ID: 1035318198

View in Genome Browser
Species Human (GRCh38)
Location 7:158010848-158010870
Sequence CAGCATCTGAGGTGCTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035318198_1035318212 25 Left 1035318198 7:158010848-158010870 CCCATGGAGCACCTCAGATGCTG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1035318212 7:158010896-158010918 CACTCCAGATGGTCCCAGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 119
1035318198_1035318201 -10 Left 1035318198 7:158010848-158010870 CCCATGGAGCACCTCAGATGCTG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1035318201 7:158010861-158010883 TCAGATGCTGCAAAGACCAGTGG 0: 1
1: 0
2: 0
3: 22
4: 261
1035318198_1035318204 14 Left 1035318198 7:158010848-158010870 CCCATGGAGCACCTCAGATGCTG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1035318204 7:158010885-158010907 TCTGCTCCCCCCACTCCAGATGG 0: 1
1: 0
2: 1
3: 27
4: 279
1035318198_1035318211 24 Left 1035318198 7:158010848-158010870 CCCATGGAGCACCTCAGATGCTG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1035318211 7:158010895-158010917 CCACTCCAGATGGTCCCAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 168
1035318198_1035318207 21 Left 1035318198 7:158010848-158010870 CCCATGGAGCACCTCAGATGCTG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1035318207 7:158010892-158010914 CCCCCACTCCAGATGGTCCCAGG 0: 1
1: 0
2: 1
3: 22
4: 256
1035318198_1035318215 30 Left 1035318198 7:158010848-158010870 CCCATGGAGCACCTCAGATGCTG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1035318215 7:158010901-158010923 CAGATGGTCCCAGGTGGGCAGGG 0: 1
1: 0
2: 1
3: 35
4: 395
1035318198_1035318214 29 Left 1035318198 7:158010848-158010870 CCCATGGAGCACCTCAGATGCTG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1035318214 7:158010900-158010922 CCAGATGGTCCCAGGTGGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 247
1035318198_1035318202 -9 Left 1035318198 7:158010848-158010870 CCCATGGAGCACCTCAGATGCTG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1035318202 7:158010862-158010884 CAGATGCTGCAAAGACCAGTGGG 0: 1
1: 0
2: 1
3: 21
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035318198 Original CRISPR CAGCATCTGAGGTGCTCCAT GGG (reversed) Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
907985441 1:59525104-59525126 CTGGATCTGATGTGCTGCATGGG - Intronic
918895038 1:190331638-190331660 CAGCATCTGAACTTCTCCATAGG + Intronic
922944836 1:229504577-229504599 CAGCCTCTGGGATGCTACATAGG + Intronic
923269097 1:232338650-232338672 CTGCATCTGAGATTCTCCAGAGG + Intergenic
1067665125 10:48271074-48271096 CAGGATCTGAGCTGATCCTTTGG - Intronic
1069834223 10:71298503-71298525 CAGCATTTGAGGTTCTCCAAAGG - Intronic
1070702342 10:78613156-78613178 CAGCATCTAAGAAGCCCCATAGG + Intergenic
1073267770 10:102238486-102238508 CAGCATCTGAAGTCCACGATAGG + Intronic
1077891743 11:6423034-6423056 CAGCATTTGAGGTGGCTCATAGG - Intergenic
1079250440 11:18783135-18783157 CAGCATCTGAGGTACCTCAGAGG - Intronic
