:6574956-6574978 CACCCTGGCCAACTGCCGGCTGG - Exonic
902388482 1:16089215-16089237 CCGCTTGGCCAGTTTCCGCAGGG + Intergenic
904618589 1:31762845-31762867 CCGCCTCGCCAGCTGCCGGCCGG - Intronic
917146589 1:171899046-171899068 CAGCTAGGCAAGCGTCCGGAGGG - Intronic
920325666 1:205161369-205161391 CTGAGTGGCCAGCTTCCAGCTGG + Exonic
922767547 1:228163705-228163727 CTGCTTGGCCAAACTCCGGCTGG + Intergenic
1064302069 10:14131789-14131811 CAGCTAGGACAGCTTCTAGCGGG - Intronic
1064369172 10:14736161-14736183 CAGCTTGTCCAGTTTAAGGCTGG - Intronic
1072609156 10:97005029-97005051 CAGCCTGGCCAGGTCCAGGCAGG + Intronic
1075869865 10:125763419-125763441 CTGCTGGGCCAGCTTGCCGCCGG + Exonic
1076812857 10:132898336-132898358 GAGCCTGGCCAGCTTCTCGCTGG - Intronic
1077079783 11:720117-720139 CAGCTGCACCAGCTTCCGGATGG - Exonic
1077133416 11:986472-986494 CAGCTTGACCGGCCTCCCGCGGG + Intronic
1077442986 11:2577407-2577429 CACCTGGGCCACCTTCCGGCAGG + Intronic
1077503398 11:2919350-2919372 CAGCTTGGGCGGCCTCCAGCTGG - Exonic
1081848212 11:46256402-46256424 CAGCCTGGGCTGCTTCCTGCTGG - Intergenic
1081907811 11:46680420-46680442 CAGCTTCCCCAGCTTCCTGAAGG + Intronic
1083106748 11:60365575-60365597 CAGTTTGGCCTGCTTTAGGCAGG - Intronic
1083595433 11:63916586-63916608 CAGCGTGGCTAGGGTCCGGCGGG + Exonic
1085035653 11:73298272-73298294 CAGCTGGGCCAGCCTCGTGCTGG + Exonic
1085196191 11:74673213-74673235 CAGCTTCCCCAGCTTACTGCGGG - Intergenic
1085410079 11:76285652-76285674 CTCCTTGGCCAGGTTCCTGCCGG + Intergenic
1089336929 11:117731590-117731612 CAGATTGCCCAGCTTCTGGGGGG - Intronic
1090796886 11:130142931-130142953 CAGCTAGGCCAGTCTCCAGCAGG - Intronic
1091894412 12:4089500-4089522 CAGCTTGGTCTGCATCCGCCAGG - Intergenic
1092118350 12:6025717-6025739 CAGTTTGACCAGCTGACGGCTGG - Intronic
1095971511 12:47904960-47904982 CAGCTTGTCCACCCGCCGGCCGG - Exonic
1096463294 12:51834633-51834655 CCGCTTGGCCAGCTTCTCCCAGG - Intergenic
1096532779 12:52252395-52252417 CAGCTCGGCCAGCTTGCAGCGGG + Intronic
1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096540836 12:52306124-52306146 CAGCTCGGCCAACTTGCAGCGGG - Exonic
1096542534 12:52316027-52316049 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG + Exonic
1096677086 12:53231853-53231875 CAGCCTGGCCAGCCTCGGGAGGG + Intronic
1098870537 12:75812413-75812435 CAGCGTGGCCAGCATCTGGGAGG + Intergenic
1103366132 12:120384788-120384810 CAGCTGGGACAGCTGCAGGCAGG - Intergenic
1103913064 12:124362676-124362698 CAGCTGGGCCAGGTTCTGGGAGG - Intronic
1103913108 12:124362823-124362845 CAGCTGGGCCAGGTTCTGGGAGG - Intronic
1104422846 12:128651375-128651397 GATCTTGGCCTGCTTCCTGCAGG - Intronic
1104714445 12:131007015-131007037 CAGCAAGGCCAGCTTCCTGGTGG - Intronic
1107016901 13:35714761-35714783 CAGCCAGGGCAGCTTCCAGCTGG + Intergenic
1109925047 13:69126408-69126430 CAGCTCAGGCAGCTTCAGGCTGG + Intergenic
1112200425 13:97268982-97269004 CAGCTGAGCCACCCTCCGGCAGG - Intronic
1112563245 13:100532213-100532235 CAGCAGGGCCACCTTCCCGCCGG - Exonic
1113321131 13:109233412-109233434 CAGCTCCACCAGCTTCTGGCAGG - Intergenic
