ID: 1035317520

View in Genome Browser
Species Human (GRCh38)
Location 7:158006092-158006114
Sequence GGGCAGCAGGTGCCCCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 1, 2: 4, 3: 23, 4: 385}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035317520_1035317530 8 Left 1035317520 7:158006092-158006114 CCTTCTTGGGGCACCTGCTGCCC 0: 1
1: 1
2: 4
3: 23
4: 385
Right 1035317530 7:158006123-158006145 TGCCTCTCCTGGGGCAGCACAGG 0: 1
1: 0
2: 5
3: 27
4: 356
1035317520_1035317533 28 Left 1035317520 7:158006092-158006114 CCTTCTTGGGGCACCTGCTGCCC 0: 1
1: 1
2: 4
3: 23
4: 385
Right 1035317533 7:158006143-158006165 AGGCACCTGCAACCAACTTACGG No data
1035317520_1035317527 -1 Left 1035317520 7:158006092-158006114 CCTTCTTGGGGCACCTGCTGCCC 0: 1
1: 1
2: 4
3: 23
4: 385
Right 1035317527 7:158006114-158006136 CCTTCCTCCTGCCTCTCCTGGGG No data
1035317520_1035317523 -3 Left 1035317520 7:158006092-158006114 CCTTCTTGGGGCACCTGCTGCCC 0: 1
1: 1
2: 4
3: 23
4: 385
Right 1035317523 7:158006112-158006134 CCCCTTCCTCCTGCCTCTCCTGG 0: 1
1: 0
2: 16
3: 161
4: 1023
1035317520_1035317525 -2 Left 1035317520 7:158006092-158006114 CCTTCTTGGGGCACCTGCTGCCC 0: 1
1: 1
2: 4
3: 23
4: 385
Right 1035317525 7:158006113-158006135 CCCTTCCTCCTGCCTCTCCTGGG 0: 1
1: 0
2: 11
3: 129
4: 957

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035317520 Original CRISPR GGGCAGCAGGTGCCCCAAGA AGG (reversed) Intronic
900086292 1:899322-899344 GGCCAGAAGGTGCCCCCAGCCGG - Intergenic
900302828 1:1986485-1986507 AGGCACCTGGTGCCCCCAGAGGG + Intronic
900390344 1:2431188-2431210 GAGCAGCAGGGGCCCCCAGGGGG - Intronic
900564169 1:3324237-3324259 GGGCACTAGGAGCCCCAAGGAGG + Intronic
901333085 1:8425401-8425423 GTGCAGCAAGGGACCCAAGAAGG + Intronic
901764394 1:11490688-11490710 GGGCAGGAGGTGGCCAGAGAGGG + Intronic
902449641 1:16488728-16488750 GAGCAGCAGGCGCTCCAAGCAGG - Intergenic
902504841 1:16932614-16932636 GAGCAGCAGGCGCTCCAAGCAGG + Intronic
902510289 1:16963246-16963268 GGGCAGCAGGTGCCTCACTGAGG + Intronic
905294390 1:36945028-36945050 GGGCAGCAGGTGTGCCCAGCTGG + Intronic
907044173 1:51289610-51289632 GGACAGCAGGTGCCCCAAGAAGG - Intronic
907221407 1:52909608-52909630 GGGCCGCATGTGGCCCAGGATGG - Intronic
907412503 1:54292555-54292577 GGGCAGCAGGGGTCCTCAGAGGG - Intronic
907426758 1:54384612-54384634 TGGCAGCAAGTGCTCCAAGCTGG + Intronic
907974126 1:59414516-59414538 GGGACACAGGTGCCCCCAGAGGG - Intronic
910299020 1:85684387-85684409 GGGCAGCATGGCCCCAAAGAGGG + Intronic
911586273 1:99694997-99695019 GGGCCGCATGTGGCCCAGGATGG - Intergenic
912514959 1:110211459-110211481 GGGCAGCGGCCGCCCCAAGCCGG + Exonic
913598045 1:120396379-120396401 GGGCAGCAGCAACTCCAAGAGGG + Intergenic
914089284 1:144482941-144482963 GGGCAGCAGCAACTCCAAGAGGG - Intergenic
914309327 1:146451274-146451296 GGGCAGCAGCAACTCCAAGAGGG + Intergenic
914592784 1:149121863-149121885 GGGCAGCAGCAACTCCAAGAGGG - Intergenic
915018785 1:152760669-152760691 GGGCAGGAGGCGCCCCAGGAGGG - Exonic
915135552 1:153728711-153728733 CGGGAGCAGGAGCCCCAGGAGGG + Exonic
915360809 1:155285383-155285405 GGTCAGCAGGTGCTCCTATAGGG + Intronic
915930844 1:160060044-160060066 AGGGAACAGGAGCCCCAAGAAGG - Intronic
920372487 1:205488127-205488149 GGGCTGCATGTGGCCCAGGATGG - Intergenic
920613694 1:207468266-207468288 GGACAGCATGTGGCCCAGGATGG + Intronic
921970426 1:221142516-221142538 GGGAAGAAGGTGGCCCAAGGTGG + Intergenic
923046952 1:230362513-230362535 GGTCAGGAGGTTCCCCCAGAAGG - Intronic
1063524545 10:6772776-6772798 GGGCTGCACGTGGCCCAGGATGG - Intergenic
1063738718 10:8793254-8793276 GGGCCGCATGTGACCCTAGATGG + Intergenic
1063936084 10:11079811-11079833 TGGCAGAAGCTGACCCAAGAGGG - Intronic
1064256142 10:13744137-13744159 GGCCAGCAGCTGCTCCAAGACGG - Intronic
1064706652 10:18079388-18079410 GGGCTGCATGTGGCCCAGGATGG - Intergenic
