ID: 1035326264

View in Genome Browser
Species Human (GRCh38)
Location 7:158068001-158068023
Sequence CCTGCCATCTCCCAGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 0, 2: 7, 3: 70, 4: 586}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035326264_1035326273 -1 Left 1035326264 7:158068001-158068023 CCTTGCAGCTGGGAGATGGCAGG 0: 1
1: 0
2: 7
3: 70
4: 586
Right 1035326273 7:158068023-158068045 GACCGGGTATGGGGAAAGGAGGG No data
1035326264_1035326279 19 Left 1035326264 7:158068001-158068023 CCTTGCAGCTGGGAGATGGCAGG 0: 1
1: 0
2: 7
3: 70
4: 586
Right 1035326279 7:158068043-158068065 GGGAGGAAGGCAGGCATGCTGGG No data
1035326264_1035326272 -2 Left 1035326264 7:158068001-158068023 CCTTGCAGCTGGGAGATGGCAGG 0: 1
1: 0
2: 7
3: 70
4: 586
Right 1035326272 7:158068022-158068044 GGACCGGGTATGGGGAAAGGAGG No data
1035326264_1035326281 26 Left 1035326264 7:158068001-158068023 CCTTGCAGCTGGGAGATGGCAGG 0: 1
1: 0
2: 7
3: 70
4: 586
Right 1035326281 7:158068050-158068072 AGGCAGGCATGCTGGGCTGGAGG No data
1035326264_1035326277 10 Left 1035326264 7:158068001-158068023 CCTTGCAGCTGGGAGATGGCAGG 0: 1
1: 0
2: 7
3: 70
4: 586
Right 1035326277 7:158068034-158068056 GGGAAAGGAGGGAGGAAGGCAGG No data
1035326264_1035326270 -10 Left 1035326264 7:158068001-158068023 CCTTGCAGCTGGGAGATGGCAGG 0: 1
1: 0
2: 7
3: 70
4: 586
Right 1035326270 7:158068014-158068036 AGATGGCAGGACCGGGTATGGGG No data
1035326264_1035326275 2 Left 1035326264 7:158068001-158068023 CCTTGCAGCTGGGAGATGGCAGG 0: 1
1: 0
2: 7
3: 70
4: 586
Right 1035326275 7:158068026-158068048 CGGGTATGGGGAAAGGAGGGAGG 0: 1
1: 0
2: 3
3: 60
4: 635
1035326264_1035326278 18 Left 1035326264 7:158068001-158068023 CCTTGCAGCTGGGAGATGGCAGG 0: 1
1: 0
2: 7
3: 70
4: 586
Right 1035326278 7:158068042-158068064 AGGGAGGAAGGCAGGCATGCTGG No data
1035326264_1035326280 23 Left 1035326264 7:158068001-158068023 CCTTGCAGCTGGGAGATGGCAGG 0: 1
1: 0
2: 7
3: 70
4: 586
Right 1035326280 7:158068047-158068069 GGAAGGCAGGCATGCTGGGCTGG 0: 1
1: 0
2: 8
3: 81
4: 652
1035326264_1035326271 -5 Left 1035326264 7:158068001-158068023 CCTTGCAGCTGGGAGATGGCAGG 0: 1
1: 0
2: 7
3: 70
4: 586
Right 1035326271 7:158068019-158068041 GCAGGACCGGGTATGGGGAAAGG No data
1035326264_1035326276 6 Left 1035326264 7:158068001-158068023 CCTTGCAGCTGGGAGATGGCAGG 0: 1
1: 0
2: 7
3: 70
4: 586
Right 1035326276 7:158068030-158068052 TATGGGGAAAGGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035326264 Original CRISPR CCTGCCATCTCCCAGCTGCA AGG (reversed) Intronic
900179099 1:1303579-1303601 GCTGCCCACTCCCAGCTCCACGG + Intronic
900189833 1:1348692-1348714 CCTGCCATCGCCCCGCTCCACGG + Intronic
900394202 1:2446470-2446492 CCTCCCTCCCCCCAGCTGCAGGG + Intronic
900641841 1:3691309-3691331 CCTGCCCTGCCCCAGCTGCCAGG + Intronic
900667695 1:3826552-3826574 TCAGCCATCTCCCAGCTGAATGG - Intronic
901203403 1:7479543-7479565 GCTGCCTTCTCCCAGCAGCCAGG - Intronic
901226989 1:7619168-7619190 CCTGCCATCTACCATCACCACGG + Intronic
901390616 1:8943590-8943612 CCTGGCAGCTCCCAGCCCCACGG - Intergenic
901762082 1:11478346-11478368 GCTGCCAGCCCCCAGCTGCAGGG - Intergenic
902163205 1:14549329-14549351 TCTGTCCTCTCCCAGCTGCAGGG - Intergenic
902361823 1:15946099-15946121 CCTGTCACCTCCCAGCAGCCTGG - Intronic
902514209 1:16980989-16981011 TCTGCCTTCTCCCAGCTTCCAGG + Intergenic
902708282 1:18221469-18221491 CCCGCCCTTTCCCAGCTCCAAGG - Intronic
902811612 1:18891161-18891183 CCTGCCACCTCCCAGCTGTGGGG + Intronic
902937991 1:19778583-19778605 CCTGCAATCACCCTGCAGCATGG + Intronic
903672042 1:25042182-25042204 CCTGGCATCTCCAAGCTTCCAGG - Intergenic
903762254 1:25706925-25706947 CATACCATCTCCAAGCAGCAGGG + Intronic
905250797 1:36647068-36647090 CCTGGCATCTCCCAGCAACCTGG + Intergenic
905403019 1:37716778-37716800 CCTTCCCTTTCCCACCTGCAAGG + Exonic
905453629 1:38072988-38073010 CCTCCCCTCTCCAAGCTGTAAGG - Intergenic
905546198 1:38802191-38802213 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
905973492 1:42157918-42157940 CCTGCCATGTGCCAGCCACACGG + Intergenic
907332041 1:53677862-53677884 CCTCCCATCTCACTGCTGCGAGG + Intronic
907996536 1:59638392-59638414 CCTGCCTTCACCCATGTGCAAGG - Intronic
908938986 1:69409770-69409792 CCTGGCATCTCCAAGCTTCTAGG + Intergenic
909163488 1:72185090-72185112 CCTGCCATGTTCCAGGTGCCAGG - Intronic
909197876 1:72649476-72649498 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
909282402 1:73771470-73771492 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
911275654 1:95854468-95854490 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
912404571 1:109426277-109426299 CCCGACGTCCCCCAGCTGCACGG + Intronic
912851770 1:113132427-113132449 CCTCACAGCTCACAGCTGCAGGG - Intergenic
913317594 1:117565858-117565880 CCCGCAGGCTCCCAGCTGCAAGG + Intergenic
914796779 1:150926496-150926518 CCTCCCGTCTTCCAGCTTCAAGG - Exonic
915521644 1:156448675-156448697 GCTGTCTTCTCCCGGCTGCATGG - Intergenic
916164439 1:161952953-161952975 CCTGCCATTTGCCAGCTGAGTGG + Intronic
916571794 1:166034398-166034420 CCTGCAATCTCAGGGCTGCAGGG + Intergenic
916615624 1:166436096-166436118 CATGCATTCTCCCAGCTGCTTGG + Intergenic
916745227 1:167680070-167680092 CCTGGCATGGCCCAGCTGGAAGG + Intronic
917472204 1:175335372-175335394 CTGGCCATCTCCCAGAAGCAAGG - Intronic
918413246 1:184282386-184282408 CCAGCCATCTTCCTGTTGCAGGG - Intergenic
918764304 1:188458731-188458753 CCTGCCATCTACCATCACCATGG + Intergenic
919249066 1:195029948-195029970 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
919475261 1:198025005-198025027 CCTGCAATCTGCCAGCTGCAGGG + Intergenic
919809960 1:201402765-201402787 ACTCCCATCTCCCTGCTGGAGGG + Intergenic
920776137 1:208938994-208939016 CCCGCCATCTTCCAGATGCCTGG - Intergenic
922041586 1:221903297-221903319 CCTGGCATCTCCAAGCTTCCAGG - Intergenic
922141594 1:222893679-222893701 CCTGGCATCTCCAAGCTTCCAGG - Intronic
923036066 1:230286117-230286139 TTTGTCATCTCCCTGCTGCAGGG + Intergenic
1063888805 10:10607878-10607900 CCTGCCACCTCCCACCTCCTGGG - Intergenic
1064602376 10:17006964-17006986 CCTGCAAGCTCCCAGCTGAAGGG + Intronic
1065398185 10:25264341-25264363 CCTGACATTTCCAAGCTGCAGGG + Intronic
1065820114 10:29517528-29517550 GCTGAAATCTCCCAGCTACAGGG + Intronic
1066654289 10:37684371-37684393 AGTGCCAGCTCCCAGGTGCATGG - Intergenic
