ID: 1035323581

View in Genome Browser
Species Human (GRCh38)
Location 7:158050612-158050634
Sequence CGGGGCCCGAGCTGTGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 263}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035323581_1035323592 14 Left 1035323581 7:158050612-158050634 CCAGGAGCACAGCTCGGGCCCCG 0: 1
1: 0
2: 0
3: 17
4: 263
Right 1035323592 7:158050649-158050671 GCTGAGCTCTGTGCTAGGGTGGG 0: 1
1: 0
2: 1
3: 30
4: 238
1035323581_1035323594 19 Left 1035323581 7:158050612-158050634 CCAGGAGCACAGCTCGGGCCCCG 0: 1
1: 0
2: 0
3: 17
4: 263
Right 1035323594 7:158050654-158050676 GCTCTGTGCTAGGGTGGGTAGGG 0: 1
1: 0
2: 5
3: 21
4: 200
1035323581_1035323589 9 Left 1035323581 7:158050612-158050634 CCAGGAGCACAGCTCGGGCCCCG 0: 1
1: 0
2: 0
3: 17
4: 263
Right 1035323589 7:158050644-158050666 GTCACGCTGAGCTCTGTGCTAGG 0: 1
1: 0
2: 0
3: 26
4: 155
1035323581_1035323593 18 Left 1035323581 7:158050612-158050634 CCAGGAGCACAGCTCGGGCCCCG 0: 1
1: 0
2: 0
3: 17
4: 263
Right 1035323593 7:158050653-158050675 AGCTCTGTGCTAGGGTGGGTAGG 0: 1
1: 0
2: 4
3: 22
4: 228
1035323581_1035323590 10 Left 1035323581 7:158050612-158050634 CCAGGAGCACAGCTCGGGCCCCG 0: 1
1: 0
2: 0
3: 17
4: 263
Right 1035323590 7:158050645-158050667 TCACGCTGAGCTCTGTGCTAGGG No data
1035323581_1035323595 23 Left 1035323581 7:158050612-158050634 CCAGGAGCACAGCTCGGGCCCCG 0: 1
1: 0
2: 0
3: 17
4: 263
Right 1035323595 7:158050658-158050680 TGTGCTAGGGTGGGTAGGGAAGG No data
1035323581_1035323591 13 Left 1035323581 7:158050612-158050634 CCAGGAGCACAGCTCGGGCCCCG 0: 1
1: 0
2: 0
3: 17
4: 263
Right 1035323591 7:158050648-158050670 CGCTGAGCTCTGTGCTAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035323581 Original CRISPR CGGGGCCCGAGCTGTGCTCC TGG (reversed) Intronic
901045959 1:6395899-6395921 CGGGTCCCGAGCCCTGCCCCGGG + Intergenic
901325275 1:8361606-8361628 CAGGGCACGACCTGTGGTCCCGG - Intronic
901703750 1:11059166-11059188 GGCGGCCCCAGGTGTGCTCCGGG - Intronic
903277947 1:22233488-22233510 CTGGCCCTGAGCTGAGCTCCGGG - Intergenic
903943437 1:26947134-26947156 TGAGGCCTGAGCTGTCCTCCTGG - Intergenic
904885871 1:33737974-33737996 AGGGGCCCAAGCTGGGATCCTGG - Intronic
905283686 1:36865540-36865562 TGGAGCACCAGCTGTGCTCCTGG - Intronic
906216955 1:44047542-44047564 CGGGTCCCCAGCAATGCTCCAGG - Intergenic
906480903 1:46198346-46198368 CGGGGCCCGAGCGGGGCCCGGGG - Intronic
908751672 1:67430127-67430149 CGCGGCCTGAGCTGCGCTCTTGG + Exonic
909823263 1:80093066-80093088 GAGGGCCTGAGCTGTGCTCTTGG + Intergenic
911038740 1:93575678-93575700 TGGGGCCCCAGCTCTGCCCCAGG + Intronic
913703644 1:121397316-121397338 GGGGACCCGGGCTGGGCTCCAGG + Intergenic