1065586790 10:27226580-27226602 GGGCAGCATGTGGCCCAAGACGG + Intronic
1065616761 10:27535179-27535201 GGGCTGCATGTGGCCCAGGATGG + Intronic
1065679382 10:28213358-28213380 AGGCAGCAGATGCCCCACGTGGG + Intronic
1067078224 10:43199992-43200014 AGGCAGCACCTGCTCCAAGATGG - Intronic
1067362622 10:45596273-45596295 TGGCAGCAGGTGTTCCATGAAGG + Intergenic
1070655218 10:78266788-78266810 GGGTAGCAGGAGCCCCATCAAGG + Intergenic
1070669508 10:78368210-78368232 GGGCAAAGGATGCCCCAAGACGG - Intergenic
1070679093 10:78436258-78436280 GAGCAGGGGGTGCCCCGAGAAGG - Intergenic
1070753437 10:78977180-78977202 GGGCAGCAGGTCCCACCAAAGGG - Intergenic
1070801463 10:79246726-79246748 GAGCAGCAGCTGCCTCACGAGGG + Intronic
1071532183 10:86398897-86398919 GGGCTCCAGCTGCCCAAAGAGGG + Intergenic
1071600797 10:86957904-86957926 GGGCAGCAGGTCCCCTGAGATGG - Intronic
1073144430 10:101271253-101271275 GGGAATCAGGAGCCCCAGGAGGG + Intergenic
1073303090 10:102482855-102482877 GGGCTGCACGTGGCCCAGGATGG - Intronic
1073461176 10:103666864-103666886 GGGCTGCAGGTGCCAGGAGAAGG + Intronic
1074438503 10:113454686-113454708 GGCCTGCAGGCGCCACAAGATGG - Intergenic
1075435647 10:122438946-122438968 GGGCCGCATGTGGCCCAGGACGG - Exonic
1076355305 10:129848304-129848326 GGGCAGCAGGTGCTCTGGGAAGG - Intronic
1076602118 10:131664050-131664072 GGGCTGCATGTGGCCCAGGATGG - Intergenic
1076737431 10:132465097-132465119 GGGCAGCAGGTCCCCCCACAGGG + Intergenic
1077147411 11:1052348-1052370 TGGGGGCAGGTGCCCCAGGAGGG - Intergenic
1077239294 11:1502306-1502328 GGGCCTCAGGTGCCACCAGAGGG + Intergenic
1077327283 11:1969282-1969304 GGGCAGGAGGCCCCCCAAGCGGG - Intronic
1080190309 11:29537494-29537516 GGGCTGCATGTGGCCCAGGATGG + Intergenic
1080623687 11:34009083-34009105 GGGCAGCATGTGTCCCAGGATGG - Intergenic
1080642470 11:34165880-34165902 GTACAGCAGGTACCCCAGGAAGG + Intronic
1081047078 11:38288998-38289020 GGGCCGCAAGTGCCCCAGAATGG + Intergenic
1081567919 11:44271022-44271044 GGGCAATGGGGGCCCCAAGATGG - Intronic
1083950583 11:65953508-65953530 GGGCAGCAGGAGCCTCACGGAGG - Intronic
1084004127 11:66314326-66314348 GGGAAGCAGGAGCCCAGAGAGGG - Intergenic
1084766604 11:71313220-71313242 GGTCTCCAGGTGCACCAAGAAGG - Intergenic
1085384724 11:76150408-76150430 GGGCAGAAGGGGCACCATGAAGG + Intergenic
1085394470 11:76200339-76200361 CAGCAACAGGTTCCCCAAGAAGG - Intronic
1085394998 11:76202695-76202717 GGGCAGCTGCAGCCCCAAGCTGG - Intronic
1085470655 11:76755523-76755545 GGGCCGCATGTGGCCCAGGACGG - Intergenic
1085494820 11:76959452-76959474 GGGCCGCATGTGACCCAGGATGG + Intronic
1085530759 11:77190677-77190699 GGCCTGGAAGTGCCCCAAGAGGG - Exonic
1087118198 11:94545307-94545329 GGGCAGCCGGTGCCCGAAATTGG + Exonic
1087782635 11:102317563-102317585 GGGCAGCAGGTGGGCAAGGAAGG + Exonic
1088157914 11:106831405-106831427 GGCAAGGAAGTGCCCCAAGACGG + Intronic
1088298550 11:108328839-108328861 GGGCCGCATGTGGCCCAGGACGG - Intronic
1088334680 11:108690577-108690599 GGGTATCAGGTGCTCCAAGGAGG - Intronic
1088364954 11:109030960-109030982 GGGTTGCAGGTGCCCAAGGAAGG + Intergenic
1088522185 11:110712126-110712148 GGGAGGCAGCTGCACCAAGAAGG - Exonic
1089189770 11:116645193-116645215 GGGCAGCAGGAGCCCGCAGCAGG + Intergenic
1091319357 11:134639126-134639148 GGGCAGGAGGAGGCCCCAGATGG + Intergenic
1202810265 11_KI270721v1_random:24462-24484 GGGCAGGAGGCCCCCCAAGCGGG - Intergenic
1091752664 12:3032482-3032504 GGGCAGCAGTTGGCCCCAGCTGG + Intronic
1091788554 12:3257801-3257823 GTGCAGCAGGTGCCCAGAGGTGG + Intronic
1092163830 12:6330452-6330474 GGGCAGAAGGTGGCCCTGGATGG - Intronic
1093574498 12:20711140-20711162 GGGTTGCATGTGGCCCAAGATGG - Intronic
1093651311 12:21648617-21648639 AGGCAGCAGGGGCCACCAGACGG + Intronic
1094608024 12:31966232-31966254 GGGCAGCATGCAGCCCAAGACGG - Intronic