1067019257 10:42781074-42781096 CCTGTCATCTCCTATCTGCTTGG - Intergenic
1067291693 10:44948233-44948255 CCTGCCAGCTCCAAGCCTCAGGG + Intergenic
1067950123 10:50727590-50727612 ACTCCCATCTTCCAGCTGAAGGG + Intergenic
1068137419 10:52964785-52964807 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
1068157592 10:53222133-53222155 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
1068300374 10:55131325-55131347 CCTGGCATCTCCAAGCTTCTGGG - Intronic
1068827636 10:61456813-61456835 CGTGTCATCCCACAGCTGCATGG - Intergenic
1069593056 10:69653678-69653700 CCTGGCATCTCCAAGCTTCTAGG + Intergenic
1069813873 10:71181162-71181184 CCTTCCTTCTCCCACCTGCCTGG - Intergenic
1070389479 10:75956844-75956866 CATGGCTTCACCCAGCTGCAAGG + Intronic
1070428868 10:76316230-76316252 CCTGGCGTCTCCCAGCTTCCAGG + Intronic
1070509165 10:77144778-77144800 CCAGCCATCTCTGAGTTGCAGGG - Intronic
1070543045 10:77430997-77431019 CCTGGCCTCTCCAGGCTGCAGGG + Intronic
1070746492 10:78936916-78936938 CCTGCCATGTCCCGGCTTTAAGG + Intergenic
1070885450 10:79892796-79892818 ACTCCCATCTTCCAGCTGAAGGG + Intergenic
1070977524 10:80617127-80617149 GCTGCCATCTCACAGCTGAGGGG + Intronic
1071381163 10:85061550-85061572 CCATCCATCTCCCATCTGCCAGG + Intergenic
1071790516 10:88949010-88949032 CCTGACAACTCCCACCTCCAAGG + Intronic
1071885953 10:89951121-89951143 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
1072781585 10:98255435-98255457 TCTGCCATTTCCCAGCTGTGTGG - Intronic
1073332940 10:102682630-102682652 CTTGCCATCTAGCAGCTCCATGG + Intronic
1073424726 10:103449568-103449590 TCTGTCATCTCCCTGCTGCGTGG - Exonic
1073733659 10:106320861-106320883 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
1073930321 10:108567190-108567212 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
1075131990 10:119748285-119748307 CCTGGCATCTCCAAGCTTCCGGG - Intronic
1075908869 10:126106210-126106232 CTTGCCAACTCCCAGCAGCAGGG - Intronic
1076125816 10:127972797-127972819 CCTCCCACCTGCCACCTGCATGG - Intronic
1076164721 10:128272644-128272666 GCTGCCCTCTGCCAGCTGAAGGG - Intergenic
1076305599 10:129463716-129463738 CCTGGCCTCTCCCAGGTCCAAGG + Intergenic
1076435584 10:130438998-130439020 GCTACCCTCTCCCAGCTGCAGGG + Intergenic
1077133545 11:987126-987148 CCGGCCATCTCCAGGCAGCATGG - Intronic
1077158164 11:1100669-1100691 ACTGCCACTCCCCAGCTGCAAGG - Intergenic
1077217259 11:1400181-1400203 CCTGCCCACTCCCTCCTGCAGGG - Intronic
1077329507 11:1977843-1977865 CCTGCCATCTCCCATCTGCCAGG + Intronic
1077419651 11:2444501-2444523 CCTGCCCTCACCCACCTGCTTGG - Intergenic
1077456988 11:2687280-2687302 CCTGGGATCTCAAAGCTGCAAGG - Intronic
1077530639 11:3093244-3093266 GCTCCCATCTCCCGCCTGCAGGG + Intronic
1077938942 11:6818983-6819005 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
1078512927 11:11998928-11998950 CCGTCCATCTCACAGCTGCTGGG - Intronic
1078518904 11:12047780-12047802 CCTGCCAGCTCCCAGCCTCTGGG - Intergenic
1078526172 11:12103296-12103318 CCTGACACCTCCCACCTGCTGGG + Intronic
1078874405 11:15378914-15378936 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
1079184023 11:18220585-18220607 CCTGGCATCTCCAAGCTTCCAGG - Intronic
1080706780 11:34702328-34702350 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
1081521045 11:43881200-43881222 TCTGTCACTTCCCAGCTGCATGG - Intronic
1081802005 11:45866422-45866444 CCTGGTATCTCCCAGCTGCCTGG - Intronic
1082750017 11:57005410-57005432 CCTGGCATCTCCAAGCTTCCAGG - Intergenic
1083413013 11:62506606-62506628 CCTGCATTTTCCTAGCTGCAGGG + Intronic
1083654900 11:64224843-64224865 GCTGGGATCCCCCAGCTGCAGGG + Exonic
1083661529 11:64253729-64253751 CCTGCCCCCTGCCAGCTGCACGG + Intronic
1083916193 11:65745093-65745115 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
1083961247 11:66016162-66016184 GCTTCCCTCTCCCAGCAGCAGGG + Intergenic
1084518188 11:69647547-69647569 CCTGCCACCCCCCAGCAGCAGGG - Intronic
1084566414 11:69931332-69931354 CCTGCCAGGTCCCAGCCGCTGGG + Intergenic
1084692218 11:70734076-70734098 CCTGCCCCCTCCCTGCTGCCAGG - Intronic
1084931031 11:72556038-72556060 TCTGCCATTTCCTTGCTGCATGG - Intergenic
1084944090 11:72629574-72629596 TTTGCCAGCTCCCAGCAGCAGGG + Intronic
1084970273 11:72767774-72767796 CCTGCCATGTCCCAGCTGTGTGG + Intronic
1085436704 11:76510788-76510810 TCTGCCAGCTCCCAGTTGAAAGG - Intronic
1085450424 11:76628860-76628882 CCTCCCACCTTCCAGCTGCATGG - Intergenic
1085730611 11:78995390-78995412 CTTGACATCTCCCAGCTGGCAGG + Intronic
1086084667 11:82942704-82942726 CCTGGCATCTCCAAGCTTCTGGG - Intronic
1087266868 11:96070470-96070492 CCTGTCATCTCCAAGCTTCTGGG + Intronic
1088135753 11:106553299-106553321 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
1088513392 11:110600310-110600332 CCTGGCATCTCCAAGCTTCTGGG + Intronic
1088568035 11:111194344-111194366 CCTGCCGTTTGCCAGCTGCTGGG - Intergenic
1088908858 11:114175579-114175601 CCTGTCCTCTCCCAGCTACTCGG - Intronic
1089308686 11:117543618-117543640 CCTGCCACCTACCAGCTGTGTGG + Intronic
1089755370 11:120682287-120682309 CTTGCCTTCTGCCAGCAGCAGGG - Intronic
1089971266 11:122695315-122695337 CCTGTCATCACTCAGTTGCATGG + Intronic
1090042015 11:123299727-123299749 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
1090124795 11:124074867-124074889 CCTGCAATCTCCAAGCTTCCAGG - Intergenic
1090511398 11:127379301-127379323 CCTGCCATTTCCCTACTGCATGG + Intergenic
1090839891 11:130478431-130478453 GCTGCCTTCTCACAGCTGCCGGG - Intergenic
1202812486 11_KI270721v1_random:33022-33044 CCTGCCATCTCCCATCTGCCAGG + Intergenic
1091705654 12:2691439-2691461 CCTGCCCTCTCCCAGCTCGCAGG + Intronic
1092159658 12:6309364-6309386 CCTGCCACCTGCCAACTACAGGG + Intergenic
1093492903 12:19725427-19725449 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
1096818099 12:54214520-54214542 CCTGCCTGCTCCCAGCTGCCTGG - Intergenic
1096823913 12:54259595-54259617 CCTGCCCCCACCCAGCTGCCTGG + Intronic
1097129852 12:56804070-56804092 CCTGGCATCTCCGAGCTTCTGGG - Intergenic
1097161465 12:57049210-57049232 CCTGCCATGTGCCTACTGCATGG - Intronic
1097261095 12:57720699-57720721 CCTGCCTTCCCCCAGCTGCCTGG + Intronic
1097477337 12:60074376-60074398 TCTGGCATATCCCAGCTGCAGGG + Intergenic
1098311601 12:69154311-69154333 GCTGCCATCTCTCACCTTCAAGG - Intergenic