1081820006 11:45983602-45983624 CTGCAGCAGAGGTGCTCCTTAGG + Intronic
1082714723 11:56598117-56598139 CAGCATCTGAGGAGTAACATTGG + Intergenic
1084045263 11:66564480-66564502 CAGCATCTCAGGTCCTCTAGAGG - Intronic
1084741188 11:71140529-71140551 CAGCCACTGAGGTCCTCCATCGG - Intronic
1086656468 11:89362969-89362991 CACCAACTGAGGTTCTTCATGGG + Intronic
1090255299 11:125279616-125279638 CCACTTCTGAGGTGCTCTATAGG - Intronic
1091998739 12:5016302-5016324 CAGCGTCTCAGGTGCTATATAGG + Intergenic
1094488240 12:30941760-30941782 CTGCAGCTGGGGTGCCCCATGGG - Intronic
1096759127 12:53825321-53825343 CAGCAACTGAGGTTATCCATTGG - Intergenic
1096893790 12:54799372-54799394 CAGCATCTTCGCTGCTCCTTGGG - Intergenic
1098389400 12:69953138-69953160 CAGCAACAGAGCTGCTCCCTAGG - Intronic
1098733024 12:74062919-74062941 CACCATCTGTGTTGCTCCAAAGG - Intergenic
1098818349 12:75197108-75197130 CAACATCTTAGGTGATTCATAGG + Intronic
1100461329 12:94802379-94802401 CACCAGCTGATGTACTCCATTGG - Intergenic
1103149454 12:118624249-118624271 CGGCATTTGAGCTTCTCCATGGG + Intergenic
1104451029 12:128868234-128868256 CAACCTCAGAGGTTCTCCATGGG - Intronic
1106139484 13:26999820-26999842 CCGCATCTGAGTTGCTGCTTGGG + Intergenic
1107250962 13:38362307-38362329 CAGCATTTGAAGTGTACCATTGG + Intronic
1111638654 13:90938334-90938356 CAGCATGGCAGGTGCCCCATAGG + Intergenic
1113250655 13:108448994-108449016 CAGCCTCTGAGGAGATCCAGGGG - Intergenic
1119685217 14:76625782-76625804 CAGCGGCTGAGTTGCTCAATCGG + Intergenic
1119725872 14:76921506-76921528 CAGCAACTGAGATGCTGGATGGG + Intergenic
1121569459 14:94936627-94936649 CAGCCTCGGAGGAGCTCCCTTGG - Intergenic
1123943533 15:25228060-25228082 CAGGATCAGAGCTGCTCCCTTGG - Intergenic
1124593816 15:31077499-31077521 CTGCATCTGAAGGGCCCCATTGG + Intronic
1124606291 15:31172350-31172372 CAGCACTTGAGGTGATCCCTGGG - Intergenic
1127020259 15:54738669-54738691 CAGCATCTGAGCCCCTCCACTGG + Intergenic
1127903823 15:63361199-63361221 CAGCATCTGGACTGCTCCGTTGG - Intronic
1129296345 15:74602329-74602351 CTGCATCTGAGGGGCTCTTTGGG - Intronic
1131175112 15:90204382-90204404 CTGCATCTGGGGTCCTTCATAGG + Intronic
1132459121 16:41583-41605 CAGCATCCAAGGTGCACCACGGG + Intergenic
1133636747 16:7673576-7673598 CATCATTTGAGGTGCTTAATGGG + Intronic
1140357567 16:74319363-74319385 CAGCATGAGAGGAGATCCATAGG - Intergenic
1141206860 16:81939421-81939443 CAGCATCTGAGTTGTTCATTGGG - Intronic
1141447297 16:84069321-84069343 CAGCTTCTGAAGGGCTGCATGGG + Intronic
1143009378 17:3857513-3857535 CTGCATTTGAGGGGCTCCAGTGG + Intergenic
1143119395 17:4597582-4597604 CAGCTTCTGAGGTGCACTCTGGG + Intronic
1146750683 17:35375835-35375857 CAGCATTTGAAGTGTGCCATTGG - Intergenic
1147141850 17:38464802-38464824 CAGCATCTGGGGGCCTCCACTGG + Intronic
1148185798 17:45642864-45642886 CAGAATCTCAGGTTCCCCATGGG - Intergenic
1148938517 17:51185988-51186010 CAGCATCTCAGGTACTTCAGAGG - Intronic
1152292764 17:79449674-79449696 CACCAGCAGAGATGCTCCATTGG - Intronic
1152334810 17:79694741-79694763 CAGGAACTAAGGTGCACCATCGG + Intergenic