1096560076 12:52429805-52429827 GGTGAGAAGCTGCCCCAAGAGGG + Intronic
1097153456 12:56995877-56995899 GGGCAGCAGGAAGCCCAGGATGG - Exonic
1097925664 12:65122922-65122944 GAGTAGCAGATGCCTCAAGAGGG + Intergenic
1099143803 12:79013411-79013433 GGGCACCAGGAACTCCAAGAGGG + Intronic
1101631250 12:106497035-106497057 GGGCGGCATGTGGCCCAGGACGG + Intronic
1102463038 12:113112072-113112094 GAGCACCAGGTGCGCCAGGATGG - Exonic
1102543051 12:113636228-113636250 AGGCATGAGGTGCCCCAAAAGGG + Intergenic
1104391322 12:128392867-128392889 AGGCCGCAGGTGGCCCAGGATGG - Intronic
1104837512 12:131800933-131800955 GGGCAGCATCTGCCCGAGGACGG - Intergenic
1104895694 12:132162620-132162642 GGGCGGCTGGTGACCCGAGAGGG - Intergenic
1106592741 13:31111105-31111127 GGGCACCAGGTGCCCTTGGATGG + Intergenic
1106995857 13:35478807-35478829 GTTCTGCAGGTGGCCCAAGAAGG - Intronic
1107155545 13:37163058-37163080 GGGCAGCATGTGGCCCAGGACGG + Intergenic
1108106385 13:47014889-47014911 GGGAAGCAGCTGCCCCCATAGGG - Intergenic
1109135877 13:58649910-58649932 GGGAAGCAGCTGCCCCCAAATGG + Intergenic
1111822122 13:93227488-93227510 GGAGAGCAGCAGCCCCAAGAGGG - Exonic
1113487225 13:110663129-110663151 AGTCAGCAGATGCACCAAGAGGG + Intronic
1113694525 13:112334767-112334789 GGGCCGCATGTGGCCCAGGATGG - Intergenic
1114463082 14:22900734-22900756 GGGCAACAGCTGCCACAAGGAGG + Exonic
1114624642 14:24120970-24120992 TGGCAGCAAGTGCCCAAAAAAGG + Exonic
1115199527 14:30838055-30838077 GGGCTGCATGTGGCCCAGGATGG - Intergenic
1117956289 14:61125992-61126014 GGGAAGCAGATGTCCCAAGGAGG - Intergenic
1118299648 14:64603800-64603822 GGGCATCAGGTGCCCCCTGATGG + Intergenic
1118965943 14:70585480-70585502 GGGCAGCATGAGGCCCAGGATGG + Intronic
1119179352 14:72594511-72594533 GGGGTGCAGGAGCCCAAAGAAGG - Intergenic
1119543761 14:75457322-75457344 GGGACGAAGGAGCCCCAAGAAGG + Intronic
1121239473 14:92418349-92418371 GAGCCACAGCTGCCCCAAGATGG - Intronic
1121251684 14:92504463-92504485 GGGCTGCAGGAGCCCAGAGAAGG + Intergenic
1121940403 14:98064768-98064790 GAGCAGAGGCTGCCCCAAGAGGG - Intergenic
1122089402 14:99328267-99328289 GGGCAGCGTGTGCCCTGAGAAGG - Intergenic
1122128703 14:99592920-99592942 GGACAGAAGGTGCCGAAAGAGGG + Intronic
1122630517 14:103105610-103105632 GAGAAGGAGGTGTCCCAAGATGG - Intronic
1122906799 14:104805367-104805389 CGGCAGGAGCTGACCCAAGAGGG - Intergenic
1122931702 14:104936087-104936109 GAGCAGCAGGGGCCCCCACAGGG - Exonic
1123998110 15:25733176-25733198 GGGCAGCAGCTGCCTCATGGAGG + Intronic
1125752116 15:42036365-42036387 TGGGAGCAGGAGCCCCAGGAGGG + Intronic
1125851887 15:42912048-42912070 GGGCCGCACGTGGCCCAGGACGG - Intronic
1125933524 15:43616342-43616364 GGGCACCAGGTGCCCAAGGCTGG - Exonic
1125946622 15:43715804-43715826 GGGCACCAGGTGCCCAAGGCTGG - Intergenic
1127568245 15:60214529-60214551 GAGCAGCAGATGCTCTAAGAGGG + Intergenic
1127681602 15:61303348-61303370 GGGGAGCAGGTGCCGTAAGGAGG + Intergenic
1128345498 15:66850269-66850291 CGGCAGCCTGTGCCCCAAGCTGG + Intergenic
1128750499 15:70145451-70145473 GGGCAGCTGGTGCCCAGGGAGGG + Intergenic
1129466576 15:75727544-75727566 GGGCAGTGAGTGCCCCAAGAGGG - Exonic
1131067365 15:89442861-89442883 GGGCTGCATCTGCCCCAAGGGGG + Intergenic
1132601058 16:773168-773190 GGGCAGCAGGTGCTGCAACAGGG + Exonic
1132699388 16:1215882-1215904 GGGCAGCAGGTGGCCAAGGTGGG + Intronic
1133146196 16:3788438-3788460 AGGCAGCATAAGCCCCAAGAGGG + Intronic
1133799393 16:9072793-9072815 GGGTAGCATGAGCCCCAACAAGG + Intergenic
1135866709 16:26109544-26109566 GGGGAGCAGGAGCCTCCAGATGG - Intronic
1135984537 16:27174394-27174416 GGGCAGGAGGCGACCCAGGAAGG + Intergenic
1136010909 16:27363029-27363051 GGGCTGCAGCTGCCCCATGCTGG - Exonic
1136188022 16:28599504-28599526 GGGCAGCTTCTGCCCCTAGAGGG - Intergenic
1136190494 16:28612498-28612520 GGGCAGCTTCTGCCCCTAGAGGG - Intronic
