ID: 1035326260

View in Genome Browser
Species Human (GRCh38)
Location 7:158067983-158068005
Sequence CAAGGTCCATGCCACCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 228}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035326260_1035326266 0 Left 1035326260 7:158067983-158068005 CCTGTGGGGTGGCATGGACCTTG 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1035326266 7:158068006-158068028 CAGCTGGGAGATGGCAGGACCGG No data
1035326260_1035326272 16 Left 1035326260 7:158067983-158068005 CCTGTGGGGTGGCATGGACCTTG 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1035326272 7:158068022-158068044 GGACCGGGTATGGGGAAAGGAGG No data
1035326260_1035326263 -9 Left 1035326260 7:158067983-158068005 CCTGTGGGGTGGCATGGACCTTG 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1035326263 7:158067997-158068019 TGGACCTTGCAGCTGGGAGATGG 0: 1
1: 0
2: 1
3: 21
4: 282
1035326260_1035326270 8 Left 1035326260 7:158067983-158068005 CCTGTGGGGTGGCATGGACCTTG 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1035326270 7:158068014-158068036 AGATGGCAGGACCGGGTATGGGG No data
1035326260_1035326265 -5 Left 1035326260 7:158067983-158068005 CCTGTGGGGTGGCATGGACCTTG 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1035326265 7:158068001-158068023 CCTTGCAGCTGGGAGATGGCAGG 0: 1
1: 0
2: 7
3: 37
4: 472
1035326260_1035326267 1 Left 1035326260 7:158067983-158068005 CCTGTGGGGTGGCATGGACCTTG 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1035326267 7:158068007-158068029 AGCTGGGAGATGGCAGGACCGGG 0: 1
1: 0
2: 8
3: 87
4: 828
1035326260_1035326268 6 Left 1035326260 7:158067983-158068005 CCTGTGGGGTGGCATGGACCTTG 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1035326268 7:158068012-158068034 GGAGATGGCAGGACCGGGTATGG No data
1035326260_1035326271 13 Left 1035326260 7:158067983-158068005 CCTGTGGGGTGGCATGGACCTTG 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1035326271 7:158068019-158068041 GCAGGACCGGGTATGGGGAAAGG No data
1035326260_1035326277 28 Left 1035326260 7:158067983-158068005 CCTGTGGGGTGGCATGGACCTTG 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1035326277 7:158068034-158068056 GGGAAAGGAGGGAGGAAGGCAGG No data
1035326260_1035326269 7 Left 1035326260 7:158067983-158068005 CCTGTGGGGTGGCATGGACCTTG 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1035326269 7:158068013-158068035 GAGATGGCAGGACCGGGTATGGG 0: 1
1: 0
2: 0
3: 13
4: 158
1035326260_1035326273 17 Left 1035326260 7:158067983-158068005 CCTGTGGGGTGGCATGGACCTTG 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1035326273 7:158068023-158068045 GACCGGGTATGGGGAAAGGAGGG No data
1035326260_1035326275 20 Left 1035326260 7:158067983-158068005 CCTGTGGGGTGGCATGGACCTTG 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1035326275 7:158068026-158068048 CGGGTATGGGGAAAGGAGGGAGG 0: 1
1: 0
2: 3
3: 60
4: 635