1098519560 12:71420487-71420509 CCTGGCATCTCCAAGCTTCTGGG - Intronic
1100375356 12:94010508-94010530 CCTGGCTCCTCCCAGTTGCATGG + Intergenic
1100848006 12:98679679-98679701 CCTGGCATCTCCAAGCTTCTGGG + Intronic
1101839958 12:108320970-108320992 TCCCCCATCTGCCAGCTGCAGGG + Intronic
1102587066 12:113930883-113930905 CCTGCCACAACCTAGCTGCATGG + Intronic
1102606716 12:114073434-114073456 CCTGCCATCCTACAGCTGAATGG - Intergenic
1102743963 12:115233398-115233420 ACTGCCATCTCACAGAAGCAAGG + Intergenic
1102776308 12:115522651-115522673 CCTGACATTTCACAGCTCCAGGG + Intergenic
1103513521 12:121491290-121491312 CCCTCCATCTCCCAGCCTCATGG + Intronic
1103865652 12:124049931-124049953 CCTGCCATTAGCCAGCTGCTGGG + Intronic
1103919085 12:124390145-124390167 CCTGCCCTCTGCCCTCTGCAGGG + Intronic
1104040877 12:125129723-125129745 CGTGCCAGCTCCCAGCAGCAGGG - Intronic
1104093024 12:125531737-125531759 CCTACCCTCTCACAGCTGAAAGG + Intronic
1104110592 12:125700670-125700692 CATGAAATCCCCCAGCTGCATGG - Intergenic
1104329913 12:127835170-127835192 CCTGCCCTCTCCCTGCCTCAAGG + Intergenic
1105824238 13:24108118-24108140 TGTGCCATCGCCCGGCTGCAGGG + Intronic
1106230807 13:27819884-27819906 CCTGCCACCTCCAAGCTGCTTGG - Intergenic
1106253426 13:28001367-28001389 CCTGGCGTCTCCAAGCTGCCAGG - Intergenic
1106678733 13:31988195-31988217 CCTGCCATCTTCCAGCCACCTGG + Intergenic
1106781764 13:33066256-33066278 CCTACCATCTTCCAGCCGCGTGG - Intergenic
1107029648 13:35837628-35837650 TCTTCCATTTCCCACCTGCAGGG - Intronic
1107147151 13:37070977-37070999 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
1107400262 13:40062498-40062520 TCTGCCACTTCCTAGCTGCACGG - Intergenic
1107838739 13:44434681-44434703 CCTGCCACCACCCAGCCACAGGG - Exonic
1107841253 13:44459695-44459717 CCTGGCATCTCCAAGCTTCCAGG + Intronic
1108542335 13:51455839-51455861 CCTGGCATCTCCAAGCTTCCAGG - Intergenic
1109564280 13:64091022-64091044 CCTACCATCTACCAGTTGTACGG + Intergenic
1109633617 13:65085277-65085299 CCTGGCATCTCCAAGCTTCTAGG - Intergenic
1110014664 13:70386214-70386236 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
1110746986 13:79065464-79065486 CCTGCCATCTCCTGCCTCCAAGG + Intergenic
1111119326 13:83824588-83824610 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
1111192855 13:84832284-84832306 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
1111643118 13:90996078-90996100 TCTGCCATGTTCCAGCTACACGG + Intergenic
1111842859 13:93472571-93472593 CCTGGCATCTCCAAGCTTCCGGG - Intronic
1111923608 13:94439436-94439458 CCTACCAACTCCCACCTCCATGG + Intronic
1112086084 13:96033874-96033896 CCTGCCATCTACCATGTCCATGG - Intronic
1112579334 13:100664704-100664726 CCATTCATCTCCCAGCTGCCTGG + Intronic
1112792179 13:103015353-103015375 CCCACCATCTGCCACCTGCAAGG + Intergenic
1115485095 14:33902393-33902415 CCTGGCATCTCCCAGCTTCCAGG + Intergenic
1116967806 14:51032366-51032388 GCATCCTTCTCCCAGCTGCAGGG + Intronic
1117514530 14:56487528-56487550 CCTGCCATCCCTAATCTGCAAGG + Intergenic
1117874190 14:60234412-60234434 CATGCCCTCTCCCAGTTCCATGG - Intergenic
1118200021 14:63663126-63663148 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
1119208087 14:72809586-72809608 CCTGCCATCAGCCACATGCAGGG - Intronic
1119257069 14:73208062-73208084 CCTGGCATCTCCAAGCTTCTGGG - Intronic
1119474912 14:74921547-74921569 CATTCCAGGTCCCAGCTGCAGGG - Exonic
1121027865 14:90629790-90629812 CCTCGCCTCTCCCAGCTGCTCGG + Intronic
1121842481 14:97145754-97145776 CCTCCCAACTCCCAGCAGAAGGG - Intergenic
1122534099 14:102450323-102450345 CCAGCCCTCTCCCTGCTGCATGG + Intronic
1124137847 15:27050429-27050451 CCTGCCACCTCCCAGGTGAAGGG - Intronic
1124240793 15:28026342-28026364 CATGCCTTTTCCCAGCTGGACGG - Intronic
1124402764 15:29364560-29364582 CCTTCCTTCACCCAGCTGAAAGG + Intronic
1124552309 15:30693075-30693097 CCTGCCAGCTCCCACAGGCACGG - Intronic
1124678930 15:31712591-31712613 CCTGCCAGCTCCCACAGGCACGG + Intronic
1124896879 15:33785697-33785719 CCTGACATCCCCCAGCTGGAAGG + Exonic
1124955188 15:34355760-34355782 TCTGCCATCCCCCAGCAGCTGGG + Exonic
1125152762 15:36551920-36551942 CCTGTCACTTCACAGCTGCAAGG - Intergenic
1125241650 15:37582942-37582964 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
1125824698 15:42666454-42666476 CCTTCCTTCTCCCAGTTTCAAGG - Intronic
1126323170 15:47447057-47447079 CCTGCCATATCCATGCTGAAGGG + Intronic
1126759195 15:51953845-51953867 CCTCCCATCTCCCAAGTGCTGGG - Intronic
1126782068 15:52147495-52147517 CATGCCATCACCCACGTGCAGGG + Exonic
1127866487 15:63037386-63037408 ACTGCCACCTCCCAGCTGAGTGG + Intergenic
1128246476 15:66136038-66136060 TGCGCCATCTCCCAGCTGCAGGG + Intronic
1128248020 15:66146308-66146330 CCTCCCCTCTCCCGGCTGCAAGG + Intronic
1128267833 15:66282115-66282137 CCTTGCCTCTCCCAGCTGCAGGG - Intergenic
1129377649 15:75144289-75144311 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
1130017905 15:80201668-80201690 CCTGCCATCCCACAGAGGCAAGG - Intergenic
1130407929 15:83618908-83618930 CTTTCCATCCCCCAGCTGGAAGG - Intergenic
1130557872 15:84935538-84935560 CGTGTCATCCCCCTGCTGCAGGG - Intronic
1130738067 15:86571131-86571153 CCTGGCATCTCCAAACTTCAGGG - Intronic
1130765273 15:86863941-86863963 CCTACCATCCCCCAGGTGCTAGG - Intronic
1130989966 15:88870339-88870361 CCTGGGATCTCCCAGGTGGAGGG - Intronic
1131248849 15:90818047-90818069 ACTACCACCTCCCAGCTGCGTGG - Intergenic
1131553446 15:93377216-93377238 CCTGCCATCTCCGAGTTGATAGG - Intergenic
1132008892 15:98256724-98256746 TCTGCCATCTCCTAGCTCTAGGG - Intergenic
1132011502 15:98280543-98280565 CCTGTCACCTCTGAGCTGCAAGG + Intergenic
1132396534 15:101479148-101479170 CCTGTCCTCTCCGAGCTCCACGG - Intronic
1132559561 16:587219-587241 CCTGAGATCTCTCAGCTGCAGGG + Intergenic
1132577697 16:671539-671561 CCTCCCCTATCGCAGCTGCAAGG + Intronic
1132983108 16:2749324-2749346 CCTCCCACCTCCCAGCTGCCTGG - Intergenic
1133750066 16:8718195-8718217 CCTGCCATGTGCCAGTTGCTGGG - Intronic
1134003710 16:10803383-10803405 CCTCCCATCTACCAGGTGGAGGG + Intronic
1134062545 16:11207847-11207869 CATGCCATGCCCTAGCTGCAAGG - Intergenic
1134066069 16:11229199-11229221 CCTTCCAGCTCCCAGCTTCTTGG + Intergenic
1134080450 16:11321255-11321277 TCTGCCACCTCACAGTTGCATGG - Intronic
1134280590 16:12813610-12813632 CCTCCCAGCTCCCAGGTTCAAGG + Intergenic