1136316516 16:29457725-29457747 GGGCAGCTTCTGCCCCTAGAGGG + Exonic
1136431093 16:30197067-30197089 GGGCAGCTTCTGCCCCTAGAGGG + Exonic
1136682805 16:31977829-31977851 GAGCAACAGGAGCCCCAGGAGGG - Intergenic
1136783443 16:32921395-32921417 GAGCAACAGGAGCCCCAGGAGGG - Intergenic
1136886344 16:33932454-33932476 GAGCAACAGGAGCCCCAGGAGGG + Intergenic
1137718521 16:50613418-50613440 AGGCAGCAGGGACCCCCAGATGG + Intronic
1137924769 16:52530125-52530147 GGGCAGCAGGGACTTCAAGAAGG + Intronic
1138529816 16:57628794-57628816 TGGCAGCAGGTACCCAAACAAGG + Intronic
1139506045 16:67398589-67398611 GCAGAGCAGGTGCCCCAGGAGGG + Exonic
1139564271 16:67763543-67763565 GGGCAGCTGGTGCCCTCAGCAGG - Intronic
1142103357 16:88287490-88287512 GGGTAGCAGGTGCTACAAGGTGG - Intergenic
1142278132 16:89133592-89133614 GGGCAGCAGGGCCACCAGGAAGG - Intronic
1142283628 16:89161807-89161829 GGGCAGCGGCTGGCCCAGGACGG - Intergenic
1203086094 16_KI270728v1_random:1185379-1185401 GAGCAACAGGAGCCCCAGGAGGG - Intergenic
1142994157 17:3751126-3751148 GGGAAGCAGGTGCTCTCAGATGG + Intronic
1143136625 17:4716052-4716074 GGACAGCTCGTTCCCCAAGAGGG + Intronic
1143237988 17:5419647-5419669 GGGGAGCAGTTGGGCCAAGATGG - Exonic
1144280912 17:13725691-13725713 GGACAGCAGGGGCTCCAGGAAGG + Intergenic
1144451476 17:15383442-15383464 AGGCTGCTGGAGCCCCAAGATGG - Intergenic
1144547859 17:16215011-16215033 GGGCAGCCGGTGCCCCGGGTGGG - Intronic
1146058537 17:29593026-29593048 GGGTGGCAGGTGGCCGAAGAGGG - Intronic
1146453213 17:32991014-32991036 TGGTAGCAGGTGCCCCAGGATGG - Intronic
1146453240 17:32991114-32991136 TGGCAGTGGGTGCCCCAGGATGG - Intronic
1146903666 17:36604055-36604077 GAGCTGGAGGTGCCCCAAGCAGG + Intronic
1147219814 17:38921934-38921956 GGGCAGCAGAGGTCCCAGGAGGG - Intergenic
1148052786 17:44777330-44777352 GGGCAGCAGGTTCTCCCAGGAGG + Intronic
1148108244 17:45130757-45130779 GGGCATCAGGAGCCCCAGAAAGG - Intronic
1150132801 17:62678435-62678457 AGGCAGTAGGTGCCCCCTGAGGG + Intronic
1150500161 17:65643132-65643154 GGGCTGAAGGAGTCCCAAGAGGG + Intronic
1151273309 17:73013610-73013632 GGGCAGCAGGTGGCCCAGGACGG + Intronic
1151948079 17:77330224-77330246 GAGCAGCAGGTGCTCCAAGAGGG - Intronic
1152354621 17:79800846-79800868 GGGAAGCAGGTGTCCCTAGGAGG - Intronic
1152659017 17:81533939-81533961 GGGCAGCAGGAGCCCGCAGGAGG - Intronic
1153093526 18:1374808-1374830 GGCCAGCAAGGTCCCCAAGATGG + Intergenic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1154290465 18:13102055-13102077 GGGCACCAGGAACCCCCAGAAGG - Intronic
1155413108 18:25567612-25567634 GGGCTGCATGTGTCCCAGGATGG + Intergenic
1155703843 18:28782984-28783006 GGGCCGCATGTGGCCCAGGATGG + Intergenic
1159999956 18:75008148-75008170 GGGCAGCAGGGGACCCATGGAGG + Intronic
1160607908 18:80066117-80066139 GGGCAGCAGGACCCCGATGAGGG + Intronic
1160812320 19:1018148-1018170 AGGCACCCAGTGCCCCAAGATGG + Intronic
1161065672 19:2236161-2236183 GGGCATGAGGGGCCCCAAGAAGG - Exonic
1161417329 19:4154765-4154787 GGGCAGCAGCTGGCCCAACCCGG + Intronic
1161663506 19:5561195-5561217 GGGCACCCAGGGCCCCAAGAGGG + Intergenic
1161821313 19:6532795-6532817 GCGCAGCTGGTGGCCCAAAATGG + Exonic
1161965878 19:7548474-7548496 GGGCTGCACGTGGCCCAGGATGG - Intronic
1162725579 19:12688237-12688259 GGTCTGCAGGTGTCCAAAGATGG + Intronic
1163237694 19:16038904-16038926 GGGCGGCAGCTGCCCGAGGAGGG - Intergenic
1163292764 19:16391481-16391503 GGGTAGCAGGAGCCCTGAGAAGG + Intronic
1165898112 19:39155466-39155488 GAGGAGCAGGTGCCTCAAGTGGG + Intronic
1166274186 19:41740360-41740382 GGGGAGCAGGGACCTCAAGAGGG + Intronic
1166318761 19:42003573-42003595 GGGGGGCCGGTGCCCCAAGGAGG - Exonic
1166977996 19:46616281-46616303 AGGCATCAGATGCCCCAAGTTGG + Intergenic
1167716581 19:51146165-51146187 GGGCAGTGGGTGGCCCATGAGGG - Intronic