1035326260_1035326276 24 Left 1035326260 7:158067983-158068005 CCTGTGGGGTGGCATGGACCTTG 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1035326276 7:158068030-158068052 TATGGGGAAAGGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035326260 Original CRISPR CAAGGTCCATGCCACCCCAC AGG (reversed) Intronic
900323589 1:2096603-2096625 CACCGTCCATGCCACGCCACGGG - Intronic
901167954 1:7233263-7233285 CAAAGTCCATGCCTCCCAAATGG - Intronic
902930977 1:19731253-19731275 CAGGGTCCATGCCATCCATCAGG + Intronic
904474638 1:30757123-30757145 CACGGCCCCTGCCTCCCCACTGG + Intronic
904793785 1:33043671-33043693 AAAGGTGCATACCACCACACCGG - Intronic
904866514 1:33583467-33583489 CTTGGGCCATGCCACCCCTCAGG + Intronic
907314757 1:53561128-53561150 CTAGTCCCATTCCACCCCACTGG + Intronic
908201653 1:61802233-61802255 ACAGGTGCATGCCACCACACTGG + Intronic
908225267 1:62049972-62049994 ACAGGTGCATGCCACCACACGGG - Intronic
910225073 1:84928047-84928069 CAGGGTCCATGCAAGCCCCCTGG + Intronic
911400864 1:97373549-97373571 CAAGGTCCTTACCTGCCCACAGG + Exonic
912312635 1:108639500-108639522 CCAGGTCCATGCCACTGCATGGG - Intronic
914373515 1:147051547-147051569 CACCATCCATGCCACCCCAGGGG + Intergenic
915273711 1:154773698-154773720 CAAGGTCCCTTCCAGCACACAGG + Intronic
915376888 1:155404211-155404233 ACAGGTACATGCCACCACACTGG - Intronic
915957373 1:160232674-160232696 ATAGGTGCATGCCACCACACTGG - Intronic
916171068 1:162002151-162002173 CAAAGTCAGGGCCACCCCACAGG + Intronic
916686658 1:167153395-167153417 ACAGGTGCATGCCACCACACCGG + Intergenic
919631828 1:199966793-199966815 ACAGGTGCATGCCACCACACCGG - Intergenic
922359216 1:224805637-224805659 CCAGGCCCATGCCATCCCATTGG + Intergenic
922499053 1:226083544-226083566 CAAGGCCCAGGCCACGCCCCCGG + Intergenic
922696734 1:227734830-227734852 CACGGTCCATGCCATCTCCCTGG + Intronic
1063186539 10:3656965-3656987 CAGGGTCCATGACACCTCCCTGG - Intergenic
1067398724 10:45950585-45950607 ACAGGTGCATGCCACCACACTGG - Intergenic
1067867044 10:49919679-49919701 ACAGGTGCATGCCACCACACTGG - Intronic
1068201228 10:53786673-53786695 CAAGGATTATGCCACTCCACTGG + Intergenic
1070382830 10:75896770-75896792 CAAGGTCCATGCCTCAGTACAGG - Intronic
1070612420 10:77942722-77942744 ACAGGTGCATGCCACCACACTGG + Intergenic
1071501089 10:86204819-86204841 CAGTGTCCATGCCTCTCCACAGG + Intronic
1072242981 10:93514558-93514580 CAAGGTCTCTGTCACCCCATGGG + Intronic
1073021022 10:100444126-100444148 ACAGGTGCATGCCACCACACCGG + Intergenic
1073446249 10:103582278-103582300 CAGGGTCCAGGTCAGCCCACTGG + Intronic
1074415265 10:113261991-113262013 GAAACTCCCTGCCACCCCACCGG + Intergenic
1076036316 10:127201388-127201410 CCAGGGCCATGCCACTCCTCTGG + Intronic
1076124166 10:127961514-127961536 CAAGTTCCAGGCCACCCCAGGGG - Intronic
1077013139 11:388367-388389 CAAGGCCCCTGCCATCCCCCAGG - Intergenic
1077213541 11:1384392-1384414 CAAGGTCCATGGCAACCCAAGGG - Intergenic