1113334192 13:109362683-109362705 CACCTTGTCCACCTTCCGGGAGG + Intergenic
1120191908 14:81447242-81447264 CAGCTCTGCCAGCTTCTAGCTGG + Intergenic
1121117967 14:91356894-91356916 TAGCTTGCCCACCTTCCTGCTGG - Intronic
1121974890 14:98393789-98393811 CAGCTTTGCCAGCCTGTGGCTGG - Intergenic
1122316672 14:100829406-100829428 GGGCTTGGCCAGCATCCTGCTGG + Intergenic
1124639448 15:31387741-31387763 GGGCTTGGCCAGGTTCAGGCAGG + Intronic
1126683717 15:51228530-51228552 GAGCTTGGCCAGCGCCTGGCTGG + Intronic
1127868284 15:63048838-63048860 CACCTGGGCCAGCTGGCGGCGGG + Intronic
1129519354 15:76176262-76176284 CAACTTGGCCGGAGTCCGGCGGG - Intronic
1129664016 15:77569353-77569375 CTGCCTGGTCAGCTTCCTGCTGG + Intergenic
1132618454 16:853409-853431 GAGCTTTGCCTCCTTCCGGCAGG + Intergenic
1132969945 16:2682373-2682395 AGGCTGGGCCCGCTTCCGGCGGG - Intergenic
1134070182 16:11255840-11255862 CAGCCTGGCCAGCAGGCGGCGGG - Intronic
1134204007 16:12222474-12222496 CAGTTGGGGCAGCTTCCCGCTGG + Intronic
1136350084 16:29701052-29701074 CAATTTGGCCAGTTTCCGGTGGG - Intergenic
1136532123 16:30876760-30876782 CAGCCTGGCCAGCTTCCTTGTGG + Intronic
1136619478 16:31418502-31418524 CAGCAAGGCCACCTTCCAGCTGG + Exonic
1137617335 16:49855748-49855770 CGGCTTCGCCTGCTTCCGCCTGG + Intronic
1138219827 16:55241189-55241211 CAGCTGGGGCAGCTTTAGGCTGG + Intergenic
1138497425 16:57416731-57416753 GTGCTGGGCCGGCTTCCGGCAGG - Intergenic
1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG + Intronic
1141634713 16:85308031-85308053 CAGCGTGGACAGCTTCCACCAGG + Intergenic
1141749445 16:85948381-85948403 CACCTGGGCCAGCTTCTGGCCGG - Intergenic
1142707866 17:1708030-1708052 CACCTTGGCCCTCTTCCGCCTGG - Exonic
1143730828 17:8881789-8881811 CAGCTCCTCCTGCTTCCGGCAGG + Exonic
1144675369 17:17158355-17158377 CAGCATTGCCAGCTTCTGCCTGG + Intronic
1145257898 17:21337624-21337646 CGGCCTGGCCAGCTCCCTGCTGG + Intergenic
1145318736 17:21750382-21750404 CGGCCTGGCCAGCTCCCTGCTGG - Intergenic
1147421794 17:40325587-40325609 CTGCTTGGCCAGCTCCTGGCGGG + Intronic
1147597173 17:41724720-41724742 CAGCTTGTCCGGCTGGCGGCAGG + Exonic
1148674650 17:49438414-49438436 CAGCTCGGCCAGCTGCTGGAGGG + Intronic
1150764692 17:67993784-67993806 CAACCAGGCCAGCTTCCGGGAGG - Intergenic
1151821601 17:76499930-76499952 CACCTAGACCAGCTTCCTGCAGG + Intronic
1157453422 18:47804868-47804890 CAGCATGGCCAGGGTGCGGCAGG - Intergenic
1160389618 18:78520323-78520345 CTGCTGGGGCAGCTTCCTGCAGG - Intergenic
1160661756 19:304406-304428 CAGCTTGCCCTGCCTCCAGCAGG - Intergenic
1161670365 19:5604457-5604479 CAGCCTTGCCAGCTTCCTGCTGG - Intronic
1163131050 19:15273234-15273256 CAACTTGGCTAGCTACCGCCAGG - Intronic
1163559477 19:18010300-18010322 CAGCCACGCCAGCTTCCTGCTGG + Exonic
1164705744 19:30318141-30318163 CATCTTGGCCAGTTTCCCCCAGG + Intronic
1165051513 19:33144578-33144600 CAGCATGGCCAGTTTCCACCTGG + Intronic
1165767967 19:38362516-38362538 CAGCTTCGCCATCTTCCTGTCGG + Exonic
1166391338 19:42410490-42410512 CAGCTCGGCCAGGTTGTGGCTGG + Exonic
1168046572 19:53798394-53798416 CAGGTTGGGCATCTGCCGGCTGG - Exonic
926050999 2:9744778-9744800 CAGCTTGCACAGCCTCCTGCCGG - Intergenic