1152556567 17:81056030-81056052 CAACAACTGGGGTGCACCATAGG - Intronic
1152941693 17:83176120-83176142 TAGGATCTGAGGTGTTCCAAAGG - Intergenic
1162230535 19:9262325-9262347 CAGCATCTGAGATGTTCCCAAGG - Intergenic
1163723036 19:18907281-18907303 CAGCATGAGAGGTGCTTCATAGG - Intronic
1165483993 19:36084341-36084363 CTGCATCAGAGGTGGTCCCTGGG - Intronic
925055432 2:853554-853576 CAGCATCTGAGTTCCTTCCTTGG + Intergenic
926887272 2:17609785-17609807 CAGCATATGAAGTGATCAATTGG - Intronic
928082489 2:28323334-28323356 CATCATCAGAGGTGCTGCACGGG - Intronic
930212083 2:48651518-48651540 AAGCATCTCAGGAGCTCCAATGG - Intronic
931513498 2:63025654-63025676 CAGAATCTGAGGTGAACTATTGG + Intronic
932792062 2:74662425-74662447 CAGCCTCTTAGGTGCTTCTTGGG + Intronic
935763657 2:106343674-106343696 CAGGGTCTGTGGTGCTCCACAGG + Intergenic
938092148 2:128441018-128441040 CAGCATCTGATGGGCTCCCCTGG - Intergenic
940259775 2:151767458-151767480 CAGAATCTGAGGGCCTCCACAGG + Intergenic
947245419 2:228042122-228042144 CAGTACCTGTGATGCTCCATTGG - Intronic
948599326 2:239099494-239099516 CAGAAGCTGAGGTGTTACATGGG + Intronic
1169310263 20:4532045-4532067 CAGAATCTGTGGGGCTCCAATGG - Intergenic
1172185148 20:33026980-33027002 CTGCATCTGAGCTGCTGCGTTGG - Intergenic
1172834021 20:37861243-37861265 CAGCATTTGGGGAACTCCATGGG - Intronic
1174461864 20:50688996-50689018 CAGCTTCTGAGGTGCCTAATGGG - Intronic
1175942726 20:62545426-62545448 CAGCAGCCAAGGTGCTCCGTGGG - Intergenic
1179989750 21:44941432-44941454 CAGCCTCTGATGTGCCCCCTTGG + Intronic
1179992634 21:44956530-44956552 CAGCATCTGAGTGGCTCTGTAGG + Intronic
1180647387 22:17350759-17350781 CAGCATCAGAGAGGCTGCATAGG - Intergenic
1182192191 22:28473626-28473648 CAGCAGCAGAGGTACCCCATAGG - Intronic
951541976 3:23790411-23790433 CAGCAGCTGAGTTGCACCTTAGG - Intergenic
953243570 3:41170588-41170610 TTGCATTTGATGTGCTCCATGGG + Intergenic
953693983 3:45143767-45143789 CAGCATCTGAGGTGAGCCCTAGG + Intronic
960936082 3:122903484-122903506 CAGCATTTCAGGAGCTCCCTAGG - Intergenic
968607640 4:1543026-1543048 CCCCATCTGAGGGGCTCCCTGGG - Intergenic
971894813 4:32579044-32579066 CAGCTTCAGAGGTTCTCCTTGGG - Intergenic
973645004 4:52941474-52941496 CAGAAGCTGAGATGCTCCCTTGG + Intronic
980103614 4:128566198-128566220 CACCATCAGACGTGCTCCAAAGG - Intergenic
980696419 4:136362353-136362375 CAGCATCTGTTCTGTTCCATTGG - Intergenic
983836040 4:172386656-172386678 CAGCAGTTGAGTTACTCCATTGG - Intronic
986709091 5:10474687-10474709 CATCATCTGACCTTCTCCATGGG - Intergenic
986857995 5:11893758-11893780 CAGCAGTTGAGGGGATCCATGGG - Intronic
989426070 5:41297558-41297580 AACCATCTAAGGGGCTCCATGGG - Intergenic
991508446 5:67350620-67350642 CAGAATGCAAGGTGCTCCATGGG - Intergenic
994299808 5:98134175-98134197 CAAAACCTGAGGTGCTCAATGGG + Intergenic
995752039 5:115462255-115462277 GAGCATCTCAGGTTTTCCATTGG - Intergenic
996175351 5:120349657-120349679 AAGCAGCTGAGGATCTCCATAGG + Intergenic