1167722239 19:51186590-51186612 GGGCAGTGGGTGGCCCATGAGGG - Intergenic
1168177040 19:54633640-54633662 GGGGAGCTGGGGCCCCCAGACGG - Exonic
925022884 2:585697-585719 GGGAAGCAGGTGCCCGAATCAGG + Intergenic
925268732 2:2586621-2586643 GGGCAGCTGGTGCCACACGGGGG - Intergenic
925402950 2:3588677-3588699 GGGCTGCATGTGGCCCAGGATGG + Intergenic
929130267 2:38561021-38561043 GGGCAGCAGGTCCTCCTAGAGGG - Intergenic
929792129 2:45031132-45031154 GAGCAGCTGGGGCACCAAGAAGG - Intergenic
930029418 2:47049255-47049277 GGGCTGCTTGTGCCCCAGGATGG + Intronic
931652158 2:64478332-64478354 GGGCAGCAGGTGGCCCGCGAGGG - Intergenic
931934727 2:67184430-67184452 GGGCAAAAAGTGCCTCAAGAGGG - Intergenic
932119526 2:69085398-69085420 AGGCAGCAAGTCCCCAAAGATGG + Intronic
933372510 2:81433627-81433649 GAGCTGCATGTGACCCAAGATGG + Intergenic
937305311 2:120867225-120867247 GGGCAGCCGCTGCCCCTGGAAGG + Intronic
937976055 2:127582676-127582698 GGACAGCAGGTGGCCCAAGAAGG - Intronic
938386389 2:130870191-130870213 GGGGAGGAGGTGCCACAAGAGGG - Intronic
938620180 2:133043593-133043615 GGGCTGCATGTGACCCAGGATGG - Intronic
938775785 2:134540167-134540189 TGGCAGCAGGTGCCAGAGGACGG + Intronic
946410409 2:219512754-219512776 GGTCAGCTGGTTCCCCAAGCTGG - Intergenic
946766998 2:223050178-223050200 GGGCAGCAGGGACTCCAAGCAGG + Intergenic
947025636 2:225734881-225734903 GGGCAGCAGGTACTCCCTGAGGG + Intergenic
947503629 2:230690479-230690501 TGTCAGCAGGGCCCCCAAGAAGG - Intergenic
947952586 2:234160977-234160999 GGGCAGAAAGTGCACCAGGAAGG + Intergenic
948271911 2:236680907-236680929 GGGCAGCAGGTGCCATGTGATGG - Intergenic
948658542 2:239492031-239492053 GAGCAGCAGGTGCTCCAGGCTGG - Intergenic
948681070 2:239635016-239635038 GGGCAGCACGTGACCAACGACGG - Intergenic
1168818909 20:760540-760562 GATCAGCAGGTGGCCCAGGAGGG + Exonic
1169003118 20:2182685-2182707 GGAAAGCAGGTGCCCAAAGCTGG + Intergenic
1169201023 20:3710309-3710331 AGGCAGAAGGTGCCCCAGCAGGG + Intergenic
1169905172 20:10595466-10595488 TGGGAGCTGGTGCCCCAAGTAGG + Intronic
1170986678 20:21265632-21265654 AGGCAGCAGGTGGCCTCAGAGGG - Intergenic
1172136591 20:32690510-32690532 GGGCTGCAGGTGCTGCAACATGG + Intergenic
1172390690 20:34562888-34562910 GGGCAGGAGGAGCCCAAAGCAGG + Intronic
1172762836 20:37334039-37334061 CCCCAGCAGGTGCCCCCAGAGGG + Intergenic
1175167645 20:57056403-57056425 GAGCAGTAAGTGCCCCCAGAAGG - Intergenic
1175404670 20:58718359-58718381 GGGCAGCAGGGGCCAGAGGATGG - Intronic
1175487789 20:59357695-59357717 GGGCACCTGGTGGCCCAAGAAGG + Intergenic
1176114990 20:63428302-63428324 GGGCAGCTGGGGCCCCCAGGAGG + Intronic
1176167747 20:63682861-63682883 GGGCAACTGGTTCCCCAACACGG - Intronic
1176183609 20:63765993-63766015 GGGCAGCAGGTGGGCCCAGCGGG - Intronic
1176278080 20:64285884-64285906 TGCCAGCAGGTGCCAGAAGAGGG + Intronic
1176304779 21:5117685-5117707 GGGCAGCAGGTGGCACAACTGGG + Intronic
1177247233 21:18543564-18543586 TGGCAGCAGGTGAGACAAGATGG - Intergenic
1178691462 21:34753670-34753692 GGGCAGGAAGTGGCCCAAGGAGG - Intergenic
1179614384 21:42572286-42572308 TGCCACCAGGTGCCCCAGGACGG - Intronic
1179852275 21:44144345-44144367 GGGCAGCAGGTGGCACAACTGGG - Intronic
1179993324 21:44959823-44959845 GGAAAGCAGGTGTCCCAACAAGG - Intronic
1181627016 22:24129112-24129134 GGACAGCAGGTGTCCCCAGAGGG + Intronic
1181631147 22:24152013-24152035 GGGGAAAAGATGCCCCAAGATGG - Intronic
1182076572 22:27499287-27499309 GGGCAGCAGGTGGCGGAACAGGG - Intergenic
1182716926 22:32364407-32364429 GGGCAGCAGGTGCACCAGCAGGG + Intronic
1182747399 22:32616222-32616244 GGGCAGCAGGAGCCTCGAGGTGG + Intronic
1183597076 22:38819117-38819139 GGGCACCACATGCCACAAGATGG + Exonic
1183742384 22:39675958-39675980 AGGCAGCAGGTGCCACAGGAGGG + Intronic
1184549631 22:45197564-45197586 GGACAGCAGGTGCGCCAGAAAGG + Intronic