913979995 1:143499027-143499049 GGGGACCCGGGCTGGGCTCCAGG + Intergenic
914074345 1:144324511-144324533 GGGGACCCGGGCTGGGCTCCAGG + Intergenic
914104831 1:144641935-144641957 GGGGACCCGGGCTGGGCTCCAGG - Intergenic
917081056 1:171257504-171257526 CAGGGCCCCAGCTGTGCTGTTGG - Intronic
917441649 1:175073914-175073936 CAGGGCCCGAGCTGAGGTGCAGG - Intronic
918092752 1:181311553-181311575 CGGCTCCCAAGCAGTGCTCCAGG - Intergenic
919748710 1:201023760-201023782 CGGGGCCCGGCCTGGGCTCGGGG - Intergenic
922351946 1:224741553-224741575 TGGGGCACGTGCTGTGCGCCAGG + Intergenic
923007927 1:230067099-230067121 CGGCGCCCGAGCTCCGCCCCGGG - Intronic
1062764180 10:48693-48715 CGTGCCCCGCGCTGTGCTCGTGG - Exonic
1062774506 10:134900-134922 CGGGGCCGGAGCCGTGCACGCGG - Intronic
1063118279 10:3086400-3086422 CGGGGACCGAACTCTGTTCCTGG - Intronic
1063822478 10:9853801-9853823 CGGGGACCCAGCTGGACTCCGGG - Intergenic
1067056369 10:43054725-43054747 CAGGGCCCCACCTCTGCTCCAGG - Intergenic
1067681693 10:48445724-48445746 CATGGCCCTAGCTCTGCTCCAGG - Intergenic
1067756711 10:49011201-49011223 CTGGGCCTCAGCTGTCCTCCAGG + Intergenic
1069616581 10:69810445-69810467 CGGGTCCCAAGCAGTGCTCAAGG + Intronic
1069818439 10:71212993-71213015 CGCGCCCCGAGCTCCGCTCCGGG - Exonic
1070257581 10:74825389-74825411 CGGGGTCCGGGCTGCGCCCCCGG + Intergenic
1073320243 10:102611845-102611867 TGGGGCCAAGGCTGTGCTCCAGG - Intronic
1074182895 10:111078803-111078825 CCGGGCCCGCGCTGCGCTCGGGG - Exonic
1075801696 10:125158940-125158962 CGGTGACCGAGCTGAGCTCTTGG + Intronic
1076667375 10:132100862-132100884 AGGAACCCCAGCTGTGCTCCTGG + Intergenic
1076754747 10:132563313-132563335 CCGGGGCCGAGCTCTGCTCTGGG + Intronic
1076887992 10:133271323-133271345 CTGGGGCCGGGCTGGGCTCCAGG + Intronic
1077042298 11:530160-530182 CTGGGCCTGTGCTGTGGTCCTGG - Intergenic
1077078520 11:712314-712336 CTGGGTACGAGCTGGGCTCCCGG + Intronic
1077078530 11:712350-712372 CTGGGTGCGAGCTGGGCTCCCGG + Intronic
1077078540 11:712386-712408 CTGGGTGCGAGCTGGGCTCCCGG + Intronic
1077078549 11:712422-712444 CTGGGTGCGAGCTGGGCTCCCGG + Intronic
1077078558 11:712458-712480 CTGGGTGCGAGCTGGGCTCCCGG + Intronic
1077111129 11:862750-862772 CGGGGCCCAAGCGATGCTCCGGG + Intronic
1077335053 11:1999664-1999686 CGGAGTCGGAGCTGTGCTCTGGG + Intergenic
1078661948 11:13294988-13295010 AGTGGCCTGAGCAGTGCTCCTGG + Intronic
1079630328 11:22666874-22666896 CGCGTCCCGAGCTGGGCTGCTGG - Exonic
1080668814 11:34358021-34358043 CGGGTACCCAGCTGTGCTGCCGG - Intergenic
1083613181 11:64014092-64014114 CGGGCCCCGAGCTGGGTGCCAGG - Intronic
1083729499 11:64645105-64645127 GGGGGCCCCAGCCCTGCTCCTGG - Intronic
1083747143 11:64742887-64742909 CTGGGCCCAGGCTGCGCTCCGGG + Exonic