1077328753 11:1974815-1974837 AAATGGCCATGCCTCCCCACAGG - Intronic
1077526086 11:3066362-3066384 ACAGGTGCATGCCACCACACTGG + Intergenic
1078492284 11:11780756-11780778 CAAGATCAAAGCCAGCCCACAGG - Intergenic
1079006489 11:16794814-16794836 CAAGGGCCATCCCACCCACCTGG + Intronic
1079240378 11:18718258-18718280 CAAGATTCCTGCCTCCCCACAGG + Intronic
1082280704 11:50268193-50268215 CAATGTCCATGCCAAACCATGGG - Intergenic
1084066791 11:66708883-66708905 CAAGGTCCGTGGCTGCCCACAGG - Exonic
1084640727 11:70424186-70424208 CAAGGCCCCTGCTACCTCACTGG - Intronic
1088832949 11:113553407-113553429 CCCGGACCATGCCACACCACAGG - Intergenic
1089458809 11:118641026-118641048 CAAACTCCATGCCAGGCCACAGG - Intronic
1089760759 11:120721470-120721492 GAGGGACCATGCCACGCCACGGG + Intronic
1090255536 11:125281147-125281169 CTAGGGCCATGCCTCCCCTCTGG + Intronic
1202811732 11_KI270721v1_random:29994-30016 AAATGGCCATGCCTCCCCACAGG - Intergenic
1091908913 12:4212926-4212948 CAAAGTCCATGCCAGCCCAATGG - Intergenic
1095905210 12:47370203-47370225 ATAGGTTCATGCCACCACACTGG + Intergenic
1096750441 12:53755645-53755667 CCAGGTCCATCCCACCCCTGTGG - Intergenic
1099399488 12:82184731-82184753 CAAGTTCCTTTCCACCCCAGAGG + Intergenic
1100506782 12:95228859-95228881 GCAGGTACATGCCACCACACTGG - Intronic
1101131700 12:101697494-101697516 CAAGGTCCTTGACTCCCCAGGGG - Intronic
1101546663 12:105719784-105719806 ACAGGTGCATGCCACCACACTGG + Intergenic
1101881561 12:108629327-108629349 CCTGGTCCCTGCCATCCCACTGG + Intronic
1102281938 12:111625312-111625334 ACAGGTGCATGCCACCACACTGG - Intergenic
1102301244 12:111773106-111773128 ACAGGTACATGCCACCACACCGG - Intronic
1103651455 12:122436091-122436113 ACAGGTGCATGCCACCACACGGG + Intergenic
1104259493 12:127169820-127169842 TAAGATCCATGCCTGCCCACAGG - Intergenic
1106321706 13:28645450-28645472 ATAGGTGCATGCCACCACACTGG - Intergenic
1109945253 13:69423854-69423876 CAGGTTCCAGGCCTCCCCACTGG - Intergenic
1111917840 13:94380071-94380093 AAAGTTGCATGCCGCCCCACAGG - Intronic
1112299780 13:98219475-98219497 ACAGGTGCATGCCACCACACCGG + Intronic
1113287870 13:108873595-108873617 CAGGGTCCATGCCAACCACCAGG + Intronic
1113287892 13:108873669-108873691 CAGGGTCCATGCCAACCAACAGG + Intronic
1114324312 14:21573528-21573550 ACAGGTGCATGCCACCACACTGG - Intergenic
1114582272 14:23772998-23773020 CGAGGGCCATACCACTCCACTGG + Intergenic
1116124874 14:40771536-40771558 GAAGGTTTATGTCACCCCACCGG - Intergenic
1118475226 14:66110005-66110027 GAAAGTTCAAGCCACCCCACAGG + Intergenic
1120898647 14:89556993-89557015 CAAGTTCTTTCCCACCCCACAGG - Intronic
1123118926 14:105908175-105908197 CACGGTCAATGCCATCCCTCAGG + Intergenic
1123823074 15:24051354-24051376 AAAAGTCCATGCCACACTACAGG - Intergenic
1124242773 15:28044448-28044470 TCAGGTCCATGCCAGGCCACTGG - Intronic
1125365023 15:38904491-38904513 CAAGCCCCATGCCACTCCAAGGG - Intergenic
1125660409 15:41390103-41390125 AAAGGCACATGCCACCACACTGG + Intronic