1136035845 16:27539540-27539562 TATGGGATCTCCCAGCTGCAGGG - Intronic
1136075824 16:27816742-27816764 CCTGCCACAAGCCAGCTGCAGGG - Intronic
1136418699 16:30118693-30118715 GCTGCCATTACCCAGCGGCAGGG + Intronic
1137063557 16:35813966-35813988 CATACCATCTCCCAGATGAATGG + Intergenic
1137334216 16:47532689-47532711 CCTGACATCTCCAAGCTTCTGGG - Intronic
1137693020 16:50442290-50442312 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
1138194887 16:55044713-55044735 CTTGCCAGATTCCAGCTGCAGGG + Intergenic
1138350573 16:56344335-56344357 CCTGCCAGCACCCTGCTGCAGGG - Exonic
1138515329 16:57532969-57532991 CCTGGCAGCTCCCAGAGGCAGGG - Intronic
1139148079 16:64346150-64346172 CCTGGCATCTCCAAGCTTCAGGG + Intergenic
1139548900 16:67662674-67662696 CCTGCCATGTCCCAGCAGTGTGG - Exonic
1139659872 16:68413342-68413364 GCAGCTATCTTCCAGCTGCAAGG - Intronic
1140415035 16:74768456-74768478 ACTGCCCTCTACCACCTGCAGGG - Intronic
1140668059 16:77245891-77245913 ACTGACAACTTCCAGCTGCAAGG - Intergenic
1140967919 16:79985110-79985132 TCTGCCATTTACCAGCTGCATGG + Intergenic
1141427315 16:83952746-83952768 TTTGCCATTTCCCAGCTGCAGGG - Intronic
1141887087 16:86899507-86899529 CCTGCCATCTCCTGGCTGTGTGG - Intergenic
1142498981 17:321793-321815 CCTGCCATCCGCCAGCTCCTGGG + Intronic
1143112590 17:4560594-4560616 GCTGCCACCTCCCACCTGCCAGG - Exonic
1143189797 17:5033099-5033121 GCTGCAAGCTCCCTGCTGCATGG - Exonic
1144060847 17:11582479-11582501 CCTGGCATCTCCAAGCTTCCGGG - Intergenic
1144626304 17:16845989-16846011 CCTGCCAGCTCCCAGGTGGCTGG + Intergenic
1144670291 17:17129001-17129023 CCACCCAGCTCCCAGCTGCCTGG - Intronic
1144880129 17:18426731-18426753 CCTGCCAGCTCCCAGGTGGCTGG - Intergenic
1144945373 17:18966996-18967018 TCTGCCATGTCCCAGCCACATGG - Intronic
1144998772 17:19288997-19289019 CCCACCATCTCCCACCTGGATGG - Intronic
1145152104 17:20517653-20517675 CCTGCCAGCTCCCAGGTGGCTGG + Intergenic
1145772285 17:27502142-27502164 TCTGCCATTTCCTAGCTGAAAGG - Intronic
1146278950 17:31532689-31532711 CCTGCCATCACCAGGCTGCGTGG - Exonic
1146648941 17:34594391-34594413 TCTGCCATATCCCAGCTGTGTGG + Intronic
1146722844 17:35135257-35135279 CCTGCCATCCCACAGCTTGATGG + Exonic
1146885095 17:36465098-36465120 CCTGCCCTCCCGCAGCTGGAAGG - Intergenic
1146927545 17:36755417-36755439 CCAGCCCTCTCCTAGCTTCATGG - Intergenic
1147260401 17:39206717-39206739 CCTGTCATCTCTCTACTGCATGG - Intergenic
1147491497 17:40871520-40871542 TCTGCCTCCTCCCAGCTGCATGG - Intergenic
1147580450 17:41624687-41624709 CCTGCCAGCTCCCAGGTGGCTGG + Intronic
1148386192 17:47236885-47236907 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
1148680986 17:49473351-49473373 CCCCCCATCTCCCAGCTGGATGG - Intronic
1149238061 17:54616446-54616468 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
1149288851 17:55195998-55196020 CCTGCCATATCCCTACTGCTTGG + Intergenic
1149329951 17:55570394-55570416 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
1149532576 17:57407256-57407278 CCTGCGATCTCCCAGCTCCGGGG + Intronic
1150004474 17:61461505-61461527 CCTGCCATTTCACTGCTGTAGGG + Intronic
1150529277 17:65959637-65959659 CCTGGCATCTCCAAGCTTCCAGG + Intronic
1151530395 17:74700624-74700646 CCTGGCTACTCCCAGCTGCTTGG + Intronic
1151683586 17:75634364-75634386 CCTGCACTCTCCCTGCTGCTGGG + Intronic
1151773192 17:76178260-76178282 CCTGGCATCTCCAAGCTTCCGGG + Intronic
1152166336 17:78710047-78710069 CCTGAAGTCTCCCAGCTGGAAGG - Intronic
1152198001 17:78928760-78928782 CCAGTCATCTCCCTGCTGCTTGG + Intergenic
1152245988 17:79184794-79184816 CCAGCCATCTCCCCACTGCCAGG - Intronic
1152558442 17:81066244-81066266 CCTGTCCTCTGCCAGCTGCCCGG + Intronic
1152719198 17:81914620-81914642 ACGGCCATCTCCGAGCTCCACGG - Exonic
1152722096 17:81928190-81928212 CCTGGCAGCTCCCAGCAGCGAGG + Intergenic
1152867328 17:82732114-82732136 CCAGCCCTCTCCCTGCTGCCTGG - Intergenic
1153427886 18:4987006-4987028 CCTGGCATCTCCAAGCTTCCAGG - Intergenic
1153618416 18:6954454-6954476 CCTGCAGTTTCTCAGCTGCATGG - Intronic
1153816397 18:8793997-8794019 CCTGCCTTCCCTAAGCTGCAAGG - Intronic
1153819977 18:8824771-8824793 CCTGCCGTCCACCAGCAGCAAGG + Exonic
1154207294 18:12348053-12348075 CCTGCCACCTGCCCTCTGCATGG - Intronic
1155215859 18:23642334-23642356 CCTGGCATCTCCAAGCTCCCAGG + Intronic
1155623462 18:27807792-27807814 CCAGCCAGCTCCCAGAAGCAAGG + Intergenic
1155819271 18:30353482-30353504 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
1155830929 18:30514030-30514052 CCTGGCTTCTCCCTGCTGCCAGG - Intergenic
1156162365 18:34374510-34374532 CCTGCTACCTCCCACCTCCATGG - Intergenic
1156475375 18:37402525-37402547 CCTGCCACCTCCAAGCTAGAAGG - Intronic
1157253207 18:46114705-46114727 GCTCCCAGCTCCCAGCTGGAAGG - Intronic
1157873392 18:51250259-51250281 CCTGGCATATCACAGCTGGAAGG - Intergenic
1158197964 18:54909797-54909819 CCTGGCATCTCCAAGCTTCTGGG - Intronic
1158772970 18:60543861-60543883 CACGCCACCTCCCAGCTGCTAGG - Intergenic
1158886178 18:61829414-61829436 CCTGGCCCATCCCAGCTGCAGGG - Intronic
1159956752 18:74524145-74524167 CCTGCCATCACTCAGCTCCTGGG + Intergenic
1160083486 18:75753232-75753254 CCTGGCATCTCCAAGCTTCCAGG - Intergenic
1160554894 18:79718551-79718573 CCTGCAATCTCCCCACTCCAGGG - Intronic
1160943296 19:1630038-1630060 CCTGCCCTCTCCAAGCTGCCTGG + Intronic
1160995446 19:1880150-1880172 GCTCCCAGCGCCCAGCTGCAGGG + Intronic
1161271615 19:3392753-3392775 CCTGCCCTCGCCCAGCTGGAGGG - Intronic
1161399352 19:4060539-4060561 GCTGCCACTTCCCAGCTGCGGGG + Intronic
1161793916 19:6375784-6375806 CCAGCCCTGTCCCAGCTGCAGGG + Exonic
1161820615 19:6528840-6528862 CTTCCCATCTCCCAGCCCCATGG - Intergenic
1162410571 19:10502898-10502920 CCTGCTGTCGCCCAGCTGCGCGG + Intronic
1163263238 19:16203890-16203912 CCTGGCTTCTGCCAGCTGGAGGG + Intronic
1163426378 19:17243140-17243162 CCTGCCAACTCCATGCTTCAAGG + Intronic
1163510791 19:17733867-17733889 CCTGCCCTCTCATAGCTGCTAGG + Intronic
1164506284 19:28863947-28863969 GCTGCCAATTCCCAGCTGCCGGG + Intergenic
1164625295 19:29723817-29723839 CCTGCAAAATTCCAGCTGCATGG + Intergenic
1164769887 19:30800372-30800394 CCAGCCATCTCCCAACTGCATGG - Intergenic
1165055343 19:33173007-33173029 ACTTCCATCTCCCAGGTTCAAGG - Intronic
1165173035 19:33906697-33906719 CCTGCCACCCCCATGCTGCACGG + Intergenic
1167123610 19:47533919-47533941 CCAGCCAGCTCCCAGCTCCAAGG + Intronic
