ID: 1035325721

View in Genome Browser
Species Human (GRCh38)
Location 7:158064690-158064712
Sequence AGTGATTTCCAGAAGCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 370}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035325710_1035325721 16 Left 1035325710 7:158064651-158064673 CCTCTGTCATCTCCCACTCACCA 0: 1
1: 0
2: 3
3: 39
4: 488
Right 1035325721 7:158064690-158064712 AGTGATTTCCAGAAGCTGACTGG 0: 1
1: 0
2: 3
3: 37
4: 370
1035325714_1035325721 -10 Left 1035325714 7:158064677-158064699 CCCCCCCTGTGCCAGTGATTTCC 0: 1
1: 0
2: 4
3: 24
4: 536
Right 1035325721 7:158064690-158064712 AGTGATTTCCAGAAGCTGACTGG 0: 1
1: 0
2: 3
3: 37
4: 370
1035325712_1035325721 3 Left 1035325712 7:158064664-158064686 CCACTCACCAAAGCCCCCCCTGT 0: 1
1: 0
2: 1
3: 24
4: 570
Right 1035325721 7:158064690-158064712 AGTGATTTCCAGAAGCTGACTGG 0: 1
1: 0
2: 3
3: 37
4: 370
1035325709_1035325721 24 Left 1035325709 7:158064643-158064665 CCTCAGGGCCTCTGTCATCTCCC 0: 1
1: 2
2: 7
3: 52
4: 433
Right 1035325721 7:158064690-158064712 AGTGATTTCCAGAAGCTGACTGG 0: 1
1: 0
2: 3
3: 37
4: 370
1035325713_1035325721 -4 Left 1035325713 7:158064671-158064693 CCAAAGCCCCCCCTGTGCCAGTG 0: 1
1: 0
2: 0
3: 17
4: 183
Right 1035325721 7:158064690-158064712 AGTGATTTCCAGAAGCTGACTGG 0: 1
1: 0
2: 3
3: 37
4: 370
1035325711_1035325721 4 Left 1035325711 7:158064663-158064685 CCCACTCACCAAAGCCCCCCCTG 0: 1
1: 0
2: 0
3: 26
4: 206
Right 1035325721 7:158064690-158064712 AGTGATTTCCAGAAGCTGACTGG 0: 1
1: 0
2: 3
3: 37
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035325721 Original CRISPR AGTGATTTCCAGAAGCTGAC TGG Intronic
900095227 1:937491-937513 AGTGATTGCCAGGAGGTGAGAGG + Intronic
902573514 1:17362018-17362040 AGAGTTTACCAGAAGGTGACAGG + Intronic
905000638 1:34665895-34665917 ACTAATTTCCAGAGGCTGTCTGG + Intergenic
906028605 1:42697979-42698001 GGTGATCCCCAAAAGCTGACAGG + Intronic
906499123 1:46328141-46328163 AGTCATACCCGGAAGCTGACTGG - Intergenic
907242562 1:53088846-53088868 AGTGAGATCCAGAGGCTGCCAGG - Intronic
907444706 1:54500082-54500104 AGAGATTTCCCGGAGCTCACAGG - Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
908180587 1:61601050-61601072 GGTGATTGCCAGGAGCTGAGAGG + Intergenic
908623193 1:66008673-66008695 AGAAGTTTCCAGAAGATGACTGG - Intronic
910066181 1:83153895-83153917 AGTACTTTCCTGAAGCAGACAGG - Intergenic
910852763 1:91665017-91665039 AGTCACACCCAGAAGCTGACTGG - Intergenic
912816225 1:112830835-112830857 AGTCACACCCAGAAGCTGACTGG + Intergenic
914442452 1:147719321-147719343 AGCTATGTCCAGAAGCTGAGCGG - Intergenic
915374761 1:155383748-155383770 AGTGATTACCAGAGGCTGAGGGG + Intronic
915747853 1:158178637-158178659 AGTGGTTTCCAGGAGCTGGAGGG - Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916532625 1:165672484-165672506 AGTGGTTACCAGAGGCTGAGGGG + Intronic
916884752 1:169056183-169056205 AGTAATTTCCACAAGATCACAGG - Intergenic
916919641 1:169450383-169450405 GGTGGTTTCCAGGAGCTGAAGGG - Intronic
917254743 1:173102547-173102569 AGTGATTTCCAGGGGCTGCAGGG - Intergenic
917759282 1:178138030-178138052 AGTGCTTTCCAGAAGCTGTCAGG + Intronic
917917711 1:179720893-179720915 AGTGATTTTCAGCAGCTGGTGGG + Intergenic
918321740 1:183371295-183371317 AGTGGTTGCCAGAAGTTGAGGGG + Intronic
918646990 1:186916944-186916966 AGTCACACCCAGAAGCTGACTGG - Intronic
919343487 1:196344690-196344712 ATCTAATTCCAGAAGCTGACAGG + Intronic
919373131 1:196756722-196756744 GGTGGTTACCAGAAGCTGAAGGG + Intergenic
919379575 1:196841405-196841427 GGTGGTTACCAGAAGCTGAAGGG + Intronic
919967853 1:202546728-202546750 AGTGATTTCCAGAAACTAGTTGG + Intronic
920399021 1:205665640-205665662 AGTGACTCCCCCAAGCTGACAGG + Intronic
922522093 1:226263112-226263134 AGTGATTTCCAGGGGCTCAGGGG + Intronic