1128044997 15:64609884-64609906 ACAGGTGCATGCCACCACACTGG - Intronic
1128059437 15:64725389-64725411 TAAGGTGCACGCCACCACACCGG - Intergenic
1128745414 15:70110866-70110888 CAATGTCCCCGCGACCCCACGGG - Intergenic
1129831530 15:78674105-78674127 CAATGTCCAGGCCACTCCCCAGG - Intronic
1130349740 15:83080455-83080477 ACAGGTGCATGCCACCACACCGG + Intergenic
1130537430 15:84797431-84797453 CAAAGCCCATGCCTTCCCACAGG - Intronic
1132884117 16:2175018-2175040 CGAGGTCCATGCCAGCCATCAGG - Intronic
1133998955 16:10767784-10767806 GAAGGTCCCTGAGACCCCACTGG + Exonic
1135508435 16:23059669-23059691 CAAGATCCCTGAGACCCCACCGG + Intergenic
1137536868 16:49333877-49333899 ACAGGTGCATGCCACCACACTGG + Intergenic
1142188100 16:88704067-88704089 CAGGGTGCATGCCCCCACACTGG + Intronic
1142266032 16:89064300-89064322 GAGGGGCCATGCCATCCCACAGG - Intergenic
1143706566 17:8701733-8701755 ACAGGTGCATGCCACCACACCGG + Intergenic
1144961771 17:19048376-19048398 CAGTGTCCATGCAACACCACAGG - Intergenic
1144973390 17:19126146-19126168 CAGTGTCCATGCAACACCACAGG + Intergenic
1145241027 17:21241192-21241214 CAAGGTCCATGCTGGCCCTCAGG + Exonic
1147191956 17:38743230-38743252 ACAGGTGCATGCCACCACACTGG + Intronic
1148030196 17:44614556-44614578 ACAGGTGCATGCCACCACACTGG + Intergenic
1148807509 17:50271486-50271508 ACAGGTACATGCCACCACACCGG + Exonic
1149750569 17:59141587-59141609 ATAGGTGCATGCCACCACACTGG - Intronic
1149815014 17:59714819-59714841 TGAGGTGCATGCCACCACACAGG + Intronic
1150181543 17:63126548-63126570 ACAGGTGCATGCCACCACACTGG + Intronic
1150905255 17:69329476-69329498 ACAGGTGCATGCCACCACACAGG + Intergenic
1154113905 18:11594136-11594158 ACAGGTGCATGCCACCACACAGG + Intergenic
1154206622 18:12342838-12342860 CGGGCTCCATTCCACCCCACTGG + Intronic
1155887406 18:31224907-31224929 ACAGGTGCATGCCACCACACTGG + Intergenic
1158386896 18:57004354-57004376 CAAGGTCCAAGCCAGCCCCAAGG - Intronic
1160234804 18:77077565-77077587 CAAGGACCCTGCCCCACCACAGG - Intronic
1162579372 19:11519143-11519165 CTGGGTCCAGGCCACCCTACTGG - Exonic
1163009754 19:14417721-14417743 ACAGGCCCATGCCACCACACCGG - Intronic
1163041598 19:14607004-14607026 CAAGGCCCATGGCTCTCCACGGG + Exonic
1165345476 19:35246140-35246162 ACAGGTGCATGCCACCACACTGG - Intergenic
1166312436 19:41970290-41970312 CTAGGTCCCTGCCATCTCACTGG - Exonic
1166566785 19:43770333-43770355 CAAGGTCTATGCCTCCCACCTGG + Intronic
926153596 2:10438099-10438121 ACAGGTGCATGCCACCACACCGG - Intergenic
930668951 2:54127604-54127626 ACAGGTGCATGCCACCACACCGG - Intronic
930685865 2:54307667-54307689 ACAGGTGCATGCCACCACACTGG + Intergenic
932178037 2:69620556-69620578 AGAGGTCAATGCCACTCCACTGG + Intronic
933110700 2:78396984-78397006 CATGTTCCAGGCCTCCCCACTGG - Intergenic
937313067 2:120914179-120914201 CAAGGTCCCTGCCAGCTGACGGG + Intronic
937477354 2:122227414-122227436 CAGGTTCCATGCTACCCCTCTGG - Intergenic