926250373 2:11152517-11152539 CTCCTTGGCCAGCTTCAGTCAGG + Intergenic
926391150 2:12394238-12394260 CAGCATGGGCAGCTTCTGGTGGG + Intergenic
926754735 2:16225740-16225762 CAGCCTGGCCCTCTTCTGGCAGG - Intergenic
931253143 2:60550857-60550879 CAGCCCGGCCAGGTACCGGCGGG - Intronic
931666908 2:64616203-64616225 CAGCTTCTCCAGCTTCCAGATGG - Intergenic
933313186 2:80685939-80685961 CAGCTTCTTCAGCTTCCGGTTGG - Intergenic
933993597 2:87651268-87651290 CAGCATGGCCGGATTCTGGCAGG - Intergenic
935856705 2:107282392-107282414 CAGGTTGGCCAGCCTCTGGTGGG + Intergenic
936300266 2:111299615-111299637 CAGCATGGCCGGATTCTGGCAGG + Intergenic
937907363 2:127058817-127058839 CAGCCTGGCATGCTTCCGGGAGG - Intronic
938207628 2:129437715-129437737 CAGTGTGGCCAGCTGCCAGCCGG + Intergenic
1173863078 20:46297037-46297059 CAACTCAGCCAGCTTCAGGCTGG - Intronic
1174425804 20:50430858-50430880 CAGCAAGGCCAGTTTCCGGGTGG + Intergenic
1175857501 20:62130226-62130248 GAGCTTGCACAGCTGCCGGCTGG - Exonic
1175904971 20:62375263-62375285 CAGCTGGGGCATCTTCCTGCCGG - Intergenic
1179778967 21:43687456-43687478 CAGCTGGGCCAGAGTCCTGCTGG - Intronic
1180569782 22:16704130-16704152 CAGTTTGACCAGCTGACGGCTGG - Intergenic
1181628236 22:24135648-24135670 CAGCATGGCCAGCTCCCAGCTGG + Intronic
1181771929 22:25131798-25131820 CAGCTCTGCCATCTGCCGGCTGG + Intronic
1182147169 22:28003648-28003670 CAGCTTGCCAAGCTTCCCTCCGG - Intronic
1182437641 22:30340955-30340977 CAGCTTGGCCTGCTGCCGGCTGG - Intronic
1184259244 22:43305363-43305385 CAGCTTGGTCTGATTCTGGCAGG + Intronic
1185156771 22:49197762-49197784 GAGCTGGGCCGGCTTCCCGCTGG - Intergenic
953032453 3:39187485-39187507 CAGGTTAGCCAGGTCCCGGCTGG - Exonic
954763908 3:52897327-52897349 CAGCTTCGGCATCTTCCTGCAGG - Exonic
963010019 3:140760223-140760245 CAGCTCGGCAAGCATCTGGCTGG - Intergenic
965596887 3:170419185-170419207 CAGCTCATCCAGCTTGCGGCAGG - Exonic
966040212 3:175475633-175475655 CAGGTTGGCCAGTTTCTGGCAGG - Intronic
966919228 3:184601629-184601651 CGCCTTGGCCACCTTCCCGCAGG + Intronic
969506873 4:7593631-7593653 CAGGTTGGCCAGGTTTCGGCTGG - Intronic
972336554 4:38112008-38112030 TAGCTTGGCCAGTTTCATGCAGG + Intronic
981423833 4:144581272-144581294 CAGCTTGGCCATCCTCAGGCGGG - Intergenic
982074528 4:151725270-151725292 CAGCTCGGCTGGCTTCTGGCTGG - Intronic
982133027 4:152247448-152247470 CAGCCAGGCCAGCTTCCTGCAGG + Intergenic
982375368 4:154684574-154684596 AGGCTGGGCCAGCTTCCCGCAGG + Intronic
985536173 5:466867-466889 CAGCTTGGCCACGTTCAGGCTGG - Exonic
988346494 5:30043100-30043122 CAGCTACGGAAGCTTCCGGCTGG + Intergenic
992379957 5:76227246-76227268 CAGCTGGGCCAGCTCCTTGCAGG + Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
996861573 5:128072880-128072902 CTGCCTGGCCAGCTTCAGACAGG + Intergenic
998674811 5:144395527-144395549 CAGCTGGGCCAGCTGCCTGCAGG + Intronic
999364303 5:151011847-151011869 CAGCAGGGCCAGCTTCCAGTGGG - Intergenic
1001749710 5:174119382-174119404 CAGCTTGACCAGCTTGCATCTGG - Intronic
1003426639 6:6002390-6002412 CAGCATGGCCAACTACCCGCAGG - Exonic
1003852850 6:10242562-10242584 CAGTTTGCCCAGCTTTGGGCAGG - Intergenic