922768790 1:228170878-228170900 AGTGTTTTCCTGAACATGACTGG + Intronic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
1063531978 10:6841986-6842008 ACTGATTTCCAGCAGCTGAAGGG - Intergenic
1064488103 10:15818812-15818834 AGTGGTTTCCAGGGGCTGAGTGG + Intronic
1067086985 10:43247717-43247739 AGTGGTTACCAGAAGCTGGTGGG + Intronic
1068641001 10:59407732-59407754 AGTGGTTACCAGAGGCTGACGGG - Intergenic
1068787381 10:60991063-60991085 AGTGACTTCCAAAAGGTGAATGG - Intronic
1069210617 10:65754864-65754886 AGTGATTTCCAGGAGCTAGTGGG - Intergenic
1070163243 10:73878758-73878780 AGTGATTTGGAGAAGCCCACTGG - Intergenic
1070508248 10:77136378-77136400 AGCGATTACCAGGAGCTGAGGGG + Intronic
1071073115 10:81717879-81717901 AGTGATTGCCAGAGGCTTATGGG + Intergenic
1072335009 10:94390032-94390054 AGTCACACCCAGAAGCTGACTGG + Intergenic
1072669050 10:97415898-97415920 AGTGATTGCCAGGGGCTGGCAGG - Intronic
1072688991 10:97558045-97558067 AGTCACACCCAGAAGCTGACTGG - Intronic
1074526164 10:114265081-114265103 AGTCATTGCCAGGGGCTGACGGG + Intronic
1074658645 10:115624534-115624556 AGTGGTATGCAGAAGCTGCCTGG + Intronic
1074786431 10:116846129-116846151 AGTGAATGACAGAAGCTGACTGG + Intergenic
1076155217 10:128199384-128199406 AGTGATTTCCAGGAGAATACAGG - Intergenic
1077217237 11:1400083-1400105 ACTGATTTCTAGAAACTGGCAGG + Intronic
1078570907 11:12457383-12457405 ATGGATTTCCAGTTGCTGACAGG + Intronic
1078646835 11:13148443-13148465 AGAGAATTCCAGAAGGTGCCTGG - Intergenic
1079432435 11:20405974-20405996 AGTGATTTCCAGGGGCTGGGAGG - Intronic
1080185056 11:29472845-29472867 AGTGATTGCCAGTAGCTGGAGGG + Intergenic
1081811206 11:45915084-45915106 AGTGAGGCCCAGAAGCTGACGGG + Intronic
1083090077 11:60190609-60190631 AGTCACATCCAGAAGCTGACTGG + Intergenic
1083345229 11:61984874-61984896 GGTGGTTTCCAGGAGCTGAGGGG - Intergenic
1084677243 11:70642647-70642669 GGTGTTTCCCAGAAGATGACGGG - Intronic
1084917706 11:72441839-72441861 AGTTTTTTCCAGGAGCTGAGAGG - Intergenic
1085305681 11:75484427-75484449 AGTTGTTTCCAGAATCTGAGGGG - Intronic
1085743471 11:79095811-79095833 TGTGATTTGCAGAAGCTTATAGG + Intronic
1086785425 11:90964136-90964158 AGTGCTTACAAGAGGCTGACGGG + Intergenic
1087550609 11:99642763-99642785 AGTGGTTACCAGAGGCTGAGAGG - Intronic
1087644707 11:100794631-100794653 ACTGACTTCTAGAAGCTGAAGGG - Intronic
1087983716 11:104650727-104650749 ACTGATTTCATGAAGCTGAGTGG + Intergenic
1088677492 11:112209262-112209284 AGTGGTTTCCAGGGGCTGAGAGG - Intronic
1089375515 11:117991563-117991585 AGTGGTTACCAGAAGCTGGAAGG - Intronic
1089418967 11:118316664-118316686 ACAGATTTCCACAAGCTGCCAGG + Intergenic
1090885792 11:130875329-130875351 AGTGATTGCCAGAGGCTGGTGGG + Intergenic
1091107018 11:132932130-132932152 AGTAGTTTCCAGAAGCTGGGGGG + Intronic
1091491569 12:937094-937116 AGTGAGATACAGAAGCTGAGGGG + Intronic
1092561399 12:9617970-9617992 GGTGATTTCCAGGAGCTGAGAGG - Intergenic
1095823317 12:46505197-46505219 GGTGGTTTCCAGAGGCTGAGGGG - Intergenic
1097615303 12:61878126-61878148 AGAGATTACCAGGAGCTGAAGGG + Intronic
1098008678 12:66026827-66026849 GGTGATTACCAGAGGCTGAGGGG + Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098769376 12:74534836-74534858 TGAGATTTACAGAAGTTGACAGG + Intergenic
1099391342 12:82083213-82083235 AGTGGTTACCAGAGGCTGCCGGG - Intergenic
1099694453 12:85999849-85999871 AGTGATTACCAGAGGCTGGGAGG + Intronic
1100625789 12:96330535-96330557 AGTGGTTCCCAGAGGCTGATAGG - Intronic
1100750931 12:97697446-97697468 ACTGATTTCCAGTTGCTAACAGG - Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1102354138 12:112218419-112218441 AGTGATTGCCAGGAGCTGTGGGG - Intronic
1103550163 12:121731048-121731070 AGTGATTGCCAGGGGCTGAGGGG + Intronic