937877561 2:126836962-126836984 CAACGTCCACGCCAGCCCTCCGG + Intergenic
937927526 2:127178506-127178528 ACAGGTACATGCCACCACACCGG + Intergenic
938022395 2:127916654-127916676 ACAGGTGCATGCCACCACACCGG - Intergenic
938779893 2:134575547-134575569 CTAGCTCCATGCCATCCCTCTGG + Intronic
944497923 2:200327260-200327282 ACAGGTGCATGCCACCACACTGG - Intronic
944617685 2:201478929-201478951 ACAGGTGCATGCCACCACACCGG - Intronic
944702250 2:202256371-202256393 TAAGGTGCATACCACCACACCGG + Intergenic
944742750 2:202628355-202628377 ACAGGTGCATGCCACCACACCGG + Intergenic
945508881 2:210675769-210675791 CAATGTCCCTGCCACCCCAGTGG + Exonic
945957336 2:216098620-216098642 CAAGGTCCATGCCTGCCTAAAGG + Intronic
947518618 2:230828088-230828110 CAGGGTCCACGCCACCCATCGGG + Intergenic
947697997 2:232208884-232208906 ATAGGTGCATGCCACCACACTGG - Intronic
948703897 2:239777703-239777725 CAGGGTCTGTGCCACCCCAGTGG + Intronic
1168785467 20:535612-535634 ACAGGTGCATGCCACCCCACCGG - Intronic
1169309943 20:4527546-4527568 CAAGCACCAGGCCAACCCACTGG + Intergenic
1171141779 20:22749798-22749820 CAAAGTCCTGGCCACCCCATAGG + Intergenic
1172570341 20:35965317-35965339 ACAGGTGCATGCCACCACACTGG + Intronic
1175580169 20:60092459-60092481 AGAGGTGCATGCCACCACACCGG - Intergenic
1175789264 20:61731393-61731415 TGAGATCCCTGCCACCCCACAGG + Intronic
1176094664 20:63334887-63334909 CAATGTCCATTCCTGCCCACAGG - Intergenic
1177066788 21:16447253-16447275 GCAGGTGCATGCCACCACACCGG - Intergenic
1178699850 21:34823762-34823784 CAAGTTTCATGCCACCCCATAGG + Intronic
1181010005 22:20034729-20034751 CAAGGTCCAGTCACCCCCACAGG - Intronic
1181106525 22:20579035-20579057 CATGGGCCATGCCACCCCCTGGG - Intronic
1182097862 22:27638151-27638173 CAAGGTGGATGGCACCCCCCAGG + Intergenic
1182550537 22:31098679-31098701 CGAGGACCAGGCCAGCCCACGGG + Exonic
1182625155 22:31640337-31640359 ACAGGCCCATGCCACCACACCGG + Intronic
1183299794 22:37053219-37053241 TAAGGTCCAGGCCAGCCCCCTGG - Intronic
1183458593 22:37936168-37936190 CAAGGCCCCAGCCAACCCACAGG - Intronic
1183556128 22:38528643-38528665 CCAGGCACATGCCACCACACCGG - Intronic
1184130139 22:42512730-42512752 GAAGGACCAGGCCACCCCTCGGG - Exonic
1184140315 22:42574547-42574569 GAAGGACCAGGCCACCCCTCGGG - Intergenic
1185048177 22:48539629-48539651 CCAGGTCGGTGCCACCCGACAGG + Intronic
1185323949 22:50216539-50216561 CGAGGTCCCTGGAACCCCACTGG - Intronic
949698027 3:6721545-6721567 CAAGGTACATTTCTCCCCACTGG + Intergenic
950285723 3:11743243-11743265 CAATGCCCAAACCACCCCACAGG - Intergenic
950672387 3:14535104-14535126 CCAGGACCATGCCAGCTCACCGG + Intronic
951225513 3:20116510-20116532 CAATGTCCAGGCCACACCCCAGG - Intronic
951730112 3:25800858-25800880 CAAGGTCTATGAGACCTCACAGG + Intergenic
952295144 3:32055343-32055365 ACAGGTGCATGCCACCACACTGG + Intronic
953646309 3:44759003-44759025 ACAGGTGCATGCCACCACACTGG + Intronic
954235282 3:49252325-49252347 CCAGGGCTGTGCCACCCCACTGG - Intronic