1084083408 11:66843541-66843563 TGGGCCCCGGGCTGTGCTGCTGG + Exonic
1085457189 11:76671766-76671788 AGGGGCCCTGGCTGTCCTCCAGG + Intergenic
1089432516 11:118436142-118436164 CGGAACCCGCGCTCTGCTCCGGG + Intergenic
1089519515 11:119054601-119054623 CGAGCGCCGAGCTGTGCTGCAGG - Exonic
1202818036 11_KI270721v1_random:54846-54868 CGGAGTCGGAGCTGTGCTCTGGG + Intergenic
1091628300 12:2139484-2139506 CAAGGCCCCAGCTGTACTCCAGG - Intronic
1093124089 12:15307422-15307444 GGAGCCCTGAGCTGTGCTCCTGG + Intronic
1095349369 12:41189905-41189927 CTGGCCCCGAACTGCGCTCCTGG + Intronic
1095753038 12:45730641-45730663 CGGGGCCGAGGCTGTGCCCCCGG - Intronic
1096494693 12:52033196-52033218 CCGAGCCCCAGCTGCGCTCCCGG - Intronic
1102571007 12:113827000-113827022 CGGGGCCTGACATGTCCTCCAGG - Intronic
1103899338 12:124295327-124295349 CGGGGCGAGAGCTGCGCGCCCGG - Intronic
1105335728 13:19466392-19466414 TGGGGCCTGAGCTGTAGTCCAGG + Intronic
1106235572 13:27857680-27857702 CGGTTCCCGAGCTTTGCTGCTGG + Intergenic
1113539987 13:111099482-111099504 AGGGCCTTGAGCTGTGCTCCTGG - Intergenic
1113886721 13:113664921-113664943 CTGGGCCCGTGCAGGGCTCCTGG + Intergenic
1115446290 14:33494163-33494185 CTGGCACCGAGCTGGGCTCCAGG - Intronic
1119519774 14:75277370-75277392 CGGGGCCCGCGGTGGGCACCTGG - Intergenic
1122604360 14:102938372-102938394 CGGGGCCCGGCCTTTCCTCCTGG + Exonic
1122883756 14:104701463-104701485 CGGACCCCGAGCTGTGCATCCGG + Exonic
1123068603 14:105630270-105630292 AGGGCCACCAGCTGTGCTCCTGG + Intergenic
1123072602 14:105649071-105649093 AGGGCCACCAGCTGTGCTCCTGG + Intergenic
1123092626 14:105748597-105748619 AGGGCCACCAGCTGTGCTCCTGG + Intergenic
1123098185 14:105776298-105776320 AGGGCCACCAGCTGTGCTCCTGG + Intergenic
1202939809 14_KI270725v1_random:136326-136348 GGGGACCCGGGCTGGGCTCCAGG - Intergenic
1123393321 15:19899567-19899589 GGGGACCCGGGCTGGGCTCCAGG + Intergenic
1124370702 15:29103383-29103405 TGGGGCCTGGGCTGGGCTCCTGG + Intronic
1126790513 15:52217326-52217348 CCAGGACCGAGCTGTGCTCCAGG + Intronic
1128306193 15:66600410-66600432 CTGAGCTCGAGCTGTGCTCTTGG + Intronic
1129328727 15:74816070-74816092 CTTGGCCCGGGCTGGGCTCCCGG - Intronic
1129752726 15:78077307-78077329 CGGCTCCCGCGCTGTGCACCTGG + Exonic
1132151283 15:99461519-99461541 CTGGGCACCAGGTGTGCTCCTGG - Intergenic
1132560231 16:590142-590164 CGGGGCCGGCGCTGGGCTTCGGG + Intronic
1132877948 16:2148621-2148643 CGGGGCGCGAGCCGGGCGCCCGG + Exonic
1133381386 16:5333568-5333590 CAGGGCCCGAGCTTCTCTCCTGG + Intergenic
1133701139 16:8310311-8310333 CTGGGCTGGGGCTGTGCTCCAGG - Intergenic
1135940660 16:26819107-26819129 CGGGGAGAGAGCTGGGCTCCAGG + Intergenic