1104130213 12:125886268-125886290 AGTGATTTCTAGGAGTTGAGGGG - Intergenic
1105253071 13:18718392-18718414 CATGATTTACAGAAGCTGAGTGG + Intergenic
1106357689 13:28999784-28999806 AGTGGTTACCAGAGGCTGGCGGG - Intronic
1106464663 13:30002287-30002309 TGTGATTCCCAGAGGCTGGCTGG + Intergenic
1106649450 13:31674136-31674158 AGTGGTTGCCAGAAGCTGGGGGG + Intergenic
1107292545 13:38872265-38872287 AGTGGTTTCCAGGGACTGACGGG + Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108131220 13:47302422-47302444 AGTTCTTCCAAGAAGCTGACAGG - Intergenic
1108401893 13:50053504-50053526 GGTGATTTCCTGAGGCTGAGGGG - Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1110693579 13:78460538-78460560 AGTGTTTGCCAGGAGCTGAGTGG - Intergenic
1111865402 13:93762041-93762063 AGTGATTACCAGAGGCTGACGGG - Intronic
1111875473 13:93888661-93888683 AGTTTTTTCCTGAAGTTGACAGG + Intronic
1113598921 13:111554604-111554626 AGTGATGTGCAGAAGCTTAGGGG - Intergenic
1114906900 14:27139916-27139938 ATTGATTTTCAGATGTTGACAGG + Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115143396 14:30199360-30199382 AGTTATCTCCAGAAGATAACAGG - Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116803968 14:49473205-49473227 GGTGATTGCCAGAGGCTGAGGGG + Intergenic
1117005568 14:51418150-51418172 AATGATTTTGACAAGCTGACAGG - Intergenic
1117351758 14:54888282-54888304 GTTGACTTCCAGCAGCTGACAGG - Intronic
1117421902 14:55555087-55555109 AGGTATTGCCTGAAGCTGACCGG - Intergenic
1117601016 14:57374703-57374725 AGTGATTACCAGGGGCTGAGGGG - Intergenic
1118310816 14:64691590-64691612 GGTGGTTTCCAGAGGCTGAGGGG - Intergenic
1118460367 14:65981632-65981654 GGTGCCTTCCAGAAGCTGCCTGG + Intronic
1119101282 14:71882109-71882131 AGTGGTTACCAGAAGCTGAGAGG - Intergenic
1119243197 14:73079999-73080021 AGAGACTTCCAGAAGCAGACAGG - Intronic
1121040080 14:90739200-90739222 AGAGATGTCCAGAAACTGACTGG - Intronic
1122077869 14:99247127-99247149 AGTCATTTCCAGAAACAGACGGG - Intronic
1122244046 14:100388834-100388856 TGTGCTCGCCAGAAGCTGACAGG + Intronic
1122279822 14:100615153-100615175 AGTGATTTCCAGGGGCTGGAGGG + Intergenic
1122567572 14:102671859-102671881 AGTGATTGCCAGAGGCTGTAGGG - Intronic
1122814251 14:104304488-104304510 AGTGTTTTCCAGCATCTTACGGG - Intergenic
1123988127 15:25663005-25663027 GGTGGTTTCCAGGGGCTGACAGG - Intergenic
1124198097 15:27650943-27650965 GGTGATTGCCAGAAGCTGGCAGG + Intergenic
1125402306 15:39317407-39317429 AGTGTTTTCCACAAACTGACTGG + Intergenic
1127261277 15:57328280-57328302 GGTAAATTCCAGAAACTGACTGG + Intergenic
1128096187 15:64958134-64958156 AGTGATTTCCAGGAGCTGCAAGG + Exonic
1128356372 15:66930355-66930377 AGTGATTTCATGAAGGTCACAGG - Intergenic
1129047873 15:72752814-72752836 AGTGAGGTCCAGAGGCTGACTGG + Exonic
1129287394 15:74536916-74536938 AGTGATTGCCAGGAGCTAAGGGG - Intergenic
1129930457 15:79406318-79406340 AATTATTTCTAGCAGCTGACAGG - Intronic
1130035299 15:80355051-80355073 AGTGGTTTCCAGGAGCCGAGGGG + Intronic
1131828202 15:96336605-96336627 AGTGTTTTCCTGAAGATAACAGG + Intronic
1133554004 16:6887385-6887407 TGTGATTTCAAGAAGCCGAAAGG + Intronic
1133607574 16:7403392-7403414 AGTGGTTGCCAGAGGCTGAAGGG - Intronic
1133699146 16:8293038-8293060 GGTGATTACCAGAAGCTGGGGGG + Intergenic
1134807220 16:17136387-17136409 AGAGGTTTCCTGAAGCAGACTGG - Intronic
1135652248 16:24216498-24216520 AGTGATTTCCAGAAGTTCCAGGG + Exonic
1135885411 16:26301633-26301655 AGTGTCTTCCACAAGCTGACTGG + Intergenic
1135980040 16:27140301-27140323 AGTGACTTCCAGGATCTGAAGGG + Intergenic
1138536772 16:57664287-57664309 AGTGGTTTCCAGGAGCTGCCTGG + Exonic
1140709208 16:77660880-77660902 AGTGATTGCCAGGGGCTGAGGGG + Intergenic
1141242387 16:82275645-82275667 AGTCAATCCCAGAAGCAGACAGG - Intergenic
