ID: 1035327532

View in Genome Browser
Species Human (GRCh38)
Location 7:158074664-158074686
Sequence TAGAATTCATACCCTGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035327532_1035327535 5 Left 1035327532 7:158074664-158074686 CCCTGATCAGGGTATGAATTCTA 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1035327535 7:158074692-158074714 ACGTGAAAGTGAGGATGAAATGG 0: 1
1: 0
2: 0
3: 22
4: 270
1035327532_1035327534 -4 Left 1035327532 7:158074664-158074686 CCCTGATCAGGGTATGAATTCTA 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1035327534 7:158074683-158074705 TCTAAATGAACGTGAAAGTGAGG 0: 1
1: 0
2: 2
3: 12
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035327532 Original CRISPR TAGAATTCATACCCTGATCA GGG (reversed) Intronic
901482442 1:9534648-9534670 AATGTTTCATACCCTGATCAGGG - Intergenic
903600793 1:24537950-24537972 TAGAAATCATAACCTCTTCATGG + Exonic
906271870 1:44485643-44485665 TAGAATTAAAACCCAGAGCATGG - Intronic
916997197 1:170313770-170313792 TAGAATTCATAGTCTGTTGAGGG - Intergenic
917258700 1:173143791-173143813 TAAAAATCATCCCCTGCTCATGG - Intergenic
923444654 1:234058079-234058101 TTGCATACATACCCTTATCAGGG + Intronic
1066343404 10:34558456-34558478 TAGAACTCATTCCCCAATCATGG - Intronic
1075410796 10:122226471-122226493 TGGAAGTCATACCCTGAACACGG - Exonic
1077889279 11:6406970-6406992 TTGAATTCATACTCTGCTCCAGG - Intronic
1079135315 11:17773151-17773173 TAGAATTCCTGCCCTGATTTCGG + Intronic
1080947974 11:36996339-36996361 TATAATTCATACCTTGGTAAAGG + Intergenic
1081828119 11:46078685-46078707 TAAAATTCTTACCCTGAACATGG + Intronic
1085852191 11:80134244-80134266 TGGAATTCCTACCCAGAGCAAGG - Intergenic
1087295958 11:96374188-96374210 TAGAATACATGCCCTGCTCAGGG + Intronic
1088102087 11:106166823-106166845 TAGATTTCAGACCTGGATCATGG - Intergenic
1090427771 11:126621089-126621111 TAGAATTTAAACCCTGATGAAGG - Intronic
1090696649 11:129250912-129250934 TAGAATTCATACACTGCTTATGG - Intronic
1094674569 12:32606707-32606729 CTGAATTCACACCATGATCAGGG - Intronic
1096072758 12:48784547-48784569 AAGAGTTCATACCCTGTGCATGG + Intronic
1096504223 12:52082490-52082512 TGGAATTCTGACCCTGGTCAAGG + Intergenic
1097912237 12:64982663-64982685 TAGAATTCTTACCTTGATTAGGG - Intergenic
1098376565 12:69821793-69821815 TGGAGTGCATACCCTGAGCAAGG - Exonic
1099615038 12:84923421-84923443 GAGTGTTCCTACCCTGATCAAGG + Intergenic
1102643934 12:114391232-114391254 TTGAATTGATAACATGATCAGGG + Intronic
1107279137 13:38713419-38713441 TATAATGCATACTCTTATCATGG + Intronic
1109301641 13:60595481-60595503 AAGAATTCATACCCTTTGCAGGG - Intergenic
1111118797 13:83819068-83819090 TAGCAATCGTAACCTGATCAGGG - Intergenic
1111662978 13:91234500-91234522 GAGCATTCATTCCCTGATCAAGG + Intergenic
1116107229 14:40525528-40525550 TGGAATTCACACTCTGACCAGGG - Intergenic
1118073733 14:62275692-62275714 TAAAATTCATATCCTGATAATGG - Intergenic
1119485284 14:74982733-74982755 TGGATTTCCTACCCTGCTCATGG + Intergenic
1127232682 15:57014281-57014303 TAGAAGGCATACCATCATCAGGG - Intronic
1129980142 15:79861560-79861582 TAGAATTCATAGCCATTTCATGG + Intronic
1131359221 15:91774717-91774739 TGGACTTCATACCCAGAGCATGG - Intergenic