1167645816 19:50704225-50704247 CCTGCCCTCTCTCTGCTGCCTGG - Intronic
1168536925 19:57178618-57178640 ACTGCCCTCTCCCTGCTGCTGGG + Intergenic
925238134 2:2297088-2297110 CCTGCAATGTCCCTGCTTCAAGG + Intronic
925348454 2:3186079-3186101 CCTGCCATCCACCAGCTGCCAGG + Intergenic
925727781 2:6890494-6890516 TCTGCCACCTCCCAGCTGCAGGG + Intronic
926070415 2:9884227-9884249 CCTGGCATCTCCAAGCTCCCAGG - Intronic
926214356 2:10895012-10895034 CCTTCCAGCTTCCAGCAGCATGG + Intergenic
926541349 2:14183797-14183819 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
926727942 2:16013160-16013182 CCTGCCATCTGCCACCTCCGAGG + Intergenic
927509044 2:23632912-23632934 CATGCCATGCCCTAGCTGCAGGG + Intronic
927743079 2:25590101-25590123 CCTGGCATCTCCAAGCTTCTGGG - Intronic
928140965 2:28728544-28728566 ACTTCCATCTCCCAGGTTCAAGG - Intergenic
928470182 2:31568129-31568151 CCTGGCATCTCCAAGCTTCCAGG - Intronic
928903642 2:36348251-36348273 CCTGCCATCCCCCAGCAGAATGG + Intergenic
928986769 2:37189795-37189817 CTTCCCATCTCCCAGCAGCTTGG + Intronic
929555817 2:42925038-42925060 CCTGCCATTCCCCTGCTGCAGGG + Intergenic
929847034 2:45541261-45541283 CCTGGCATCTCCCACCTTCCAGG - Intronic
930762044 2:55049049-55049071 CCTGCCACCGCCCAGCTCCCCGG - Intronic
931500180 2:62856333-62856355 CCTGGCATCTCCAAGCTTCCAGG + Intronic
932045144 2:68340944-68340966 TCTGCCACCTCTCAGCTACACGG + Intergenic
932479929 2:72032967-72032989 CCTGCCATTTGCCAGCTGTGTGG + Intergenic
932501550 2:72187188-72187210 CCTGGCATCTCCAAGCTTCTGGG - Intronic
932717426 2:74111738-74111760 TCTGCCATTTCCTAGCTGGATGG - Intergenic
932925044 2:75963707-75963729 CCTATCATCTGTCAGCTGCAAGG - Intergenic
933371149 2:81417542-81417564 CCTTCCACCTCCCAGGTCCATGG + Intergenic
933743085 2:85550258-85550280 CCCTCCATCTCCCAGCTGGAAGG + Intronic
935518669 2:104077792-104077814 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
936709067 2:115109945-115109967 TCTGCCATCTTCAAGCTACATGG + Intronic
936709204 2:115111669-115111691 CTTGCCTTCCCCCAGCTGCTGGG - Intronic
936993486 2:118389805-118389827 CCTGAGATCTCACAGCTGAAAGG - Intergenic
937067020 2:119025126-119025148 CATGACAGCTCCCAGCTTCAAGG - Intergenic
937167916 2:119837764-119837786 CCTGGCATCTCCAAGCTTCCAGG + Intronic
937268686 2:120633389-120633411 CCTGCCTGCTCCGAGCTGCTTGG - Intergenic
937449862 2:121993059-121993081 CCTCCCATCCTCCAGCTGTAGGG + Intergenic
937986493 2:127640435-127640457 CCTCCCAGGGCCCAGCTGCAAGG + Intronic
938102751 2:128508369-128508391 ACTGCAATCTCCCAGGTTCAAGG - Intergenic
938457398 2:131475666-131475688 CCTGCCACTTCCCAGGTGCTGGG + Intronic
939007502 2:136806305-136806327 CTTCCCAACTCCTAGCTGCATGG + Intronic
939017546 2:136919959-136919981 CCTGACATCTCCAAGCTTCCAGG - Intronic
940009251 2:149037889-149037911 CCTCCCACATCCCAGCTGCCTGG + Intergenic
940542227 2:155035431-155035453 CCTACCATCTGCCTGCTGCCTGG - Intergenic
940835502 2:158516783-158516805 CCTGTAATCCCCCAGCTGCTCGG - Intronic
941435768 2:165469530-165469552 CTTCCTCTCTCCCAGCTGCAGGG + Intergenic
941643248 2:168011784-168011806 TCTGCCACAACCCAGCTGCATGG + Intronic
941998968 2:171627420-171627442 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
942315474 2:174693148-174693170 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
943180152 2:184530512-184530534 CCTGGCATCTCCAAGCTTCCGGG - Intergenic
943820304 2:192314055-192314077 CCTGGCATCTCCAAGCTTCCGGG - Intergenic
944022597 2:195125050-195125072 CCTGGCATCTCCAAGCTTCCAGG - Intergenic
944866057 2:203863288-203863310 CCTGCCCTCTCCCAGGTTCAGGG - Intergenic
945234445 2:207621837-207621859 CGTGCCAGCACCCAGCTCCACGG + Exonic
945342347 2:208671647-208671669 ACTCTCATCTCCCAGCTACAGGG - Intronic
945627175 2:212224643-212224665 CCTTCCCACTCCCAGCTGAAAGG + Intronic
945705126 2:213221094-213221116 CCAGTCATCTCTCAGCTTCATGG - Intergenic
947490091 2:230586206-230586228 CCTGTAATCTCCCAGCTACCCGG + Intergenic
947533253 2:230925897-230925919 CCTGGCATCTCCCACCTTCAGGG + Intronic
948061653 2:235046921-235046943 CCTGCCCCTTCCCAGCAGCATGG + Intronic
948334831 2:237199922-237199944 CCTGGCATCTCCAAGCTTCCAGG - Intergenic
948506719 2:238433451-238433473 CCTTCCCTCTCCCAGCTACGGGG - Intronic
948713283 2:239839309-239839331 CCTGGCATCTCCAAGCTTCTAGG + Intergenic
948739514 2:240033598-240033620 TCTGGCCTCTCCCAGCTGCCAGG + Intergenic
1168956671 20:1838934-1838956 CCTGTCATCTTCCAGCTGTGGGG - Intergenic
1169309430 20:4522295-4522317 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
1169768384 20:9174219-9174241 GCCTCCATCTCCCAGCTTCAAGG + Intronic
1170840209 20:19919134-19919156 TCTGTCATCCCCCAGCTGGAAGG - Intronic
1172108716 20:32532623-32532645 CCTGCCATCCCCCTTCTGCCTGG + Intronic
1172625662 20:36345142-36345164 CTTGACATGTCCCAGCTGGAAGG + Intronic
1172938904 20:38641195-38641217 CCAGCCAGCTCTCAGCTGCTGGG + Intronic
1173654973 20:44693714-44693736 TCTGCCATCTGCCTGCTGAATGG - Intergenic
1174588093 20:51624264-51624286 CCTGCCATGGCCCTGCTGAAAGG + Intronic
1175176402 20:57114957-57114979 CCTGGCCTCTCCCAGCTGGCTGG - Intergenic
1175374915 20:58517516-58517538 TCTGCCACCTTCCAGCTGCCTGG - Intergenic
1175705735 20:61175114-61175136 CCTCCCTCCTCCCAGCTGCATGG + Intergenic
1175726954 20:61325006-61325028 CCCAGCATCCCCCAGCTGCAAGG - Intronic
1175757366 20:61538308-61538330 CCTGCCATCTCCCCTCCCCAGGG + Intronic
1175802168 20:61807117-61807139 CCCGCCAGCCCCCAGCTGCAAGG + Intronic
1175993879 20:62803896-62803918 CCTGCCATTTCCCAGCACCGCGG - Intergenic
1176075308 20:63245556-63245578 TCTCCCCTCTCCCTGCTGCATGG + Intronic
1176083057 20:63283586-63283608 CGTGCCCACCCCCAGCTGCAGGG + Intronic
1176131200 20:63497532-63497554 CTTGGCATCTCCCAGCCCCAGGG - Intronic
1176132921 20:63503802-63503824 CCTGCCCTGGCCCAGCTGCTCGG - Intergenic
1176385470 21:6136828-6136850 CCTGCCCTCTCCACGCTCCAGGG + Intergenic
1176973175 21:15289542-15289564 CCTGCCATCTCCAAGCTTCTGGG - Intergenic
1177026876 21:15931774-15931796 CCTGCCACCTCCCTCCAGCATGG - Intergenic
1178396401 21:32247412-32247434 CCTGCCATGTTCCTGTTGCAAGG + Intergenic
1179104251 21:38384047-38384069 CCGTCCATCCCTCAGCTGCAGGG + Intronic
1179130313 21:38630444-38630466 CCTCCCACCTCCCTGTTGCATGG - Intronic
1179185630 21:39083378-39083400 CCTCCCATCTCCCCCGTGCAGGG + Intergenic