954559111 3:51540897-51540919 ACAGGCACATGCCACCCCACCGG - Intergenic
954710092 3:52501342-52501364 CCGAGTCCCTGCCACCCCACAGG - Intronic
955226940 3:57068029-57068051 ACAGGTGCATGCCACCACACCGG - Intronic
957787726 3:84903728-84903750 ACAGGTGCATGCCACCACACTGG - Intergenic
958120990 3:89287849-89287871 CAAGGTCAATGTCATACCACGGG - Intronic
960875006 3:122287229-122287251 CAATGTCCATGTCACCCAAGGGG + Intergenic
963048646 3:141123790-141123812 CAGGGTGCATGCCAACCCAGAGG + Intronic
964772504 3:160239222-160239244 CAGGCTCCAGGCCACCCCACTGG - Intronic
965609291 3:170527615-170527637 GAGGGGCCATGCCACCCCATGGG + Intronic
967040426 3:185687121-185687143 CACCATCCATGCCACCCCAGAGG - Exonic
967928749 3:194674583-194674605 ACAGGTGCATGCCACCACACCGG - Intergenic
971932845 4:33107282-33107304 ACAGGTGCATGCCACCACACCGG + Intergenic
977394221 4:96451155-96451177 CAACTTCCATGGCACCTCACAGG - Intergenic
978573373 4:110164596-110164618 ACAGGTGCATGCCACCACACCGG - Intronic
978919432 4:114164929-114164951 ACAGGTGCATGCCACCACACTGG - Intergenic
980105808 4:128587335-128587357 TAAGGTCCTTGTCAACCCACAGG - Intergenic
980931400 4:139186242-139186264 ACAGGTGCATGCCACCACACTGG - Intergenic
981973109 4:150689781-150689803 AAAGGTGCATGCCACCACACCGG - Intronic
983628088 4:169823651-169823673 CAGGGTCATGGCCACCCCACTGG + Intergenic
985667131 5:1187093-1187115 CAAGGCCCACGTCACCCCAGCGG - Intergenic
988574696 5:32410162-32410184 CTCGGTGCATGCCACCACACCGG - Intronic
989578975 5:43014377-43014399 CAAGGTGCATGCCACCACCTTGG + Intergenic
990285689 5:54298666-54298688 CAAGGCCCATGACAGCCCTCTGG + Intronic
991444127 5:66681527-66681549 CCAGGTCCCTGTCACCACACTGG + Intronic
992544012 5:77793248-77793270 ACAGGTGTATGCCACCCCACTGG + Intronic
994812392 5:104538157-104538179 TAAGGCGCATGCCACCACACTGG - Intergenic
1000051457 5:157566808-157566830 ACAGGTGCATGCCACCACACTGG + Intronic
1000325781 5:160170988-160171010 ACAGGTGCATGCCACCACACTGG + Intergenic
1001069123 5:168568972-168568994 CAATGTCCATGCCAAACCATGGG + Exonic
1001649055 5:173302327-173302349 CAAGCTCCCTGCCTCCCCACGGG - Intergenic
1005216241 6:23531883-23531905 CAAGGTACCTCCCACACCACAGG + Intergenic
1005452922 6:25991869-25991891 CCAGGTCCATGCCCGCCCCCAGG + Intergenic
1005491206 6:26349062-26349084 ACAGGTGCATGCCACCACACCGG + Intergenic
1008366744 6:50690037-50690059 CAAGGCCCCTGCCACCATACTGG + Intergenic
1011075582 6:83434859-83434881 ATAGGTGCATGCCACCGCACCGG - Intergenic
1012275616 6:97271812-97271834 CAAGGTATGTGCCACCACACTGG + Intronic
1018688943 6:166327937-166327959 ACAGGTGCATGCCACCTCACCGG + Intronic
1020656084 7:10929726-10929748 ACAGGTGCATGCCACCACACTGG - Intergenic
1023455410 7:40333493-40333515 ACAGGTCCATGCCCCCACACTGG - Intronic
1023506597 7:40905858-40905880 CCAGGCACATGCCACCACACTGG + Intergenic
1023713821 7:43022576-43022598 CAAGGTCCATTCCCCCCAAGGGG - Intergenic
1025163322 7:56685803-56685825 GCAGGTGCATGCCACCACACTGG - Intergenic