1141242454 16:82276053-82276075 AGTCAATCCCAGAAGCAGACAGG - Intergenic
1141242487 16:82276257-82276279 AGTCAATCCCAGAAGCAGACAGG - Intergenic
1141242537 16:82276563-82276585 AGTCAATCCCAGAAGCAGACAGG - Intergenic
1141551599 16:84810066-84810088 AGTGATGTCAAGATGCTGGCAGG - Intergenic
1142303981 16:89275340-89275362 AGTGGTTTCTAGAAGCTTCCTGG - Intronic
1143894081 17:10123190-10123212 AATGCTTTCCAGAGTCTGACAGG - Intronic
1144319611 17:14101454-14101476 TGGGGTTTACAGAAGCTGACAGG - Intronic
1144681333 17:17197471-17197493 AGTGATTGCCAGGAGCTGGAGGG + Intronic
1145358802 17:22192769-22192791 AGTGGTTTCCAGAGGCTGGAAGG + Intergenic
1145849552 17:28079041-28079063 TGTGGTTTCCAGGAGCTGATAGG - Intronic
1145864641 17:28233095-28233117 AGTCACACCCAGAAGCTGACTGG - Intergenic
1147810112 17:43162764-43162786 AGTCACACCCAGAAGCTGACTGG - Intergenic
1148737452 17:49872892-49872914 TGTGATTTCCAGAATTTGGCAGG - Intergenic
1149211774 17:54311737-54311759 AGTGTTTTCCAGAGGGGGACGGG + Intergenic
1152383926 17:79957526-79957548 AGTGGTTGCCAGGAGCTGGCGGG + Intronic
1153846741 18:9056986-9057008 AATTATTTTCAGAAGCTGATAGG + Intergenic
1156087722 18:33427778-33427800 AGTAATTACCAGAAGGTGAAAGG - Intronic
1157202195 18:45668784-45668806 AAAGATTTCCAGAAACTGACAGG - Intronic
1157429663 18:47614257-47614279 AGCAATGTGCAGAAGCTGACTGG - Intergenic
1158270818 18:55714213-55714235 AGAGATTTCCACACTCTGACTGG + Intergenic
1158855008 18:61534720-61534742 AGTGATTGCCAGAGGCTGGTGGG + Intronic
1159393733 18:67830007-67830029 AGTGGTTGCCAGAAGCTGAAGGG - Intergenic
1162505610 19:11082684-11082706 AGTGATTACCAGGGGCTGAGAGG - Intergenic
1163089235 19:15007363-15007385 AGTGGTTACCAGGAGCTGAGGGG + Intronic
1163934349 19:20428674-20428696 AGTCACACCCAGAAGCTGACTGG - Intergenic
1163943015 19:20512436-20512458 AGTCACACCCAGAAGCTGACTGG - Intergenic
1164396719 19:27871579-27871601 AGTGATTTCCAGGGGTTGAGAGG + Intergenic
1165437626 19:35805050-35805072 AGTGGTTTCCAGGGGCTGAGGGG + Intronic
1165545971 19:36536155-36536177 AGAAATTTCAAGAAGGTGACTGG + Intronic
1165605365 19:37098846-37098868 AGTGGTTACCAGATGCTGAGGGG - Intronic
1167155267 19:47734759-47734781 AGTGATTTCTAGAGCCGGACGGG + Intronic
1168430707 19:56277516-56277538 AGTGATTTCCAGGGGGTGAGGGG + Intronic
927407708 2:22790909-22790931 AGTGATTTTCAGATGCTTGCTGG + Intergenic
927667981 2:25045303-25045325 AGCCATTTCCAGAAACTGATGGG - Intronic
929301618 2:40309988-40310010 AGTGATTGCCAGGGGCTGAGGGG - Intronic
930458290 2:51634879-51634901 AGTTATTTTCAGAAGCAGTCAGG + Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
936878331 2:117219410-117219432 AGTGGTTTCCAGGAGCTGAGTGG - Intergenic
937091509 2:119209442-119209464 AGTGCTTTCCAGATGCTGAGTGG + Intergenic
937703026 2:124885631-124885653 AGTGGTTTCCAGGAGCTAAGAGG - Intronic
937823409 2:126337389-126337411 AGTATTTTCCAGAAGCAGATAGG - Intergenic
938231265 2:129661758-129661780 AGTGATTACCAGCAGTTTACGGG + Intergenic
938588744 2:132716921-132716943 TGTGATTTTTAGAAGCTGGCTGG + Intronic
939822571 2:146975973-146975995 TGTGATTTCTAGAAGCTAATTGG - Intergenic
940236753 2:151519452-151519474 AGAGGTTCCCAGGAGCTGACGGG + Intronic
940479448 2:154210011-154210033 AGTGGTTTCCAGAGGCTGAGAGG - Intronic
940531050 2:154876442-154876464 AATGATTACTAGCAGCTGACTGG + Intergenic
940803962 2:158164448-158164470 AGTGGTTACCAGAGGCTGAGGGG + Intergenic
940858244 2:158746521-158746543 AGAGGTTACCAGAAGCTGAGGGG - Intergenic
942009112 2:171740968-171740990 AGTGGTTTCCAGGAGCTGTGGGG - Intronic
942492982 2:176508512-176508534 AGTGGTTTCCAGAATTTGACTGG - Intergenic
943319663 2:186432102-186432124 GGGGATTTCCAGATGCAGACAGG + Intergenic
943408299 2:187515559-187515581 AGTCACACCCAGAAGCTGACTGG + Intronic