1179454269 21:41488188-41488210 CCTGTCATCTCCCACCTGCTGGG + Intronic
1179586065 21:42375062-42375084 CCTGCCAGCACGCAGCTGCCAGG + Intronic
1179738003 21:43401424-43401446 CCTGCCCTCTCCACGCTCCAGGG - Intergenic
1180858338 22:19062320-19062342 CCTGCCCTGTCCCAGCAGCCAGG + Intronic
1181948401 22:26536611-26536633 CCTGCCATCTCACAGTTGATGGG - Intronic
1182517985 22:30869845-30869867 CCCGCCATGTCCCCACTGCATGG - Intronic
1182779380 22:32855498-32855520 CCTGCCATTTCCCAACTGTGTGG + Intronic
1182787352 22:32918879-32918901 TCTGCCTTCTCCAAGCTGCAAGG - Intronic
1182809820 22:33106213-33106235 CCAGCCATTTCCCAGATGCCTGG - Intergenic
1183165394 22:36143716-36143738 CCTGGCACCTCCAAGCTTCAGGG + Intronic
1183592345 22:38787084-38787106 CCTGCAATCTCTCAGGTGCATGG - Intronic
1184054168 22:42033288-42033310 CCTGGCATCTCCAAGCTTCTGGG - Intronic
1184097539 22:42324805-42324827 CATGCAATCTCCCAGCAGCCTGG + Intronic
1184246767 22:43239795-43239817 CTTTCCACCTCCCAGCAGCAAGG - Intronic
1184556509 22:45236104-45236126 CCTGCCACCTGCCAGCTACGTGG + Intronic
1184865733 22:47201006-47201028 CCTGGCATCTCCAAGCTTCCAGG - Intergenic
1185149102 22:49154149-49154171 CCAGCCTCCTCCCCGCTGCAGGG + Intergenic
1185183969 22:49381593-49381615 CCTGCGATGTCCCACCTGCCTGG + Intergenic
949226458 3:1700651-1700673 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
949840565 3:8315540-8315562 CCTACTGGCTCCCAGCTGCAAGG - Intergenic
949986641 3:9546400-9546422 CCTGCCTCCTCCCACCTCCAGGG + Intronic
950074136 3:10175248-10175270 CCTGTAATCTCCCAGCTACTCGG - Intronic
950085367 3:10253852-10253874 TCGGCCATTTACCAGCTGCATGG - Intronic
950091957 3:10302110-10302132 CCTGTAATCTCCCAGCTACTGGG + Intronic
951136128 3:19106554-19106576 CCTGGCATCTCCAAGCTTCTCGG - Intergenic
952042885 3:29281397-29281419 CCTGGCTTCCCCCAGCTGCCGGG - Exonic
952408643 3:33027142-33027164 CCTGGCATCTCCAAGCTTCTGGG + Intronic
952793435 3:37218226-37218248 CCTGGCATCTCCAAGCTTCAGGG + Intergenic
952900679 3:38109790-38109812 CCTGCCATCTCCTGCCTGCCAGG - Intronic
952954323 3:38547773-38547795 CCTGCCTTCCCCCAGCCCCAGGG - Intergenic
954272811 3:49522937-49522959 CCTTGCCTCTCCCAGCTCCAAGG + Intronic
954659703 3:52220512-52220534 GCTCCCAGCTCCCTGCTGCAGGG + Intergenic
954923994 3:54216620-54216642 TCTGCCACCTTCCAGCTGGAGGG - Intronic
955015414 3:55064718-55064740 CCTCCCATCTCCATCCTGCAGGG - Intronic
955335083 3:58078777-58078799 CCAGTCATCTGCCTGCTGCATGG - Exonic
955949693 3:64230153-64230175 CATGACCTCACCCAGCTGCAAGG + Intronic
956045807 3:65194560-65194582 CCTCCCCTCTCCCAGTTGGATGG - Intergenic
956704363 3:71986601-71986623 CCTTCCATCACCCAGCTGCTTGG + Intergenic
957369377 3:79272553-79272575 TCTCCCATCTCCCAGCAGCAGGG + Intronic
957636435 3:82791290-82791312 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
957638225 3:82815036-82815058 CCTGGCATCTCCTAGCTTCCAGG - Intergenic
958498303 3:94874194-94874216 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
958585874 3:96086839-96086861 TCTGACATCTCCCAGCTACATGG + Intergenic
958949285 3:100399910-100399932 CCTGCCATGCCCCAGCCCCAAGG - Intronic
960200514 3:114829753-114829775 CCTGCCATATGCTAACTGCATGG - Intronic
960688082 3:120313868-120313890 CCTGCCATGTCACTGCTGCCAGG + Intergenic
960702795 3:120453143-120453165 ACTGCCATTTACTAGCTGCATGG + Intergenic
960813936 3:121654135-121654157 CCTCCCACCTCCCAGGAGCAGGG - Intronic
961504274 3:127359810-127359832 CATGGCCTCACCCAGCTGCAAGG - Intergenic
961512165 3:127409689-127409711 CCTCCCAGCCCACAGCTGCATGG + Intergenic
962785830 3:138767805-138767827 CCTGACATCTCCAAGCTTCCGGG - Intronic
962872344 3:139508450-139508472 CCTCCTATCTCCCACCTCCAGGG + Intergenic
962985950 3:140536152-140536174 CTTGCCATCTACTAGCTGTACGG + Intronic
964338844 3:155686701-155686723 CCAGGCATCTCCCATATGCAAGG + Intronic
964430354 3:156599342-156599364 TCTGCCTTGCCCCAGCTGCAGGG - Intergenic
964927736 3:161978172-161978194 CCTGGCATCTCCCAGCTTCCAGG - Intergenic
965813286 3:172613604-172613626 CCTGGCATCTCCAAGCTACTGGG - Intergenic
966306932 3:178546914-178546936 TCCGCCATCTCACAGCTGCCTGG - Intronic
966571021 3:181442979-181443001 CCTGAAATTTCTCAGCTGCAGGG + Intergenic
966629855 3:182060211-182060233 CCTGCCTTTTGCCAGCTGCTTGG - Intergenic
968431259 4:560423-560445 CCGGCCCTATTCCAGCTGCAAGG - Intergenic
968817381 4:2829051-2829073 CCTGGCATCTCCCAGCTTTCTGG + Intronic
968981119 4:3850116-3850138 CCTGCTACCTCCCAGCTCCCAGG - Intergenic
969179325 4:5424926-5424948 CCTGGCATCTCCAAGCTTCTGGG + Intronic
969463973 4:7343907-7343929 ACTGCCACCTCCCAGCTGCAGGG - Intronic
969560310 4:7942489-7942511 CATGGCATCTCCCTCCTGCAGGG - Intergenic
971813320 4:31456104-31456126 CCTGCCATCTCACAGAGGCAGGG - Intergenic
972382155 4:38529239-38529261 CCTTTCTTCTCCAAGCTGCAGGG - Intergenic
972645925 4:40967464-40967486 CCTGGCATCTCCAAGCTTCTGGG + Intronic
973620021 4:52716974-52716996 CTTGGCATCTCCCAGCTCCTGGG - Intergenic
974308520 4:60173997-60174019 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
974619721 4:64340154-64340176 CCTGGCTTCTGCCAGCTCCATGG - Intronic
974894954 4:67927329-67927351 CCTGGCATCTCCAAGCTTCCTGG + Intronic
976647438 4:87400480-87400502 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
976922591 4:90457211-90457233 CCTGGGATCTCCAAGCTGCTGGG - Intronic
977471963 4:97453164-97453186 CCTGGCATCTCCAAGCTTCCGGG + Intronic
977487247 4:97665076-97665098 CCTGGCATCTCCGAGCTTCTGGG - Intronic
978691607 4:111519377-111519399 CCTTCCATCTCCCAGGTGAAAGG + Intergenic
978778891 4:112529573-112529595 ACTGACCTCTCCTAGCTGCAAGG - Intergenic
978822186 4:112979369-112979391 CCTGGCATCTCCAAGCTTCCAGG - Intronic
979010870 4:115366408-115366430 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
979011609 4:115377647-115377669 ATTCCAATCTCCCAGCTGCAGGG - Intergenic
979707553 4:123738615-123738637 CCTGCCATATACTACCTGCATGG + Intergenic
979956236 4:126956464-126956486 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
980253534 4:130348824-130348846 CCTGGCATCTCCAAGCTTCCAGG - Intergenic
980308640 4:131099344-131099366 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
980450312 4:132960418-132960440 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
980729722 4:136810972-136810994 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