1025226077 7:57164688-57164710 ACAGGTGCATGCCACCACACTGG - Intergenic
1027251191 7:76399856-76399878 ACAGGTCCAAGTCACCCCACTGG - Intronic
1028465607 7:91148241-91148263 ACAGGTACATGCCACCACACTGG - Intronic
1030307716 7:108035998-108036020 ACAGGTGCATGCCACCACACCGG + Intronic
1032504125 7:132423053-132423075 CGAATTCCATGCCACCCCAAGGG - Intronic
1034013925 7:147561069-147561091 CAAGGTCATTGCCACCTCTCTGG - Intronic
1034679938 7:152920921-152920943 CCAGGTCCCTCCCACACCACAGG + Intergenic
1035326260 7:158067983-158068005 CAAGGTCCATGCCACCCCACAGG - Intronic
1035407163 7:158606720-158606742 CAAAGTCAATGCCGGCCCACAGG - Intergenic
1035860657 8:3024445-3024467 ACAGGTACATGCCACCACACGGG + Intronic
1039948133 8:42147433-42147455 ATAGGTGCATGCCACCACACTGG + Intergenic
1040564153 8:48551099-48551121 CAAAGTCCAAGCCACCACACAGG - Intergenic
1042418846 8:68561122-68561144 ACAGGTGCATGCCACCACACCGG + Intronic
1045137211 8:99233898-99233920 CACCATCCATGCCACCCCAGAGG - Intronic
1045459048 8:102411649-102411671 CCAGGTCCAGACCACCCCACCGG + Intronic
1047372706 8:124269123-124269145 TAACGTCCATCCCACCTCACCGG - Intergenic
1049594702 8:143477960-143477982 CCAGCTCCCTGCCTCCCCACAGG + Intronic
1052924846 9:34006532-34006554 ACAGGTGCATGCCACCACACTGG - Intronic
1053011896 9:34638229-34638251 GAAGGGGCATGCCAGCCCACAGG + Intronic
1054834425 9:69661531-69661553 CTGAGTCCTTGCCACCCCACAGG + Intronic
1055058497 9:72045495-72045517 ACAGGTGCATGCCACCACACCGG + Intergenic
1056348759 9:85726086-85726108 ATAGGTGCATGCCACCACACTGG - Intronic
1056988704 9:91389582-91389604 ATAGGTGCATGCCACCACACTGG + Intergenic
1057864032 9:98665125-98665147 ACAGGTGCATGCCACCACACTGG - Intronic
1059154165 9:111975320-111975342 ACAGGTGCATGCCACCACACTGG - Intergenic
1060409960 9:123393881-123393903 CCAGGTCCTTCCCGCCCCACTGG + Intronic
1060689261 9:125642061-125642083 ATAGGTGCATGCCACCACACCGG - Intronic
1061098783 9:128476427-128476449 ACAGGTGCATGCCACCACACCGG + Intronic
1062398336 9:136361615-136361637 CAAGGCCCTTGCCGCCCCCCTGG - Intronic
1062713305 9:137988397-137988419 CATGGACCATGCCACCCCCCTGG - Intronic
1187633377 X:21200098-21200120 ACAGGTGCATGCCACCACACTGG + Intergenic
1189163327 X:38833542-38833564 CAACCACCATGGCACCCCACTGG + Intergenic
1189919495 X:45889317-45889339 CAAGTGCCCTTCCACCCCACAGG - Intergenic
1190456726 X:50634679-50634701 AAAAGTCCATGCCCCCCTACAGG - Exonic
1192222171 X:69204658-69204680 CATGGTCAATTCCACACCACGGG - Intergenic
1192375832 X:70560871-70560893 ACAGGTGCATGCCACCACACCGG + Intronic
1193387023 X:80884229-80884251 CAAGGTGACTGCAACCCCACAGG + Intergenic
1193555072 X:82944134-82944156 ACAGGTGCATGCCACCACACTGG + Intergenic
1197184352 X:123570211-123570233 CAGGGTCCAGGCCTCCCCACTGG - Intergenic
1199524305 X:148775320-148775342 CAAAGTGCATGCCAGCACACAGG - Intronic
1199705535 X:150421863-150421885 CAAGCTCCACCCAACCCCACTGG + Intronic