1136699316 16:32116941-32116963 GGGGACCCGGGCTGGGCTCCAGG + Intergenic
1136768334 16:32810993-32811015 GGGGACCCGGGCTGGGCTCCAGG - Intergenic
1136799807 16:33060112-33060134 GGGGACCCGGGCTGGGCTCCAGG + Intergenic
1138190852 16:55012888-55012910 CAGGGCCAGAGCTGCGCACCAGG + Intergenic
1140506893 16:75479196-75479218 CGCGGGCCGTGCTGCGCTCCCGG - Exonic
1140514064 16:75529686-75529708 CGCGGGCCGTGCTGCGCTCCCGG - Exonic
1141054774 16:80804616-80804638 CGGGGGCCGGGCCGGGCTCCCGG - Intergenic
1141421755 16:83922194-83922216 TGAGGCCCGACCTGTGCTTCCGG + Exonic
1141722311 16:85763255-85763277 AGGGGCCTGAGCTGTTCTGCAGG + Intergenic
1141737383 16:85862593-85862615 TGCGGTCTGAGCTGTGCTCCTGG + Intergenic
1141777396 16:86133599-86133621 CGGGGCCGCTGCTGTGCTGCAGG - Intergenic
1142034498 16:87855055-87855077 TGAGGCCCAAGCTGTGGTCCTGG + Intronic
1203070726 16_KI270728v1_random:1073009-1073031 GGGGACCCGGGCTGGGCTCCAGG - Intergenic
1142854980 17:2724343-2724365 CGGGGACCGAGCTGCGTCCCTGG + Intergenic
1143863041 17:9905088-9905110 CGGAGGAGGAGCTGTGCTCCTGG - Exonic
1144501307 17:15787930-15787952 TGGGACCCGAGCTGGGCTCCTGG + Intergenic
1145163481 17:20590604-20590626 TGGGACCCGAGCTGGGCTCCTGG + Intergenic
1145291705 17:21551662-21551684 CGGGGCATGCGCTGTGCGCCCGG - Exonic
1145867579 17:28250761-28250783 CGCGGCCCAAGCTGGGCTCTGGG - Intergenic
1145995041 17:29100175-29100197 CAGGGCCCAACCTGGGCTCCAGG + Intronic
1147427235 17:40351674-40351696 CAGGGCCACAGCTGTGCTCATGG + Intronic
1147879843 17:43646357-43646379 CGTGGGCCGGGCTGTGCTCCGGG - Intronic
1147924546 17:43938505-43938527 CGCGGCCTGAGCTGGGCTCGGGG + Intronic
1148145937 17:45364902-45364924 CCAGGCCCGAGATGGGCTCCTGG + Intergenic
1148332013 17:46818859-46818881 CGGAGCCCGAGTTGTGGGCCGGG - Intronic
1148437261 17:47694233-47694255 CGGCGCCCGGGCTGGGCCCCAGG + Intronic
1149314035 17:55421979-55422001 CGGGGGCGGAGCCGGGCTCCGGG - Exonic
1149773868 17:59342208-59342230 TGGGGCCCCAGCTGTGCCCTGGG + Intronic
1150043479 17:61888140-61888162 CTGGGCTCGAGCAGTCCTCCTGG - Intronic
1151629603 17:75301566-75301588 AGGGGCCAGTGCTCTGCTCCTGG - Intergenic
1152391952 17:80008619-80008641 CGGGGCCCGAACTCTGGTCCTGG - Intronic
1152729402 17:81962113-81962135 CGGGGCCAGAGGTGAGGTCCTGG + Intergenic
1152957091 18:49018-49040 CGTGCCCCGCGCTGTGCTCGTGG - Exonic
1156088832 18:33440847-33440869 CGGCGCCCGATCAGCGCTCCAGG + Intronic
1157604999 18:48920805-48920827 TGGGGACAGAGCCGTGCTCCTGG + Exonic
1159895205 18:73989671-73989693 CAGGGCCCCATCTGTCCTCCTGG + Intergenic
1160013822 18:75125869-75125891 GGGCGCCCGAGCTCTGCTCCCGG - Intergenic
1160566234 18:79788236-79788258 CGGGGCCTGCGCTGTGCGCGGGG - Intergenic