980730860 4:136823342-136823364 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
981032143 4:140136199-140136221 CCTGCCACCTCTCAGCAGCAGGG - Intronic
981765171 4:148240791-148240813 CCTGCAATCTCACAGCAGCAAGG - Intronic
982320151 4:154068721-154068743 CCTCCCATCTCCCACTTGGAAGG - Intergenic
982351199 4:154416983-154417005 ATTACCCTCTCCCAGCTGCAGGG + Intronic
982957802 4:161793017-161793039 CCTGTCATCTCCAAGCTTCTGGG + Intronic
983125761 4:163949331-163949353 CCTGTCATCTCCAAGCTTCTAGG - Intronic
983784657 4:171716058-171716080 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
985009844 4:185570839-185570861 CCTGTGAACTCCCCGCTGCATGG - Intergenic
985591178 5:766303-766325 GCTCCCATCTTCCAGCGGCAGGG - Intronic
985776784 5:1848510-1848532 CCAGCCTTCTCCCACCTCCAGGG - Intergenic
985983406 5:3490441-3490463 CCTTCCCTCTCCTTGCTGCACGG - Intergenic
986923612 5:12717988-12718010 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
987370198 5:17186322-17186344 GCTCCCAGCTCCCAGCTGCCAGG + Intronic
987642806 5:20633749-20633771 CCTGCCCCCTCCCAGCAGTAGGG + Intergenic
989417378 5:41195456-41195478 CCTGGCACCTCCCAGCTTGATGG + Intronic
990073725 5:51816852-51816874 CCCACCATCTCCAAGCTTCAAGG + Intergenic
990474257 5:56146365-56146387 ACTGCCACCTCCCAGGTTCAAGG + Intronic
992629426 5:78666231-78666253 CCTGCCCTTTCCCTGCAGCATGG + Intronic
993256971 5:85604424-85604446 CCTGCCATGTAGCTGCTGCAGGG - Intergenic
993729632 5:91406925-91406947 CCCTCCATCTCCCAGGTTCAAGG - Intergenic
994248125 5:97504313-97504335 CCTCCCATTTCTCAGCTGGAAGG - Intergenic
994593968 5:101807484-101807506 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
994763279 5:103883916-103883938 CCAGCCATTTTCCAACTGCAGGG - Intergenic
995386719 5:111596725-111596747 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
995730659 5:115237857-115237879 CCTCCCATCTTCCAGCTGAAGGG + Exonic
995742510 5:115369444-115369466 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
996051458 5:118938865-118938887 CCTACCATCTACCAACTGAAAGG + Intronic
996183699 5:120451282-120451304 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
997223931 5:132194742-132194764 CTTGGCATTTACCAGCTGCATGG + Intronic
997626396 5:135334058-135334080 CCTGCCACATGCCACCTGCACGG + Exonic
998906330 5:146909076-146909098 ACTGCCCTCTCTTAGCTGCAGGG - Intronic
999714866 5:154352508-154352530 CTTAACCTCTCCCAGCTGCAGGG - Intronic
999795184 5:154982295-154982317 CCTACCATCTCCCTGGTCCAAGG - Intergenic
999887068 5:155936046-155936068 CCTGGCATCTCCAAGCTTCCAGG - Intronic
1000489548 5:161893702-161893724 CTCGCCACCTACCAGCTGCATGG + Intronic
1002043357 5:176529606-176529628 CTTGGCATCTCCCAGCCGCTCGG + Exonic
1002071870 5:176683553-176683575 CCTGGCATCACACAGCTGGATGG + Intergenic
1002168312 5:177361567-177361589 TCTGCCACATCTCAGCTGCATGG + Intronic
1002374764 5:178780795-178780817 CATGCCAGCGCCCAGCAGCAGGG + Intergenic
1002705188 5:181155914-181155936 TCTGCCATCTCTTAGCTCCAGGG + Intergenic
1002986326 6:2192577-2192599 CCTGGCATCTCCAAGCTTCTGGG + Intronic
1003273534 6:4628442-4628464 CCTCCCAGCTCCCAGGTTCAAGG + Intergenic
1003377044 6:5589041-5589063 CCCTCCATGTCCCAGCTCCACGG + Intronic
1004304608 6:14488404-14488426 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
1005237520 6:23782333-23782355 GCTTCCAGATCCCAGCTGCAAGG + Intergenic
1005307498 6:24528177-24528199 CCTCCCATCTCCCCGCTGGCTGG - Intronic
1006463734 6:34178685-34178707 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
1006506642 6:34493218-34493240 CACTCCATCCCCCAGCTGCAGGG - Intronic
1006807205 6:36796419-36796441 CTTCCCAACTCCCAGCTGCCTGG - Intronic
1007239390 6:40414114-40414136 CCTGCCAGCTCCTAGCTGGGAGG + Intronic
1007782073 6:44260139-44260161 CCGGCCAGCTGCCAGGTGCAGGG + Exonic
1009243280 6:61204418-61204440 CCTGGCAACTCCAAGCTTCAGGG - Intergenic
1012052162 6:94360668-94360690 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
1012594484 6:101023813-101023835 CCTGCCAGTTCCCAAGTGCATGG + Intergenic
1013116765 6:107109358-107109380 CCCTCCATCTCCCAGGTTCAAGG - Intronic
1013779144 6:113711069-113711091 CCTGACATCACACATCTGCAAGG + Intergenic
1014000322 6:116358088-116358110 CCTGCCTTCTTCCAGCAGCAAGG - Intronic
1014770569 6:125453977-125453999 CCTGCCATCTCCAAGATTCTGGG + Intergenic
1015096120 6:129416971-129416993 CCTGGCATCTCCAAGCTCCTGGG - Intronic
1016237950 6:141890774-141890796 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
1016758767 6:147715449-147715471 CCTGGCATCTCCAAGCTTCCAGG - Intronic
1017522251 6:155212972-155212994 CCTGGCATCTCCAAGCTTCCAGG - Intronic
1018064026 6:160113333-160113355 GCTGCCATCTCCAAGCTGAGCGG - Intronic
1018416060 6:163603051-163603073 CCCGCCATTACCCACCTGCACGG - Intergenic
1019425601 7:975235-975257 CCTGCCAGCTCCCACCTGCAGGG + Intronic
1019715884 7:2539164-2539186 CCTGCCACCTCCTACCTGCCGGG + Exonic
1019866254 7:3713037-3713059 CCTGCCATGCCCCAGCCACATGG - Intronic
1019972260 7:4550389-4550411 CCTGCCATTTCCCATCCACAGGG + Intergenic
1020586881 7:10079650-10079672 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
1021271431 7:18591726-18591748 CCTGCCATTTCTCAGCTGTCTGG + Intronic
1021677765 7:23098032-23098054 CCTGGCATCTCCAAGCTTCCGGG + Intergenic
1022216752 7:28270571-28270593 CCTGGCATCTCCAAGCTTCAGGG + Intergenic
1022584284 7:31591036-31591058 CCATGCATCTCCCAGATGCAAGG - Intronic
1022649609 7:32262470-32262492 CCTGCCACCACCCTGCTACACGG - Intronic
1023201135 7:37698148-37698170 CCTGCCATATTCCAGATGCATGG + Intronic
1023699940 7:42882923-42882945 CCTGGCATCTCCAAGCTTCCAGG - Intergenic
1023758786 7:43444713-43444735 CCTGCCCTCTCCCTGCTCCAGGG - Exonic
1024046093 7:45586762-45586784 CCTGCCACCTCCCAGGTGTCTGG - Intronic
1024354095 7:48396469-48396491 GCTTCCCTCTCCGAGCTGCATGG - Intronic
1024786377 7:52911804-52911826 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
1026695931 7:72591904-72591926 ACTTCCATCTCCCAGGTTCAAGG + Intronic
1027924917 7:84447871-84447893 CCTGCCATCTCCAAGTTTCCAGG + Intronic
1028054442 7:86225432-86225454 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
1028378821 7:90176048-90176070 CCTGGCATCTCCAAGCTTCTGGG - Intronic
1029474611 7:100775693-100775715 CCCGCCATCTCCCAGATCCCTGG + Exonic
1029703700 7:102264351-102264373 CCTTCCTTCTCACATCTGCAGGG - Intronic