1004128677 6:12898638-12898660 CACCTTGGCCAGCTCCTGGCAGG + Intronic
1004198163 6:13524368-13524390 GAGCCTGGCCAGCTAGCGGCAGG - Intergenic
1007074815 6:39059746-39059768 CAGCTTGGCCAGCGTCTGCTGGG + Intronic
1007273833 6:40658964-40658986 CAGGGTTGCCAGCTTCAGGCTGG + Intergenic
1008515083 6:52311187-52311209 AAGCTTGGACAAATTCCGGCTGG - Intergenic
1017672473 6:156779485-156779507 CAGCCGGGCCTGCTTCCGCCCGG + Intronic
1017721453 6:157246108-157246130 GACCTTGGGCAGCTGCCGGCAGG + Intergenic
1017905958 6:158757688-158757710 AGGCATGGCCAGCTTCCAGCAGG - Intronic
1019610088 7:1932128-1932150 CAGCCTGGGCAGCCTCCAGCGGG - Intronic
1021904409 7:25319082-25319104 TCCCTTGGCCAGCTTCCTGCAGG - Intergenic
1023833315 7:44052920-44052942 CACCATGGCCAGCTTCCTGAAGG + Exonic
1024540372 7:50471008-50471030 CAGCTGGGCCATCTGCCGGGTGG + Intronic
1026322466 7:69279694-69279716 TAGGTTGGCCTGCTTCCGGAGGG + Intergenic
1029581959 7:101442253-101442275 AAGCTGGGCCTGCTTTCGGCTGG + Intronic
1030354883 7:108530960-108530982 CAGTTTATCCAGCTTCCTGCTGG + Intronic
1030499335 7:110339898-110339920 CATCTTGGACAGCTTTCGGGAGG - Intergenic
1031385254 7:121141970-121141992 CAGCTTTGCCAGCTACCCTCTGG + Exonic
1034466536 7:151233034-151233056 AAGCGCGGCCAGCTTCCGACAGG - Exonic
1034487633 7:151375968-151375990 CAGCTTGGACAGCCTCGGGTGGG + Intronic
1034512275 7:151545718-151545740 CAAATTGGCCAGCTTCTGGCTGG + Intergenic
1035235251 7:157493616-157493638 CAGCTTTGACTGCTTCCCGCAGG - Intergenic
1035316855 7:158001937-158001959 CAGCTTGGCCAGCTTCCGGCTGG - Intronic
1037319041 8:17626940-17626962 CGGCTTGGCCAGCACCTGGCTGG - Intronic
1037450701 8:19013727-19013749 CAGCCTCGCCAGCCTCCGCCAGG - Intronic
1037805862 8:22057614-22057636 CAGCCTGGCCAGCCACTGGCTGG - Intronic
1038019584 8:23541613-23541635 CTGGCTGGCCAGCTTCCTGCAGG - Intronic
1039921252 8:41896054-41896076 CACCTTGGACAGCACCCGGCAGG - Intronic
1041289069 8:56291230-56291252 CAGCTTAGCAAGCCTCCAGCTGG + Intergenic
1047482386 8:125296809-125296831 CACCTTGGCCATTTTCCTGCAGG - Intronic
1049021272 8:139959132-139959154 CAGCTTGGCCACTTTCTGACTGG + Intronic
1049322302 8:142003024-142003046 CAGCTCAGCCAGCCTCCAGCAGG - Intergenic
1049592373 8:143468503-143468525 CAGCCTGGCCATCATCCGGCAGG - Exonic
1053046863 9:34927124-34927146 CAGTTTGGCCAGCTCAAGGCAGG + Intergenic
1058893428 9:109380542-109380564 CACCGTGCCCAGCTTCCAGCTGG + Intronic
1058949580 9:109891114-109891136 CAGCTTGACCAGATTCTAGCTGG + Intronic
1059434330 9:114267108-114267130 CAGCTTAGCCAGCGTGAGGCGGG - Intronic
1060155097 9:121313995-121314017 GAGCTTGGCCAGCTTGCGGTTGG - Exonic
1061282527 9:129605758-129605780 GAGCTAGGCCAGCATCAGGCAGG - Intergenic
1061431211 9:130532583-130532605 CAGCATGCCCAGCCTCAGGCTGG + Intergenic
1061674579 9:132208510-132208532 CAGCCTGGCCGGGTTCTGGCAGG + Intronic
1186402860 X:9275629-9275651 CTGCATGGCCAGCTTGCTGCTGG - Intergenic
1187367469 X:18676554-18676576 CAGAGTGGCCAGCCACCGGCCGG + Intronic
1199030938 X:142999260-142999282 CAGCTTGGCTATCTTCTAGCTGG - Intergenic
1199354784 X:146849452-146849474 CAGATTGGCCAATTTCCTGCAGG - Intergenic