1160909618 19:1468647-1468669 CGGGGTGCCAGCTGTGCTCCGGG + Exonic
1161320129 19:3637267-3637289 CTGGGCCTCAGCTGTGCACCTGG + Intronic
1161346425 19:3770803-3770825 CGGGGCCCAACCAGGGCTCCAGG + Exonic
1161586922 19:5110755-5110777 CCAGCCCCGAGCTGAGCTCCTGG + Exonic
1162481426 19:10929018-10929040 CTGGGCCCGCGCGCTGCTCCGGG + Exonic
1162489979 19:10986255-10986277 CGGGGCCCCAGATGTCTTCCGGG + Exonic
1163018165 19:14469523-14469545 AGGGGCCCGGGCTGGGGTCCAGG - Intronic
1164799918 19:31067890-31067912 TGGGGCCCCATCTGTGTTCCGGG - Intergenic
1166782059 19:45348089-45348111 AGTGGCCCGAGCTGCGCTCCAGG - Exonic
1167100791 19:47403315-47403337 TGGGACCCGAGCTGGGCTCCTGG - Exonic
1167504573 19:49864268-49864290 CGGGGCCAGAGGTGGACTCCAGG + Intronic
1202680148 1_KI270712v1_random:2444-2466 GGGGACCCGGGCTGGGCTCCAGG - Intergenic
925057095 2:864121-864143 CCAGGCCCGGGCTGTGCACCAGG - Intergenic
925902592 2:8518923-8518945 CCGGTCCCTAGCTGGGCTCCTGG - Intergenic
926092618 2:10060410-10060432 CAGGGCAAGAGCTGGGCTCCTGG + Intronic
926791553 2:16576580-16576602 AGGGACACGACCTGTGCTCCAGG - Intronic
926821415 2:16855268-16855290 CGGTGCCCGCGCTGTGCTCTTGG - Intergenic
927194488 2:20538346-20538368 CAGGGCTTGAGCTGAGCTCCAGG - Intergenic
927696637 2:25244078-25244100 TGGGGCCTGAGCTGTGCGCAGGG - Intronic
929441156 2:41966746-41966768 TGGGGCTCCAGCTGTGCCCCAGG - Intergenic
932321154 2:70822973-70822995 CTGGGCCAAAGCTGTTCTCCTGG - Intergenic
934287050 2:91658544-91658566 AGGGGCACGTGCTGTCCTCCTGG + Intergenic
935543819 2:104379266-104379288 CTGGGCACGAGCTGTCTTCCAGG + Intergenic
936585797 2:113756632-113756654 CGGGGCCAGAGCAGATCTCCGGG - Exonic
937223132 2:120353467-120353489 TGGGGGCAGAGCTGGGCTCCAGG - Intergenic
938683211 2:133712862-133712884 TGGGGTCCCAGCTGTGCTTCAGG - Intergenic
942818432 2:180080695-180080717 CAGGGCCCTAGCTGTACCCCCGG + Intergenic
944539618 2:200743199-200743221 TGGAGCCGGGGCTGTGCTCCAGG - Intergenic
947621487 2:231593908-231593930 TGGGCCCCGAGCTGTGCAGCAGG - Exonic
948431751 2:237923251-237923273 TGGGGACTGAGCTGTGCTCTGGG - Intergenic
948703997 2:239778247-239778269 CTGGGCCCGGGCTCCGCTCCTGG - Intronic
1172232205 20:33344372-33344394 TGGTGCCCGTGCTGTGCTCTGGG - Intergenic
1172267548 20:33629855-33629877 CGGGGACCGAGTTGGTCTCCAGG + Exonic
1174054071 20:47785880-47785902 CGGGGCCGGGGCCGTGCGCCGGG - Exonic
1174291861 20:49514453-49514475 CTTGGCCCGAGCTGTGTCCCTGG - Intronic
1176037280 20:63045777-63045799 TGGGGCCTGCTCTGTGCTCCGGG - Intergenic
1176103918 20:63376883-63376905 TGGGGGCAGAGCTGTGCCCCTGG - Intronic
1176547105 21:8206793-8206815 CTGGGCCCTTGCGGTGCTCCTGG + Intergenic
1176555010 21:8251002-8251024 CTGGGCCCTTGCGGTGCTCCTGG + Intergenic