1185076809 22:48687549-48687571 GGGCACCAGGTTCCCTGAGAAGG + Intronic
1185207777 22:49550012-49550034 GTGGAACAGGTGCCCCAGGAAGG - Intronic
949947543 3:9202457-9202479 GTGCAGGAGCTGCCCCAGGAGGG - Intronic
949978274 3:9480741-9480763 GGGCTGCACGTGGCCCAGGATGG - Intergenic
950433206 3:12963360-12963382 GAGCAGCTGGGACCCCAAGAAGG + Intronic
952420026 3:33122269-33122291 GGGCAGCAGCAGCAGCAAGAAGG - Intronic
952928814 3:38343823-38343845 GGGCTGCATGTGGCCCAGGATGG - Intergenic
953879943 3:46686380-46686402 GGACTGCAGGTTCCCAAAGAGGG + Exonic
953920841 3:46950139-46950161 GAGCATCAGGTTCCCTAAGAGGG - Intronic
954302210 3:49706044-49706066 GCTCCGCCGGTGCCCCAAGAGGG + Exonic
954453099 3:50582260-50582282 GGGCAGCTGGGGCCACAAGCAGG + Exonic
955452753 3:59087571-59087593 GGGCTGCAGGTGAACCAGGAGGG - Intergenic
955704108 3:61710531-61710553 GGGCAGCATGTACCCCAGGATGG + Intronic
955833766 3:63031477-63031499 GGGGAGCAGTGGCCCCAGGATGG + Intergenic
957614995 3:82515834-82515856 GGGCAGCATGTGGCCCAGGATGG - Intergenic
957639821 3:82837845-82837867 GGGCTGCATGTGGCCCAGGATGG - Intergenic
959084972 3:101842469-101842491 GGGCTGCATGTGGCCCAGGATGG + Intronic
960148978 3:114232138-114232160 AGGCAGCAGGTGGCTCCAGATGG + Intergenic
961211622 3:125130057-125130079 GGAAAGCAGGTCCCCTAAGAGGG + Intronic
961400342 3:126636842-126636864 GGGCTGCAGGAGGCCCAGGATGG + Intronic
961474870 3:127140314-127140336 GGGCAGCAGGTGCACAGAGTGGG + Intergenic
961715347 3:128853800-128853822 GGGGCTCGGGTGCCCCAAGATGG - Intergenic
961811405 3:129523831-129523853 GGGACTCGGGTGCCCCAAGATGG + Intergenic
961846519 3:129769160-129769182 GGGCCGCACGTGGCCCAGGATGG + Intronic
961902137 3:130223369-130223391 GGGCAGTATGTGGCCCAGGATGG + Intergenic
965612025 3:170554583-170554605 GGGCAGCTGGTGGCTCATGAAGG - Intronic
966901659 3:184491356-184491378 GGACAGCAGCAGCCCCAGGACGG + Intronic
966902971 3:184500341-184500363 TGGCAGCAGGTGTCCCTCGAGGG + Intronic
967162939 3:186755334-186755356 TGACAACAGGTGCCCCAAGGTGG - Intergenic
967217822 3:187225274-187225296 GGGCAGCTGGTGCCTCCACAAGG - Intronic
968556113 4:1247339-1247361 TGGAAGCAGGTGCTCAAAGATGG + Intronic
968618492 4:1592976-1592998 GGGCAGCAGCTGCCCGAATCAGG - Intergenic
968646558 4:1744060-1744082 GAGCGGAAGGTGCCCCCAGAGGG + Intronic
968814449 4:2814753-2814775 GGGAAGGAGGGGCCCCAGGAAGG + Intronic
969315039 4:6376943-6376965 GAACAGCAGGTGCCCAGAGAGGG + Intronic
969343007 4:6553976-6553998 GGGGTCCTGGTGCCCCAAGAAGG - Intronic
969345000 4:6564575-6564597 AGGCAGCTGGGACCCCAAGAGGG - Intergenic
969488373 4:7485177-7485199 AGGCTGCAGGAGCCCCAGGAGGG - Intronic
969690560 4:8701867-8701889 GGGCAGTGGGTGCCCCTGGAAGG - Intergenic
973248290 4:48034234-48034256 GGGCTGCATGTGGCCCAGGACGG + Intronic
973664775 4:53147857-53147879 GGGCTGCATGTGGCCCAGGATGG - Intronic
973774641 4:54232443-54232465 GGGAAGGAGGCGCCCCAAGTCGG - Intronic
974030501 4:56772145-56772167 GGACAGCAGCAGCCCCCAGAGGG - Intergenic
977283007 4:95066031-95066053 GAACAGCAGCTGTCCCAAGAAGG - Intronic
978109469 4:104945238-104945260 GGGGATAAGGTGCTCCAAGAAGG - Intergenic
978746798 4:112203947-112203969 CTCCAGCAGATGCCCCAAGAGGG - Intergenic
981420994 4:144550164-144550186 GGGCTGCATGTGGCCCAGGACGG - Intergenic
985648392 5:1095823-1095845 GGGCAGCACGTGCTCCCAGTAGG + Intronic
985749590 5:1666870-1666892 GGGCAGCATGCGGCCCAGGATGG - Intergenic
985777803 5:1854023-1854045 AGGCAGCAGGGGCCACGAGATGG - Intergenic
986014928 5:3749279-3749301 AGGAAGCAGATGCTCCAAGAAGG - Intergenic
986172221 5:5324354-5324376 GGTCAGCAGGTGTCCCATGAAGG - Intergenic
986579951 5:9255551-9255573 GGGCAGAAGGTGGTCCCAGAAGG - Intronic
987277185 5:16374496-16374518 GGTCAGCAGCTGCCCAGAGATGG - Intergenic
988485841 5:31667583-31667605 GGGCAGGAGGGCCACCAAGAAGG + Intronic
992629451 5:78666455-78666477 GGAAAGAAGCTGCCCCAAGATGG - Intronic