1131368364 15:91858830-91858852 GAGAATACAGTCCCTGATCAAGG - Intronic
1131722671 15:95187878-95187900 TTGAATTCCTACCCTGAAAATGG - Intergenic
1135754563 16:25086273-25086295 TAGAATTCACACCCAGCTCTCGG - Intergenic
1137246143 16:46706817-46706839 TGCAATTCAAACCCTGTTCAAGG + Intergenic
1139212624 16:65094725-65094747 TAGGATTAATGCCCTTATCAAGG + Intronic
1148220567 17:45858814-45858836 TAAAATTCAGACTCTGATCCGGG - Intergenic
1149958566 17:61081036-61081058 AAGAATTGACTCCCTGATCATGG - Intronic
1150499967 17:65641395-65641417 TGGAGTTCACATCCTGATCAAGG - Intronic
1153149524 18:2075186-2075208 TAGATTTCATTGCCTGATTAAGG - Intergenic
1155798724 18:30073619-30073641 TTGAATTCCTCCCCTGAGCATGG - Intergenic
1156778379 18:40821445-40821467 AAGAATTCACACCCTAATGATGG - Intergenic
1157611066 18:48955945-48955967 TAGTAATCAAACCCTAATCATGG + Intergenic
1159552219 18:69906996-69907018 GAGAATGCACACACTGATCAAGG + Intronic
1161804722 19:6436228-6436250 TATACTTCAAACACTGATCACGG - Intronic
1161877755 19:6925069-6925091 TATAATTCATAACACGATCAGGG - Intronic
1165661305 19:37582729-37582751 TAGAATTAATACCTTCATAATGG - Intronic
1166499507 19:43330391-43330413 TTGAATTCCTCCCCTGAACATGG + Intergenic
1168472890 19:56654096-56654118 CAGAGTTCATACCCTGTTCCAGG + Intronic
927821248 2:26267193-26267215 TAGAGTTCATACCCAGATCTTGG + Intronic
933004493 2:76973201-76973223 TAGAAGTCATATTCTAATCATGG - Intronic
935269286 2:101419783-101419805 TAGAATGAATGCCCTGATAACGG - Intronic
936653451 2:114456432-114456454 TAATATTCTTACCCTGATCCTGG - Intronic
939998432 2:148942510-148942532 TAGAATTCAAGCCCTGGGCAAGG + Intronic
942422197 2:175819874-175819896 TAGAATACTTTCCCTGGTCATGG + Intergenic
942480502 2:176382656-176382678 TATAATTCATTTCCAGATCATGG - Intergenic
1170148536 20:13204391-13204413 TAGAATTCTTCCCCTGGGCATGG + Intergenic
1173710561 20:45151959-45151981 AAGAATTCACAGCATGATCAGGG - Intergenic
1175428422 20:58886185-58886207 CAGAATTCAAACCCTGATGTGGG + Intronic
1181170186 22:21003945-21003967 AAGGGTTCGTACCCTGATCAGGG + Intergenic
1184542468 22:45136343-45136365 TATAATTCTTACTCTGAGCAGGG + Intergenic
949908061 3:8875317-8875339 TAAAAGTCATAACCTGGTCAGGG - Intronic
952064513 3:29552361-29552383 TAAAATACATACCCTGACTATGG - Intronic
952548166 3:34445574-34445596 AAGAATTAATACCATGAACATGG - Intergenic
954267790 3:49483594-49483616 TAGAATCCAGTCCCTGCTCAAGG - Intronic
955872702 3:63456324-63456346 TAGAATTCACACTCCGAGCAAGG + Intronic
965048454 3:163611839-163611861 TAGTATTCATATCCTGGTCTAGG + Intergenic
971513509 4:27457494-27457516 TAGAAATCAAACCCTCAACAAGG - Intergenic
972549683 4:40118589-40118611 GAGAATTCATAGCATAATCACGG - Intronic
973297738 4:48544263-48544285 TAAACATCATACCCTGCTCAGGG - Intronic
981181935 4:141756138-141756160 TAGGCATCATACCCTGATCTTGG + Intergenic
984958050 4:185065566-185065588 GAGAATTCATATCCTCAGCAAGG - Intergenic
987176683 5:15318737-15318759 AAGAATTAATTGCCTGATCATGG + Intergenic
988289096 5:29261739-29261761 TACATTGCATACCCTGATAAGGG + Intergenic
988483063 5:31645795-31645817 TAGTATTCCTACCGTGAGCAGGG + Intronic
989405106 5:41051635-41051657 TGGAATTCATGCCCTCATGAAGG + Intronic
990829098 5:59936404-59936426 TAAAATTCAGATGCTGATCAGGG - Intronic