943830744 2:192458632-192458654 GGTGATTTCCAGGAGCTGGGTGG - Intergenic
944398105 2:199292726-199292748 ACTGCTTTCCAGATGCTGAGTGG - Intronic
944466467 2:200005420-200005442 AGTGATTTCCTGAAGAGGAGGGG - Intronic
945561416 2:211345184-211345206 AGTGATATTGAGAAACTGACAGG + Intergenic
945981184 2:216312347-216312369 AGTGACTATCAGCAGCTGACTGG - Intronic
946230896 2:218290740-218290762 AATGATATCCAGAAGTCGACAGG - Intronic
947586571 2:231360465-231360487 AGGGCTTTCCAGAGGCTGAGGGG + Intronic
947993828 2:234510411-234510433 GGTGATTTCCAGGGGCTGAGAGG - Intergenic
1170288255 20:14736306-14736328 AGTGATTGCCAGAGGGAGACAGG + Intronic
1171408721 20:24931573-24931595 AGTCACACCCAGAAGCTGACTGG + Intergenic
1172313251 20:33934008-33934030 AGGGATGTCCAGACGCAGACGGG - Intergenic
1172502696 20:35438159-35438181 AGTTATTTTCAGCTGCTGACTGG - Exonic
1172719245 20:36986727-36986749 CTTGATGTCCAGAAGGTGACAGG - Intergenic
1175513697 20:59554137-59554159 AGTCACACCCAGAAGCTGACTGG - Intergenic
1176838576 21:13818277-13818299 CATGATTTACAGAAGCTGAGTGG + Intergenic
1177205700 21:18008513-18008535 GGTGGTTGCCAGAAGCTGAGGGG - Intronic
1179154773 21:38840279-38840301 GGGGATTTCCAGAAGGAGACTGG + Intergenic
1179298740 21:40088004-40088026 AGTGAGTCACAAAAGCTGACAGG + Intronic
1180010426 21:45046408-45046430 AGTGGTTTCCAGGGGCTGAGGGG + Intergenic
1181528576 22:23503205-23503227 AGTGACTGCCAGAATGTGACTGG - Intergenic
1183573110 22:38669102-38669124 ATTGTTTTCCACATGCTGACAGG + Intronic
1183720794 22:39560255-39560277 AGTGGTGCCCAGAAACTGACTGG - Intergenic
1183865055 22:40697701-40697723 AGTAGTTGCCAGAAGCTGAGGGG + Intergenic
1184540417 22:45119870-45119892 AGTGATTTCCAGGGGCTGTGGGG + Intergenic
1184983344 22:48112179-48112201 AGTGCTTTCCAGGAGCTGAGAGG + Intergenic
1185099782 22:48832722-48832744 TGTGATTTCCCGTAGGTGACAGG + Intronic
949325525 3:2859070-2859092 TGTGATTACCAGAAGCTAGCTGG - Intronic
949401632 3:3670607-3670629 AGTCATTTCCAGAAGATGCCAGG + Intergenic
949855400 3:8456785-8456807 AGTGATAACTAGAAGGTGACTGG - Intergenic
950552796 3:13676851-13676873 AATGATTTCCAGTAGATGACTGG - Intergenic
951165833 3:19484486-19484508 AGTCACATCCAGAAGCTGACTGG - Intronic
954468449 3:50672561-50672583 AGTAGTTTCCAGGAGGTGACAGG + Intergenic
955063628 3:55515873-55515895 AGTGATTTGCAGAAACAGGCTGG + Intronic
956101831 3:65776585-65776607 AGAGATTTCCTGCAGCTGCCTGG - Intronic
956481812 3:69680777-69680799 AGTGTTTGCCAGAGGCTGAGGGG + Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
956764555 3:72473419-72473441 GGTGGTTTCCAGAAGCTGGGGGG - Intergenic
959204519 3:103288157-103288179 GGTGATTTCCAGGATCTGAGGGG - Intergenic
959639179 3:108612429-108612451 AGTGATTTCCAAAAGATAAGAGG - Intronic
959849902 3:111072731-111072753 AGAGAGCTCCAGAAGCTGTCAGG - Intronic
961206869 3:125090650-125090672 GGTGATTTCATGAAGCTGAAGGG - Intronic
961706971 3:128794557-128794579 AGTGACTTCCAGAAAATGAATGG - Intronic
961787620 3:129357170-129357192 AGTGATGTGCAGAGGCTGGCAGG + Intergenic
961975887 3:131024878-131024900 AGTGCTTTTCAGAAGCAGATCGG - Exonic
964932814 3:162047097-162047119 AGTTACACCCAGAAGCTGACTGG - Intergenic
967040001 3:185683257-185683279 GGTGATTACCAGAGGCTGACGGG + Intronic
968227977 3:196987797-196987819 GGTGGTTGCCAGGAGCTGACGGG + Intergenic
968612271 4:1562733-1562755 AGAAGGTTCCAGAAGCTGACTGG + Intergenic
969093006 4:4710179-4710201 AGGGTCTTCTAGAAGCTGACGGG + Intergenic
969750114 4:9103643-9103665 AGTCACATCCAGAAGCTGACTGG + Intergenic
970176414 4:13344056-13344078 GGTGGTTGCCAGAAGCTGAAGGG + Intergenic
970361761 4:15316361-15316383 AGTGGTTGCCAGGAGCTGAGGGG - Intergenic
970670101 4:18386864-18386886 AGTGAGTTCCAAAAGGTGAGGGG + Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