992643656 5:78792411-78792433 GGGCTGCACGTGGCCCAGGATGG - Intronic
993499716 5:88651661-88651683 GGGCTGCATGTGGCCCAGGATGG - Intergenic
994082534 5:95723266-95723288 GGGCCGCATGTGGCCCAGGATGG - Intronic
994475564 5:100264224-100264246 GGGCTGCATGTGGCCCAGGATGG + Intergenic
995227654 5:109720749-109720771 GGGCTGCATGTGGCCCAGGACGG - Intronic
995972910 5:117994520-117994542 AGACAGCACGTGACCCAAGACGG - Intergenic
997510629 5:134451413-134451435 GTGCAGCAGGTGACTCAGGAGGG - Intergenic
998078350 5:139254723-139254745 TGGCAGCATGTTCTCCAAGAAGG - Intronic
999053603 5:148550169-148550191 CACCAGCAGGTTCCCCAAGATGG + Exonic
999122177 5:149218029-149218051 GGGTAGGAGGAGCCCCAGGAGGG + Intronic
999243194 5:150139151-150139173 GGGCAGCAGAGGCCCAGAGAAGG + Intronic
1001257081 5:170192419-170192441 GGGCAACAGCTGCCTCTAGAAGG - Intergenic
1001420617 5:171583798-171583820 GGGCTGGAGGTGGACCAAGAGGG - Intergenic
1002681504 5:180969049-180969071 GGGCAGAAGGTGACCCAAACTGG + Intergenic
1004067626 6:12264689-12264711 GGGCAGCATGTGGTCCAGGATGG - Intergenic
1004278573 6:14259311-14259333 GGGCAGAAGGAGCACCAGGAAGG + Intergenic
1004604018 6:17176993-17177015 GGGGAGCAGGAGGCCCCAGAGGG - Intergenic
1004922599 6:20390675-20390697 GGGCGGCATGTGGCCCAAGACGG - Intergenic
1006034806 6:31202822-31202844 GGGCAGAAGGTGCGGCAGGAAGG - Exonic
1006358650 6:33575342-33575364 GGGCTGCAGGTGCTGCAACATGG + Exonic
1006436932 6:34030556-34030578 GGGCATCTGGTGCCCAGAGAGGG - Intronic
1006447189 6:34086238-34086260 GGGCAGCAGGAGGCCCAGGCTGG - Intronic
1007252255 6:40503762-40503784 GGGAAGCAGGTGCTCCTGGAAGG + Intronic
1007915891 6:45561382-45561404 GGGCAGAGGGGGCCCCAAGGAGG + Intronic
1008044225 6:46835329-46835351 GAGCAGCAGGTCTCCGAAGAAGG + Exonic
1008125044 6:47658593-47658615 AGGAAGCAGATGCACCAAGAGGG - Intronic
1008251092 6:49240629-49240651 TGGCAACAGGTCCTCCAAGATGG - Intergenic
1009966469 6:70583769-70583791 GGGCTGCATGTGGCCCAGGATGG - Intronic
1010742530 6:79525816-79525838 GGGCGGCAGGAGCCACAAGCCGG + Intronic
1010791956 6:80075224-80075246 TGGCAGCAGGTACCCTAAAATGG + Intergenic
1013656657 6:112253910-112253932 GGGGCGCAGGTGCCCCAGCAGGG + Intronic
1015417056 6:132961436-132961458 GGGCAGCAGAGGCCCCATGGTGG + Intergenic
1016595934 6:145801312-145801334 AGGCAGCATGTGGCCCAGGACGG + Intronic
1016703049 6:147075705-147075727 GTGCAGTATGTGCACCAAGATGG - Intergenic
1017230377 6:152067324-152067346 AGGCAGCAGGTGTCGAAAGACGG + Intronic
1018151556 6:160944659-160944681 GGGAAGCAGGTGGCCAAGGATGG + Intergenic
1018207767 6:161451510-161451532 GGGCAGCAGGTTCCCTCAGGTGG - Intronic
1019010383 6:168839872-168839894 GGGGAGCACGAGGCCCAAGAAGG + Intergenic
1019262665 7:90342-90364 GGGCAGCAGGGCCCCAAGGAAGG + Intergenic
1019898311 7:4000122-4000144 GGGAAGGAGGGGGCCCAAGATGG + Intronic
1019958253 7:4434501-4434523 GGCCAGAAGGTGCACGAAGAAGG + Intergenic
1020354632 7:7263212-7263234 GGGCTGCATGTGGCCCAGGACGG + Intergenic
1021765281 7:23942842-23942864 GGGCAGCAGGTAGAGCAAGAGGG - Intergenic
1023852401 7:44157767-44157789 GGGCAGCTGCTGCCAGAAGATGG + Intronic
1023938969 7:44758022-44758044 GGGCAGCGTCTGCCCCAACATGG + Exonic
1024517548 7:50272179-50272201 GGCCAGCAGGGGTCCCAAGCTGG - Intergenic
1025017361 7:55449815-55449837 GGGCTGCAGGGGCCGCAGGAGGG - Intronic
1025019377 7:55468623-55468645 GCCCAGCAGGTGGCCCAGGATGG + Intronic
1025020968 7:55478960-55478982 GGGCAGCAGGGGCCCATGGAAGG + Intronic
1027601399 7:80245499-80245521 GGGCAGCTGCTACCCCATGAGGG - Intergenic
1029609321 7:101618290-101618312 GGGTAGCAGGTGCCTCTAGGCGG + Intronic
1031603094 7:123737222-123737244 GGGCTGCATGTGGCCCAGGACGG - Intronic
1032013133 7:128359796-128359818 CAGCAGCAGGTCCCCGAAGATGG + Exonic
1032429610 7:131849970-131849992 TGGCTGCAGGTGTTCCAAGAAGG - Intergenic