1176566056 21:8389840-8389862 CTGGGCCCTTGCGGTGCTCCTGG + Intergenic
1176573932 21:8434026-8434048 CTGGGCCCTTGCGGTGCTCCTGG + Intergenic
1176583381 21:8550759-8550781 GGGGACCCGGGCTGGGCTCCAGG + Intergenic
1176737844 21:10568586-10568608 TGGGGCCTGAGCTGTAGTCCAGG - Intronic
1178303772 21:31473582-31473604 CGGGAGGCCAGCTGTGCTCCAGG - Intronic
1179780095 21:43694080-43694102 CGGGGGCTGCGCTGGGCTCCCGG - Exonic
1180009009 21:45037484-45037506 CGGAGCCCCGTCTGTGCTCCAGG + Intergenic
1180204184 21:46247180-46247202 CTGGGCTCGAGCAGTCCTCCTGG + Intronic
1180266191 22:10527689-10527711 GGGGACCCGGGCTGGGCTCCAGG + Intergenic
1182296795 22:29314918-29314940 CGGGCGCCTGGCTGTGCTCCGGG - Intronic
1183295968 22:37029745-37029767 CGGGGCCCCAGCTCAGCACCAGG - Exonic
1183483326 22:38076504-38076526 CGGGGACCCAGGTGGGCTCCTGG - Intergenic
1184339795 22:43880021-43880043 CGGGACCCATGCTGTGCCCCCGG - Exonic
1184959575 22:47919331-47919353 AGGGGCCCGAGCTGTATGCCCGG + Intergenic
1185055249 22:48575834-48575856 CGGGGCCGGGGCTGCGCGCCGGG - Intronic
1185065807 22:48631186-48631208 GGGGGCCCTTGGTGTGCTCCGGG + Intronic
1185095362 22:48803418-48803440 TGGGGCCCGGGCCGTGCTTCAGG + Intronic
1185212095 22:49576013-49576035 TGCGACCCTAGCTGTGCTCCCGG - Intronic
1203251980 22_KI270733v1_random:123078-123100 CTGGGCCCTTGCGGTGCTCCTGG + Intergenic
1203260034 22_KI270733v1_random:168161-168183 CTGGGCCCTTGCGGTGCTCCTGG + Intergenic
949394755 3:3602866-3602888 CTGGGCAGAAGCTGTGCTCCCGG + Intergenic
949922533 3:9014133-9014155 AGGGGCCCCCACTGTGCTCCAGG - Intronic
950106109 3:10389851-10389873 CTGGGTCCCAGCTGTCCTCCTGG - Intronic
950480735 3:13242208-13242230 CTGGGCTCGAGCTGGTCTCCAGG + Intergenic
950646902 3:14382762-14382784 CCGGGCACGAGGTCTGCTCCAGG + Intergenic
950888046 3:16377862-16377884 TGGGGCCTGAGCTGGGCTCTGGG + Exonic
952816539 3:37452263-37452285 CGGGGCGGGAGCTCTGCGCCTGG - Exonic
953283409 3:41580708-41580730 CGGGCTCCCAGCTGTGCACCCGG - Intronic
954615024 3:51965055-51965077 CCGGGCCCAGGCTGGGCTCCAGG + Intronic
954616976 3:51974072-51974094 CGGGGACTGGGCCGTGCTCCGGG + Exonic
961013350 3:123449645-123449667 CGGCGCCCGAGAGGCGCTCCGGG + Exonic
961075602 3:123979213-123979235 CTGGGCCAGTGCTGTGCTCCTGG - Intronic
961121236 3:124373019-124373041 CAGGGCCCAGGCTCTGCTCCAGG - Intronic
961308084 3:125973295-125973317 CTGGGCCAGTGTTGTGCTCCTGG + Intronic
961457627 3:127032008-127032030 CTGGGCCGGAGCTGAGCTGCAGG + Intronic
961550147 3:127665941-127665963 CTGGGCCCCAGGTGTGCTCATGG + Intronic
962401013 3:135058698-135058720 CTGGGCCCCAGCTGTACTGCAGG - Intronic
964014361 3:151928243-151928265 CGGGGCCCGCCCGCTGCTCCGGG - Intergenic