1030149314 7:106387007-106387029 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
1031836551 7:126686486-126686508 CCTGACATCTCCAAGCTTCCAGG + Intronic
1031968946 7:128049668-128049690 CCTGTCACTTACCAGCTGCATGG + Intronic
1032858529 7:135857441-135857463 CCTGGCATCTCCAAGCTTCCAGG - Intergenic
1032919186 7:136526931-136526953 CCTGACATCTCCAAGCTCCCGGG - Intergenic
1033595563 7:142855774-142855796 CCTGACTCCTCCCAGCTCCAAGG - Intronic
1034057291 7:148048544-148048566 CCTGACATGCCCCAGCTCCATGG - Intronic
1034210317 7:149357579-149357601 CCTGGCATCTCCGAGCTTCCAGG - Intergenic
1034481349 7:151322217-151322239 CCTGGCATCTCCAAGCTTCTAGG + Intergenic
1034486549 7:151368399-151368421 CCTGGCTACACCCAGCTGCAAGG + Intronic
1034677596 7:152902914-152902936 CCTGGCATCACCCAGCTACCCGG - Intergenic
1035075424 7:156174487-156174509 CCTGCCCCCTCCCAGGTGCCCGG - Intergenic
1035080758 7:156214123-156214145 CCCCCCTTCTCCCTGCTGCAGGG + Intergenic
1035326264 7:158068001-158068023 CCTGCCATCTCCCAGCTGCAAGG - Intronic
1035328165 7:158078321-158078343 CCTGCCACCTGCCAGCTGCCTGG - Intronic
1035355088 7:158271763-158271785 CCTGTCATCTCACAGCAGAAGGG + Intronic
1035901491 8:3462128-3462150 CCCCCCACCTCCCAGCTGCTCGG + Intronic
1036670030 8:10777359-10777381 CTGGCCATCTCCCGGCAGCAAGG - Intronic
1036907730 8:12721064-12721086 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
1037813096 8:22098170-22098192 CCTGCCAGGCCCCAGCTGGACGG + Exonic
1038633735 8:29268979-29269001 TCTGCCACCTACCAGCTGCGTGG - Intergenic
1039414600 8:37383099-37383121 CCTGCCAGCACCCAGAGGCATGG + Intergenic
1039597354 8:38802507-38802529 CCTCCCATCTCCCCGGTCCATGG + Intronic
1039919607 8:41883985-41884007 CCTGGCATCTCCCAGTTCCCTGG - Intronic
1040075274 8:43223012-43223034 CCTGCATTGTCCCAGCAGCAAGG - Intergenic
1040752746 8:50729943-50729965 ACTCCCATCTCCCAGCTGCTCGG - Intronic
1041274500 8:56143105-56143127 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
1041357166 8:57013587-57013609 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
1041381418 8:57257951-57257973 CCTGCCCTCCTGCAGCTGCAGGG - Intergenic
1041395838 8:57390265-57390287 CCTTCCATGTTCCAACTGCATGG - Intergenic
1042004762 8:64168783-64168805 CCTGCCTCCTGCCAGCTCCATGG - Intergenic
1042005006 8:64169952-64169974 CCTGGCATCTCCAAGCTTCCTGG + Intergenic
1042012804 8:64267065-64267087 CCTGCCCTCTTCAAACTGCATGG + Intergenic
1044543198 8:93430599-93430621 CCTACCATCTCCCAGTTCCCAGG + Intergenic
1044774862 8:95677620-95677642 CCTGGCATCTCCAAGCTTCCAGG - Intergenic
1045270890 8:100660667-100660689 CCTGGCCTCTCCCAGCAGCCTGG + Intronic
1047944827 8:129865013-129865035 TCTACCTTCTCCAAGCTGCATGG - Intronic
1048529460 8:135234336-135234358 CCTGCCATCTGCCTGAGGCAGGG - Intergenic
1048678738 8:136814595-136814617 CAGATCATCTCCCAGCTGCAAGG - Intergenic
1048881500 8:138876163-138876185 CCTCCCTTTCCCCAGCTGCACGG + Intronic
1049189152 8:141277009-141277031 CCAGCAAGCTCCCAGCAGCAAGG + Intronic
1049277665 8:141728005-141728027 GCTGCCATATCCCACCAGCAGGG - Intergenic
1049309003 8:141923541-141923563 CCTGCCCTCTCCTAGCTCTAGGG - Intergenic
1049711949 8:144068781-144068803 CCTCCCAGCTCCTGGCTGCAAGG + Intergenic
1049725249 8:144142787-144142809 CCTGCCATCACCCGGAGGCAGGG + Intergenic
1049767307 8:144360851-144360873 GCAGCCAGCTCCCTGCTGCATGG + Exonic
1050269991 9:3933131-3933153 CCTCACATCTCCCAGGAGCATGG - Intronic
1051149614 9:14066208-14066230 CGTGACATCCCCCAACTGCAAGG - Intergenic
1051363626 9:16304423-16304445 CCTGCCGTCTTCCACCTCCAAGG + Intergenic
1053128301 9:35600290-35600312 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
1053280744 9:36818581-36818603 CCTGGCAGCTCGCAGCGGCAGGG - Intergenic
1053313713 9:37035367-37035389 CCTGCGACCACCCCGCTGCAGGG - Intergenic
1053402420 9:37837374-37837396 CCCTCCATCTCCCAGGTTCAAGG - Intronic
1054735364 9:68745011-68745033 CCTGCCCTCTCCCAGTTGGTGGG - Intronic
1055739980 9:79377483-79377505 CATTCCCTCCCCCAGCTGCAGGG + Intergenic
1056994353 9:91442747-91442769 CCTGGCATCTCCAAGCTTCTGGG - Intergenic
1057183209 9:93040813-93040835 CATGCCATCTCCCAGCTGTCAGG + Intergenic
1057319785 9:94001978-94002000 CCTCCCATTTCCCAGTAGCAAGG + Intergenic
1057860853 9:98639767-98639789 ACTGCCAGCTGCCAGCTCCAAGG + Intronic
1058766818 9:108189915-108189937 CCTGCCCCCTCCCTGCTGCCAGG - Intergenic
1058773987 9:108266156-108266178 CCTGCCACCTCCCAGCTACCTGG + Intergenic
1059656328 9:116360919-116360941 CCTGCCATCTCAATTCTGCATGG - Intronic
1060618891 9:125044810-125044832 CCTGGCATCTCCAAGCTTCTGGG + Intronic
1061085112 9:128393793-128393815 CCCCCTGTCTCCCAGCTGCATGG + Intergenic
1061185049 9:129048203-129048225 CCTGCCATATCCCTGCCACAGGG - Intronic
1061284986 9:129617265-129617287 CCTGACACCTCCCAACTGCTTGG - Intronic
1061342153 9:129991178-129991200 CCTAGCATCACCCAGGTGCAGGG - Intronic
1062088131 9:134659064-134659086 TCTGCCACTTCCTAGCTGCAGGG - Intronic
1062186192 9:135219928-135219950 CCTGCCATTTCCCCGCTGTGTGG - Intergenic
1062192300 9:135254283-135254305 GCTGGCATCTCCCGGCTACACGG - Intergenic
1062329217 9:136029643-136029665 CCTGGCATCTCCAAGCTTCCAGG + Intronic
1062353721 9:136152187-136152209 CCTGCCATCTCCCAACAGTGAGG + Intergenic
1062453338 9:136624634-136624656 CCGCCCAGCTCCCAGCTCCAGGG - Intergenic
1185687515 X:1941444-1941466 CCTGTCAACTCCCTGCTGGAGGG - Intergenic
1186424901 X:9456248-9456270 TCTGCTATCTGCAAGCTGCAAGG + Intergenic
1188402589 X:29765317-29765339 ACTGCATTCTCCCAGCTGCCAGG + Intronic
1189281825 X:39824562-39824584 CCTGCCCTCTCCCAGGTCCTCGG + Intergenic
1192036043 X:67564010-67564032 CCTGCCATTTGCCAGCTGTGTGG - Intronic
1193046936 X:77063838-77063860 CCTCCCTTCTCCCAGCTGTGTGG + Intergenic
1194000313 X:88420466-88420488 CCTGGCATCTCCAAGCTCCCAGG - Intergenic
1195178443 X:102333507-102333529 CCTGGCGTCTCCAAGCTTCAAGG - Intergenic
1195180421 X:102353576-102353598 CCTGGCGTCTCCAAGCTTCAAGG + Intergenic
1197342311 X:125288354-125288376 CCTGGCATCTCCAAGCTTCTGGG + Intergenic
1197378503 X:125710517-125710539 CCTGGCATCTCCAAGCTTCCAGG + Intergenic
1199614888 X:149648428-149648450 CCTGGCATCTCCAAGCTTCTAGG + Intergenic
1200127098 X:153820792-153820814 CCTGCCAGCCGCCAGATGCAGGG - Intronic
1202018110 Y:20433881-20433903 CCTGGCATCTCCAAGCCTCAAGG - Intergenic