972275113 4:37549860-37549882 AGTCACACCCAGAAGCTGACTGG + Intronic
972292841 4:37706023-37706045 AGTGATTTCCAGGTGCTGAGGGG - Intergenic
972308463 4:37855209-37855231 AGTGGTTACCAGGGGCTGACTGG - Intronic
973011063 4:45073953-45073975 AGTGGTTGCCAGGAGCTGAAAGG - Intergenic
973397719 4:49610790-49610812 AGAGACTTCCAGAAGCAGAGAGG + Intergenic
974103051 4:57438513-57438535 AGTTGCTTCCAGGAGCTGACGGG - Intergenic
974419581 4:61655699-61655721 AGTGATTTCCATCTGCTGAGTGG + Intronic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974875408 4:67698267-67698289 AGTGATTTGAAGAAACTGACAGG - Intronic
974949665 4:68572823-68572845 AGTCACACCCAGAAGCTGACTGG - Intronic
974988143 4:69054735-69054757 AGTCACACCCAGAAGCTGACTGG + Intronic
975401206 4:73941828-73941850 AGAGATTTCCAGAAACTGGTGGG - Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977578850 4:98703144-98703166 AGTGGTTCCCAGGAGCTGAGGGG + Intergenic
977622002 4:99148476-99148498 AGTGGTTGCCAGAAGCTAAATGG - Intronic
977740447 4:100474816-100474838 AGTGGTTACCAGAAGCTGGGAGG + Intronic
979378173 4:119974008-119974030 GGTGGTTACCAGCAGCTGACAGG + Intergenic
979406091 4:120312116-120312138 AGGGATTTCCAGAAGCTCATAGG - Intergenic
979563930 4:122132998-122133020 AGAAATTTCCAGAAGCTAATGGG + Intergenic
980965827 4:139519986-139520008 AGTTATTTACAGAGTCTGACTGG + Intronic
981583675 4:146275959-146275981 TGTGGTTTCCTGAATCTGACTGG - Intronic
981716318 4:147756194-147756216 AGGTATTAGCAGAAGCTGACTGG - Intronic
982662577 4:158224754-158224776 AGTCACACCCAGAAGCTGACTGG - Intronic
982800027 4:159694371-159694393 AGTGATTTCCAAAGGCTCAGGGG + Intergenic
982941359 4:161561428-161561450 AGTGATTTCCAGGAACTGCATGG + Intronic
983789556 4:171779417-171779439 AGTGATTTCCAAAATGTGATCGG + Intergenic
983898168 4:173103673-173103695 AGTCACACCCAGAAGCTGACTGG + Intergenic
984507003 4:180632546-180632568 AGTGATTGCAGGAAGGTGACTGG - Intergenic
989095843 5:37780623-37780645 AGTCACACCCAGAAGCTGACTGG - Intergenic
989145513 5:38245708-38245730 AGTGATGTCCTGAAGCTGGAAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
993714890 5:91266172-91266194 AGTGATTTCCAGGGGCTGCAGGG + Intergenic
993862041 5:93148106-93148128 ACTGATTTTCAGGAGATGACTGG - Intergenic
993974407 5:94458988-94459010 AGTGGTTACCAGAAGCTGAGGGG - Intronic
994741883 5:103629288-103629310 ATAGGTTTCCAGAAGATGACTGG - Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996216105 5:120868677-120868699 AGTGATTTCCACAGGCTGACAGG - Intergenic
997206539 5:132053628-132053650 TTTGGCTTCCAGAAGCTGACTGG - Intergenic
997349977 5:133223884-133223906 ACTTTTTTCCAGTAGCTGACTGG - Intronic
997890933 5:137676128-137676150 ATGGATTCCCAGAAGGTGACTGG - Intronic
998146739 5:139733499-139733521 AGGGAGTTCCAGATGCTCACAGG - Intergenic
998178965 5:139922928-139922950 AGTGATTGCCAGAGGTTGAGGGG + Intronic
998564130 5:143201072-143201094 AGTGAATTTCAGAGACTGACTGG + Intronic
1001985089 5:176067566-176067588 AGTGGTTTCCAGCAGCTGCTAGG - Intronic
1002231776 5:177770569-177770591 AGTGGTTTCCAGCAGCTGCTAGG + Intronic
1002263565 5:178013184-178013206 AGTGGTTTCCAGCAGCTGCTAGG - Intronic
1003135697 6:3433337-3433359 AGTGAGTCCCAGAAGCTGTAGGG + Intronic
1003694152 6:8386262-8386284 ATTGGTTTCCAGGAGCTGATTGG + Intergenic
1004883048 6:20027580-20027602 TGTGAGTACCAGAAGCTGGCAGG - Intergenic
1005630319 6:27701126-27701148 GGTGATGTCCAGAGGCTGAAGGG - Intergenic
1006031978 6:31183018-31183040 AGTCACACCCAGAAGCTGACTGG - Intergenic
1009044664 6:58223860-58223882 AGTGGTTACCAGAGGCTGAGAGG + Intergenic
1009220482 6:60978131-60978153 AGTGGTTACCAGAGGCTGAGAGG + Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1010317954 6:74472035-74472057 AGTCACACCCAGAAGCTGACTGG + Intergenic