1032481836 7:132253618-132253640 GGTCAGAAGGTGAACCAAGAGGG - Intronic
1032777897 7:135134088-135134110 GGGAAGCAGGTACTACAAGAGGG + Intronic
1034489417 7:151385419-151385441 GGGCAGCCAGTGCTCCAACAGGG + Intronic
1035227689 7:157442674-157442696 AGGCAGGAGGAGCCCCAAGCTGG + Intergenic
1035286879 7:157812318-157812340 GCGAAACAGGTGCCCCAGGAAGG - Intronic
1035317520 7:158006092-158006114 GGGCAGCAGGTGCCCCAAGAAGG - Intronic
1035352963 7:158259321-158259343 GGGAAGCAGGTGGCCCATGCAGG + Intronic
1035829588 8:2680283-2680305 GGACAGCAGCTGCCACATGATGG - Intergenic
1036413123 8:8520803-8520825 GGGCCACATGTGCCCCAGGATGG - Intergenic
1037977738 8:23225150-23225172 GAGCCGCAGGTGCCCCGAAAAGG - Intergenic
1041274304 8:56142026-56142048 AGGCTGCAGCTGCACCAAGAAGG - Intergenic
1042080064 8:65041859-65041881 GGGCAGCAGGAGCTCAGAGAAGG - Intergenic
1044079365 8:87864879-87864901 GGGCTGCATGTGACCCAGGATGG - Intergenic
1045469389 8:102497548-102497570 GGGCAGCTGATACACCAAGAGGG + Intergenic
1047654030 8:126955864-126955886 GGGCTGCATGTGGCCCAGGATGG + Intergenic
1048083538 8:131154006-131154028 AGGCCGCAGGTAGCCCAAGATGG - Intergenic
1048640467 8:136352832-136352854 GGGCAGAAGTTGGCCTAAGATGG + Intergenic
1049205996 8:141363839-141363861 GGGCAGCAGATGGCCCAGGGTGG + Intronic
1049325535 8:142019617-142019639 GGGCAGCCGTTGGCCCATGAGGG + Intergenic
1049436915 8:142590638-142590660 GGGCAGCTGGGGCCCTCAGAGGG + Intergenic
1049709811 8:144058413-144058435 GGGCAGCAGGCGGGCCATGAGGG + Intronic
1049790298 8:144469328-144469350 GGGCAGCAAGGGCCCCCAGCCGG + Exonic
1051389610 9:16550182-16550204 GGGCTGCATGTGGCCCATGAAGG + Intronic
1052363807 9:27589311-27589333 GGGCAGCTGGCCACCCAAGATGG + Intergenic
1053072018 9:35107402-35107424 AGGCAGCAGGTGGCTCCAGAAGG + Exonic
1053079910 9:35166967-35166989 GAGCTGCATGTGGCCCAAGACGG + Intronic
1053653373 9:40191662-40191684 GAGCAGCAGGTCTCCAAAGAAGG - Intergenic
1054531211 9:66184556-66184578 GAGCAGCAGGTCTCCAAAGAAGG + Intergenic
1056370233 9:85946595-85946617 GGGCTGCATGTGGCCCAGGATGG + Intronic
1057198734 9:93129379-93129401 GTGGAGCAGATGCCCCAGGATGG + Intronic
1057225063 9:93288879-93288901 GGGCTGGGGGTGCCCCAGGAGGG - Exonic
1057225398 9:93290268-93290290 GAGCTGCATGTGGCCCAAGACGG + Intronic
1057266352 9:93620354-93620376 GGGCAGCAGGTGAGGCACGAGGG + Intronic
1058072993 9:100620126-100620148 GGGCTGCATGTGGCCCAGGACGG - Intergenic
1059812135 9:117867199-117867221 GGGCAGCAGGTGGTAGAAGATGG + Intergenic
1060358397 9:122931625-122931647 GGACAACAGGGGCCCCGAGAGGG + Intergenic
1061045082 9:128160478-128160500 GGGAAGCAGGTGACCCGAGGGGG + Exonic
1061883992 9:133582483-133582505 GGGTGGCAGGGGCCCCAAGGTGG - Intronic
1061923905 9:133796786-133796808 GCCCAGCAGGCGCCCCGAGAGGG - Intronic
1062044003 9:134416874-134416896 GTGCAGCAGGGACCCCAACATGG - Intronic
1062049702 9:134440905-134440927 GGGCAGGAGGTGCACCCAGAGGG + Intergenic
1062364535 9:136202595-136202617 GGACAGGAGGGTCCCCAAGAAGG - Intronic
1187345736 X:18461996-18462018 GGGCTGCATGTGGCCCAGGATGG + Intronic
1187993043 X:24896361-24896383 GGGCTGCATGTGGCCCAGGACGG + Intronic
1190454866 X:50617683-50617705 GGGCACCAGATGTCCCTAGAAGG - Intronic
1190477316 X:50840880-50840902 GGGCTGCATGTGACCCAGGATGG + Intergenic
1192261047 X:69505950-69505972 GGCCAGCAGGTCCCCCATCAGGG - Exonic
1194097800 X:89665478-89665500 GGGCAGCAGGTGAGCCAATCCGG + Intergenic
1198278238 X:135117654-135117676 GGGCAGCAGGTAGGGCAAGAAGG - Intergenic
1198292724 X:135254862-135254884 GGGCAGCAGGTAGGGCAAGAAGG + Intronic
1198300743 X:135332117-135332139 GAGCAGCAGGTAGGCCAAGAAGG + Intronic
1199488063 X:148369925-148369947 GGCCAGTAAGGGCCCCAAGAAGG + Intergenic
1199760356 X:150899684-150899706 GGGCAGCCGGTGCCGCATAATGG - Intergenic
1200450820 Y:3326866-3326888 GGGCAGCAGGTGAGCCAATCCGG + Intergenic