ID: 1035326276

View in Genome Browser
Species Human (GRCh38)
Location 7:158068030-158068052
Sequence TATGGGGAAAGGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035326260_1035326276 24 Left 1035326260 7:158067983-158068005 CCTGTGGGGTGGCATGGACCTTG 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1035326276 7:158068030-158068052 TATGGGGAAAGGAGGGAGGAAGG No data
1035326264_1035326276 6 Left 1035326264 7:158068001-158068023 CCTTGCAGCTGGGAGATGGCAGG 0: 1
1: 0
2: 7
3: 70
4: 586
Right 1035326276 7:158068030-158068052 TATGGGGAAAGGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035326276 Original CRISPR TATGGGGAAAGGAGGGAGGA AGG Intronic
No off target data available for this crispr