1011772229 6:90686731-90686753 GGTGATTGCTAGAAGCTGAGGGG + Intergenic
1012148245 6:95713462-95713484 GGTGGTTGCCAGAAGCTGAGGGG + Intergenic
1012329321 6:97964573-97964595 AGTGATGTGCTGAAGCTTACAGG + Intergenic
1012700970 6:102457236-102457258 AATGGTTTCCATAAGCTTACGGG + Intergenic
1012704172 6:102499954-102499976 TGTGACTTCCAGAAGCTTAGAGG - Intergenic
1013994400 6:116291461-116291483 AGTCATTTCCTCAAGCTGGCTGG - Intronic
1014072708 6:117201756-117201778 AGTGAGTCCCAGGAGCTGAAGGG - Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015534267 6:134251509-134251531 AGAGATTTCCAGGAGAGGACAGG + Intronic
1016074462 6:139779297-139779319 AGTGCATTCTAGAAGCTGAAAGG + Intergenic
1018302392 6:162417470-162417492 AGAGATGACCAGAAGCTGAAGGG + Intronic
1019219930 6:170465078-170465100 CCTGCTTTCCACAAGCTGACTGG + Intergenic
1020322864 7:6953001-6953023 AGTCACACCCAGAAGCTGACTGG - Intergenic
1022216437 7:28267210-28267232 GGTGATTCCCAGAAGCTGAGGGG - Intergenic
1023089313 7:36603055-36603077 AGTGTTTCCCAGAATCTCACAGG + Intronic
1024502468 7:50125803-50125825 GGTGGTTTCCAGGAGCTGAGGGG + Intronic
1024905863 7:54378599-54378621 AGTGATTTCCAGAGGTAGAGGGG - Intergenic
1025711580 7:63915273-63915295 AGTGGTTTCCAGGAGCTGGTGGG + Intergenic
1027277930 7:76580884-76580906 AGTACTTTCCTGAAGCAGACAGG + Intergenic
1027427804 7:78079740-78079762 CTTGATTGCCAGAAGCTGTCTGG + Intronic
1027658471 7:80960619-80960641 AGTAATTTCCAAAAACTGTCAGG - Intergenic
1027838449 7:83277422-83277444 TTTGATTTCCAGAAGTTGATTGG + Intergenic
1028064046 7:86359712-86359734 AGTGATTACCAGAGGTTGGCGGG + Intergenic
1028672131 7:93413710-93413732 AGTGGTTACCAGAAGTTGAGGGG - Intergenic
1029096761 7:98091245-98091267 AGTAATTTCCAGAGGCTGAATGG - Intergenic
1031191848 7:118562792-118562814 AGTGGTTTCCAGGGGCTGAGGGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031259431 7:119499258-119499280 AGTGGTTACCAGAGGCTGGCAGG - Intergenic
1031394763 7:121260018-121260040 ACTGATTTACTGAAACTGACAGG - Intronic
1031550028 7:123098604-123098626 AGTGGTTACCAGAAGCTGGGGGG + Intergenic
1032729689 7:134627327-134627349 ACTGATTTCCAGATGCTGTAGGG - Intergenic
1033001217 7:137507369-137507391 AGTGCTTTCCAGAAACTAACAGG + Intronic
1033961637 7:146920562-146920584 AGTGATTTCTAGAAGATGTTTGG + Intronic
1034508403 7:151515316-151515338 AGTGGTTGCCAGGGGCTGACAGG + Intronic
1035325721 7:158064690-158064712 AGTGATTTCCAGAAGCTGACTGG + Intronic
1037475903 8:19257539-19257561 AGTGGTTTCCAGGAGTTGTCAGG + Intergenic
1037621706 8:20569170-20569192 AGTGATTACCAGAGGCTGGGAGG - Intergenic
1038089856 8:24240744-24240766 AGTCACACCCAGAAGCTGACTGG + Intergenic
1038203375 8:25438554-25438576 AATGATCTGCTGAAGCTGACAGG + Intronic
1038463901 8:27742446-27742468 AGTGATTTTCAGATGCAGTCAGG - Intronic
1038718990 8:30016399-30016421 AGTGACTTGCCGAAGCTGAAAGG + Intergenic
1040061005 8:43102732-43102754 GGTGATTTACAGAAGCAGAATGG - Intronic
1041227333 8:55713473-55713495 AGTCACGCCCAGAAGCTGACTGG + Intronic
1041515662 8:58696280-58696302 AGTCACACCCAGAAGCTGACTGG + Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042059200 8:64798837-64798859 GCTGTTTTCCAGAAGCTGCCGGG - Intergenic
1042694434 8:71540714-71540736 AGTTATTTCCAGTATCTGATGGG - Intronic
1043166479 8:76909114-76909136 CGAGATCTCCAGAAGCTCACTGG - Intergenic
1045918285 8:107499673-107499695 AGAGATTTCCAAAAGCAGGCTGG - Intergenic
1045987824 8:108269884-108269906 GGTGGTTGCCAGAAGCTGAGGGG - Intronic
1046287867 8:112119134-112119156 AATGGTTTCCAGGAGCTGAGAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047794091 8:128236225-128236247 TGTGATTTGCAGAATCTGGCTGG - Intergenic