999031337 5:148296136-148296158 CAGCAAATGAGGTGCAGCATAGG - Intergenic
1000332532 5:160217159-160217181 CATCAACTGAGATGCTCCATGGG + Intronic
1001740760 5:174051076-174051098 CTGCAGCAGCGGTGCTCCATGGG + Intronic
1002769954 6:282244-282266 CACATTCTGAGGTGCTTCATAGG + Intergenic
1006419411 6:33923994-33924016 CAGCATCTGGTGTGCTCCTCGGG + Intergenic
1008048905 6:46880139-46880161 CAGCATCTGTGGTGCTGAACTGG + Intronic
1008050214 6:46893407-46893429 GAGCATCTAAGCTGCTCCTTAGG - Intronic
1010813126 6:80323192-80323214 CAGCATCTTGTATGCTCCATAGG + Intronic
1011754350 6:90483664-90483686 CAGCAACTGAGATGAACCATAGG - Intergenic
1013551316 6:111210533-111210555 CAGCATCTGAGCTGGTGCTTGGG - Intronic
1015531862 6:134228780-134228802 CAGCATTTGAAATTCTCCATGGG - Intronic
1018160569 6:161038142-161038164 CAGCATTTGAGTGACTCCATAGG + Intronic
1022222736 7:28330003-28330025 CAGCAGCTAAGCAGCTCCATGGG + Intronic
1032265289 7:130366207-130366229 CATCATCTGAAGTGGTCCATGGG + Intronic
1034456493 7:151173821-151173843 CAGCCTCTGAGATGCTTCCTAGG + Intronic
1035318198 7:158010848-158010870 CAGCATCTGAGGTGCTCCATGGG - Intronic
1047092995 8:121594192-121594214 CAGCATCAGAGGTAATCCAAGGG + Intergenic
1047303924 8:123638030-123638052 AAGCATCTGAGATGAGCCATTGG + Intergenic
1049394922 8:142395509-142395531 TGGCATCTGCGGTGCTCCATGGG - Intronic
1050199970 9:3134089-3134111 CAGCTTATGAATTGCTCCATGGG - Intergenic
1050297321 9:4218648-4218670 CCACATCTCAAGTGCTCCATAGG - Intronic
1051376694 9:16409245-16409267 CAGTGTCTGCTGTGCTCCATTGG + Intergenic
1052974089 9:34399150-34399172 CAGCATGTGAGTGGATCCATGGG + Exonic
1059386106 9:113965675-113965697 CTGCACCTGAGATTCTCCATAGG - Intronic
1061134557 9:128725880-128725902 CAGGATCTGATGTGCTCAGTGGG + Intergenic
1061360629 9:130139787-130139809 CAGTATCTTACGTGCTCCAAAGG - Exonic
1061843018 9:133370950-133370972 CAGCATCTGAGGGGCTTAACAGG + Intronic
1062403810 9:136383995-136384017 TAGCTTCTGAGCTGCCCCATCGG - Exonic
1062421502 9:136484587-136484609 CAGCGGCTGAGGTCCTCCCTGGG + Exonic
1203603932 Un_KI270748v1:41773-41795 CAGCATCCGAGTTGCTCTGTTGG - Intergenic
1186731234 X:12412384-12412406 CAGTATCTGAGGTTCCCCCTTGG + Intronic
1188280503 X:28262384-28262406 CAGAATCTGAAATGCTCCAAAGG - Intergenic
1188849747 X:35116997-35117019 CATCAACTGAGGGGCTTCATAGG + Intergenic
1197275712 X:124476462-124476484 CAGCCTCTGAGCTGTTCCATAGG - Intronic
1199005519 X:142692129-142692151 CTGCATCTGAGTTGCTACAAAGG - Intergenic
1199833275 X:151564093-151564115 CACCATCGTAGGTGCACCATAGG + Intronic
1200055263 X:153456841-153456863 GAGCACCTAGGGTGCTCCATGGG - Intronic
1201277398 Y:12312281-12312303 CAGCATCTAAGGTGTGCCACGGG + Intergenic
1201396523 Y:13554685-13554707 CAGCACCTCTGGTGGTCCATGGG + Intergenic
1202274431 Y:23100582-23100604 CCTCCTCTGAGCTGCTCCATGGG + Intergenic
1202291596 Y:23320104-23320126 CCTCCTCTGAGCTGCTCCATGGG - Intergenic
1202427424 Y:24734317-24734339 CCTCCTCTGAGCTGCTCCATGGG + Intergenic
1202443367 Y:24935777-24935799 CCTCCTCTGAGCTGCTCCATGGG - Intergenic