993103300 5:83568051-83568073 TAGAATTGATTCCCTGAGAAGGG + Intronic
993153787 5:84195760-84195782 TAGAATTCCTACTGTGGTCATGG - Intronic
997407681 5:133664906-133664928 TTGATTTCATATCCTAATCAAGG - Intergenic
1002003014 5:176208769-176208791 TTGAATTCATCCCCTGAAAAGGG + Intergenic
1002223499 5:177702486-177702508 TTGAATTCATCCCCTGAAAATGG - Intergenic
1005002036 6:21251274-21251296 CAGAATTTATGCTCTGATCAGGG + Intergenic
1007888940 6:45267271-45267293 TAAAATTCATGCCCTAATTAAGG + Intronic
1008425758 6:51354115-51354137 CAGAATTCATACTCTAACCATGG + Intergenic
1009345605 6:62610223-62610245 TTGAATTCATACCCAGAAGATGG + Intergenic
1010041282 6:71387886-71387908 TAAAATTCATAGCCTACTCAAGG - Intergenic
1010630545 6:78192337-78192359 TTGAATTCCTCCCCTGATAATGG + Intergenic
1013461404 6:110378341-110378363 AAGAATTCATACACTTATTATGG - Intergenic
1014167128 6:118238138-118238160 TAAAGTTAATACCCTGCTCAAGG + Intronic
1014980439 6:127940113-127940135 TAAAATTCATATGCTGCTCAGGG + Intergenic
1016117863 6:140310906-140310928 TATAATTTATATCCTGACCAAGG + Intergenic
1019038791 6:169085328-169085350 CTGAATTCATACCCTGAACTGGG + Intergenic
1021496814 7:21284068-21284090 TAGAATTCATAAGATTATCAGGG + Intergenic
1022366275 7:29721513-29721535 TAGAATCCATGTCCTGATCTTGG - Intergenic
1022931470 7:35120513-35120535 TAGAATCCATGTCCTGATCTTGG + Intergenic
1023163037 7:37316447-37316469 TAGAATTCTTCCCCTGATGATGG + Intronic
1028706721 7:93857234-93857256 TAGAATTCTTACACTGCTAATGG + Intronic
1029827361 7:103213019-103213041 TAGAATCCATGTCCTGATCTTGG + Intergenic
1032433493 7:131881778-131881800 TAGAATTCACACACTGAAGATGG + Intergenic
1033318034 7:140314687-140314709 TAGAAATCAAACACAGATCAGGG + Intronic
1035327532 7:158074664-158074686 TAGAATTCATACCCTGATCAGGG - Intronic
1036581947 8:10082854-10082876 TTGAATTCCTACTCTGTTCACGG - Intronic
1039830194 8:41207251-41207273 TGGAAATCCTACCCTGTTCAAGG + Intergenic
1042427662 8:68667523-68667545 TTGAATTCCTACCCTGTGCAAGG + Intronic
1043251862 8:78084895-78084917 TATAATTATTACCCTGATCTAGG + Intergenic
1043539824 8:81248260-81248282 AAGAATTCATTGCCTAATCACGG - Intergenic
1043604369 8:81982497-81982519 TAGAATTAATCTCTTGATCAGGG + Intergenic
1046248384 8:111596301-111596323 TGGAATTCAAACCCTGATTATGG + Intergenic
1046878236 8:119279011-119279033 TTGAATTCATTCCCTGAAAATGG + Intergenic
1047075385 8:121395981-121396003 TAGAATTTAAACCCCGATCTTGG - Intergenic
1049153565 8:141052858-141052880 TATAATTCATAACATAATCATGG - Intergenic
1055335209 9:75226684-75226706 TTGAATTCCTACCCTGAAAATGG + Intergenic
1055395665 9:75871607-75871629 TAGTATTCACACCATGAACACGG - Intergenic
1057615462 9:96585644-96585666 TAGAATTCATACATTGCTAATGG + Intronic
1060517463 9:124274993-124275015 TACAATTCTTAACCTGAGCAGGG + Intronic
1062012660 9:134275385-134275407 GAGAACTCCTACCCTGGTCAGGG + Intergenic
1062687817 9:137824832-137824854 TAGAATTCATACATTTAACAAGG - Intronic
1186612805 X:11154783-11154805 TAGATTTCTAACCCTCATCAAGG - Intronic
1196303909 X:114078325-114078347 TAGAAATCATACCCTTGGCATGG - Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1199680542 X:150221503-150221525 GAGGATTCATATCCAGATCACGG + Intergenic