964771146 3:160225537-160225559 CGGGACCCGAGCGGAGCGCCGGG + Intergenic
967281570 3:187828588-187828610 AGGGGCCCGTCCAGTGCTCCTGG - Intergenic
968068231 3:195770829-195770851 GAGGGCCCGTCCTGTGCTCCTGG - Intronic
968818990 4:2836144-2836166 CAGGGCCCCAGCTGGGCTTCGGG - Exonic
973758841 4:54099648-54099670 CGTGGCCAGAGCTGCGCTCAGGG + Intronic
975870776 4:78776378-78776400 CGGGGCCCAGGCTGTGCGCTTGG + Exonic
977370324 4:96126458-96126480 CGAGGCCAGAGCTCTGCTCGTGG - Intergenic
985441358 4:189984333-189984355 CGTGTCCCGCGCTGTGCTCGTGG - Intergenic
985551488 5:535555-535577 TGGGGCCTGAAATGTGCTCCGGG + Intergenic
985553087 5:543102-543124 CGGGGCCAGGGCTGGGCTGCAGG + Intergenic
985655514 5:1129577-1129599 CGATGCCCCAGCTGGGCTCCTGG - Intergenic
985824675 5:2183442-2183464 CAGGGCCCAACCTGAGCTCCGGG + Intergenic
985980282 5:3456900-3456922 AGGGCCCCGACCAGTGCTCCAGG - Intergenic
990378695 5:55200050-55200072 CTGGGCCCAAGCTATCCTCCCGG - Intergenic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
992397396 5:76380530-76380552 CGAGGCAGGCGCTGTGCTCCTGG - Intergenic
993502711 5:88680551-88680573 GGGGGCCCGCGCGGGGCTCCTGG + Intergenic
996911875 5:128665873-128665895 CTTGGACCGAGCTGTGCTACTGG - Intronic
997613530 5:135231320-135231342 TGGTGCCAGAGATGTGCTCCAGG + Intronic
997623784 5:135318208-135318230 CAGGGCCCGAGCAGAGCACCCGG - Intronic
999327003 5:150649873-150649895 CGGGGTCCGGGCTGGGCTTCGGG - Exonic
1002140550 5:177134687-177134709 CGGGGTCCGAGGGGGGCTCCTGG - Intronic
1002922935 6:1585897-1585919 CAGTGCCCGACCTGTCCTCCGGG - Intergenic
1003657410 6:8025427-8025449 CAGGGCCACAGCTGAGCTCCTGG - Intronic
1003737362 6:8891870-8891892 CGTGGCCAGAACTGTGCTACAGG - Intergenic
1005314239 6:24588728-24588750 CGGTGACTGAGCTGAGCTCCAGG + Exonic
1014552017 6:122800060-122800082 TGGGGCTCAAGCTGTCCTCCTGG + Intronic
1016982156 6:149863744-149863766 CCGGGCCCGGGCAGTCCTCCTGG + Exonic
1018434600 6:163749135-163749157 TTGGGCACGGGCTGTGCTCCAGG - Intergenic
1018769050 6:166956366-166956388 CGGGCCCCGCGCCGGGCTCCGGG + Exonic
1018855875 6:167674577-167674599 CGTGGCCCGTGCTGAGCTTCCGG + Intergenic
1019206437 6:170365740-170365762 CAGGGGCCGAGCCCTGCTCCAGG - Intronic
1019722940 7:2584053-2584075 GTGGCCCAGAGCTGTGCTCCTGG + Intronic
1020134082 7:5576464-5576486 TGGGGCCGGAGCTGTCCCCCTGG - Intergenic
1022018579 7:26376708-26376730 CGGGGCCGGGGCTGGACTCCAGG + Intergenic
1022509510 7:30926171-30926193 TGGGGCCCCAGCACTGCTCCTGG + Intergenic
1023842092 7:44103769-44103791 CGGGCCCCGTGCTGGGCCCCAGG - Intergenic
1024639301 7:51316646-51316668 CGGGACGCGGGCGGTGCTCCGGG + Exonic
1025562059 7:62381016-62381038 GGGGACCCGGGCTGGGCTCCAGG + Intergenic