1047857754 8:128930952-128930974 AATTCTTTCCAGAAGCAGACAGG - Intergenic
1048089970 8:131229186-131229208 AGTTATTTCCATAAACTGGCTGG - Intergenic
1048957163 8:139546743-139546765 AGTCACACCCAGAAGCTGACTGG - Intergenic
1049634082 8:143676865-143676887 AGTCACGCCCAGAAGCTGACTGG + Intergenic
1052019165 9:23506526-23506548 GGTGGTTTCCAGAAGCTGCAGGG - Intergenic
1052182817 9:25551332-25551354 AGTGATTTCTACAAGGTTACAGG + Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052687708 9:31775692-31775714 AGTGAAAACCAGAAGCTGAAAGG - Intergenic
1055322140 9:75092641-75092663 AGTGATTATCAGTAGATGACAGG - Intronic
1055324410 9:75113953-75113975 AGTGGTTGCCAGAGGCTGGCGGG - Intronic
1055391742 9:75829098-75829120 AGTGGTTTCCAGGAACTGAAGGG + Intergenic
1056784170 9:89577065-89577087 AGTGGTTTCCAGGGGCTGGCAGG - Intergenic
1057144776 9:92750612-92750634 AGTGGTTGCCAGAGGTTGACGGG + Intronic
1057566222 9:96168259-96168281 AGTGAATGCCAGAAGCCGCCTGG - Intergenic
1057582149 9:96296438-96296460 AATGAATTCCATAAGCTGAGTGG - Intronic
1059943102 9:119377082-119377104 AGTGGCTTCTAGATGCTGACAGG + Intergenic
1060118545 9:120966436-120966458 ACTGATTTCCTGAAGGTCACTGG + Intronic
1061656376 9:132094098-132094120 AGTGGTTTCCAGAGACTGAGAGG - Intergenic
1061707941 9:132467362-132467384 GGTGATTGCCAGGAGCTGAGGGG - Intronic
1062178464 9:135177317-135177339 GGTGTTTTCCAGGAGCTGAAAGG - Intergenic
1185910162 X:3973599-3973621 AGTCACACCCAGAAGCTGACTGG + Intergenic
1186075330 X:5872196-5872218 ACTGATTTCCAGAGACTGAGAGG - Intronic
1186457316 X:9720085-9720107 AGTAATTTGCAGAACCTAACAGG + Intergenic
1187497334 X:19806576-19806598 AGTGATTTCCAGAATGTTCCAGG + Intronic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190422085 X:50295321-50295343 AGGGATTCTCAGCAGCTGACTGG + Intronic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1193087920 X:77463871-77463893 AGTGTTTACCAGAGGCTGAGGGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194585591 X:95730312-95730334 AGTCATTTCAAGAATCTGAATGG + Intergenic
1194653978 X:96548836-96548858 ATTGATTTCCAGAAGCGCAATGG + Intergenic
1194784643 X:98067180-98067202 GGTGATTGCCAGTAGCTGAGGGG + Intergenic
1195353716 X:104018546-104018568 AGTGATCACAAGAAGATGACTGG - Intergenic
1196023920 X:111020375-111020397 GGTGGTTTCCAGGAGCTGAGAGG + Intronic
1196333957 X:114507779-114507801 AGTTATTTCCAGAGGCTGGGAGG + Intergenic
1196345078 X:114645536-114645558 ACTGATTTCCAGAAGCATAAAGG + Intronic
1196667433 X:118331326-118331348 AATGATTCCCAGAATCTGAAAGG - Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197299317 X:124758857-124758879 AGTGATTTCCAGGAGTTGAGAGG + Intronic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1197860843 X:130968613-130968635 AGTGATTTCCAGGATCTGGGGGG + Intergenic
1197970270 X:132108232-132108254 AGTGGTTTCCAGCAGCTGGGTGG + Intronic
1198511630 X:137357710-137357732 AGGGACTACCAGAAGCTGAAAGG + Intergenic
1198549820 X:137733543-137733565 AAAGATTACCAGAAGCTGAACGG - Intergenic
1199222368 X:145332334-145332356 GGTGATTGCCAGAAGCTGGTGGG - Intergenic
1199825192 X:151491640-151491662 AGTGATTGCCAGGAGCTGCAGGG - Intergenic
1199844235 X:151679201-151679223 AGAGATTTGCAGAGGCTAACTGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200699364 Y:6389033-6389055 AGTCATACCCAGGAGCTGACTGG + Intergenic
1201034747 Y:9775665-9775687 AGTCATACCCAGGAGCTGACTGG - Intergenic
1201270520 Y:12249408-12249430 AGTCACATCCGGAAGCTGACTGG + Intergenic
1201297208 Y:12474212-12474234 AGTCACACCCAGAAGCTGACTGG - Intergenic
1201556529 Y:15268837-15268859 AGTCACACCCAGAAGCTGACTGG + Intergenic
1202303673 Y:23444709-23444731 AGTGATTTCCAGAAAGTAATTGG + Intergenic
1202567137 Y:26225885-26225907 AGTGATTTCCAGAAAGTAATTGG - Intergenic