1025825320 7:65006348-65006370 CGGGGTCCGAGCTGTCAGCCCGG + Intronic
1028470672 7:91203369-91203391 CCGGGCCTGGGCTGTGCTCTGGG + Intronic
1033595312 7:142854880-142854902 CGGGGCCCCGCCTGTGCGCCGGG - Intergenic
1034459681 7:151191560-151191582 AGGGGTCCGAGTTGTGCTTCAGG + Intronic
1034560404 7:151876340-151876362 CAGGGCCCGAGCTGGGCTGGCGG - Intronic
1034621911 7:152463494-152463516 CGCAGCCTGAGCTGGGCTCCCGG - Intergenic
1034979221 7:155465688-155465710 CTGGGCCCGAGCTGCGCCCCAGG + Intergenic
1035263988 7:157679646-157679668 GGGGGCCCACGTTGTGCTCCTGG - Intronic
1035323581 7:158050612-158050634 CGGGGCCCGAGCTGTGCTCCTGG - Intronic
1036288303 8:7463601-7463623 CGTGGGAAGAGCTGTGCTCCAGG + Exonic
1036333172 8:7847927-7847949 CGTGGGAAGAGCTGTGCTCCAGG - Intronic
1038068959 8:23992496-23992518 CTTGGCCTGAGCCGTGCTCCTGG - Intergenic
1042784981 8:72537005-72537027 CGGCGCCGGAGCTGTGCGCTCGG - Intergenic
1047202942 8:122781815-122781837 CGGAGCCCGAGCCGGGCGCCCGG + Exonic
1047512874 8:125529046-125529068 CCGGGCTCGAGCGGGGCTCCTGG + Intergenic
1048996132 8:139794669-139794691 TGGGTCCCCAGCAGTGCTCCTGG - Intronic
1049536771 8:143186157-143186179 CGGGCGCAGAGCTGCGCTCCAGG - Intergenic
1049700210 8:144007556-144007578 CGGGGCCTGTGCTGAGCTCTGGG + Intronic
1049742785 8:144249041-144249063 CGGGGCGCGGGGGGTGCTCCAGG + Intronic
1052999432 9:34569526-34569548 CAGGCCCCCTGCTGTGCTCCTGG + Intronic
1054907109 9:70421037-70421059 CTGGCCCCGAGCTGTGCCCCAGG + Intergenic
1057185988 9:93058022-93058044 CAGGCCCAGAGCTGTGATCCGGG - Intergenic
1057216552 9:93231855-93231877 CCTGGCCCCAGGTGTGCTCCTGG + Intronic
1057313437 9:93955209-93955231 CGGGGCCCGCGCGGGGCTCTAGG + Exonic
1057857026 9:98609718-98609740 CTGGGGCAGAGCTGGGCTCCAGG + Intronic
1061398097 9:130354392-130354414 CCGGGACAGAGCTCTGCTCCTGG - Intronic
1061587547 9:131578634-131578656 TGAGGCCAGAGCTGAGCTCCTGG - Exonic
1062327515 9:136019307-136019329 CGGGGCCAGAGCTGGGTTCCAGG + Intronic
1062550940 9:137086305-137086327 CGGGGCCCGAGCGCTGCGCCTGG - Intergenic
1062558899 9:137130304-137130326 CGGGGCCCGAGCGCTGCGCCTGG + Intergenic
1062741076 9:138175611-138175633 CGTGCCCCGCGCTGTGCTCGTGG + Intergenic
1203468383 Un_GL000220v1:106228-106250 CTGGGCCCTTGCGGTGCTCCTGG + Intergenic
1203476204 Un_GL000220v1:150200-150222 CTGGGCCCTTGCGGTGCTCCTGG + Intergenic
1185747472 X:2584230-2584252 CGGGGCCGGCGCGGGGCTCCGGG - Intergenic
1186504874 X:10083225-10083247 CGGAGCGCAAGTTGTGCTCCTGG + Intronic
1197734243 X:129838944-129838966 CTGGCCCAGAGCTGTGCTGCAGG + Intronic
1200066543 X:153506762-153506784 AGGGGCCCTAGCTCTGCCCCAGG - Intronic
1202596096 Y:26541899-26541921 TGGGGCCTGAGCTGTAGTCCAGG - Intergenic