ID: 1035327559

View in Genome Browser
Species Human (GRCh38)
Location 7:158074798-158074820
Sequence ACGAGCAATGCTGATCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035327559_1035327561 14 Left 1035327559 7:158074798-158074820 CCAGCAGGATCAGCATTGCTCGT 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1035327561 7:158074835-158074857 GAACGAGCTGCTCCCATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035327559 Original CRISPR ACGAGCAATGCTGATCCTGC TGG (reversed) Intronic
904864476 1:33567614-33567636 CCGACCAGTGATGATCCTGCTGG + Exonic
914668101 1:149849322-149849344 TCAAGTAATGCTGATGCTGCTGG + Intronic
920850302 1:209623839-209623861 ATAAGCAGTGCTGATCCTTCAGG - Exonic
921856275 1:219988681-219988703 ACCAGAAATTCTGAACCTGCTGG - Exonic
1071990333 10:91095154-91095176 ACAGGTAATGCTGATGCTGCTGG - Intergenic
1072096024 10:92180786-92180808 CCAAGCAATGCTGATGCTGCTGG + Intronic
1072742948 10:97921199-97921221 TCTAGCAATGCTGCTGCTGCTGG + Intronic
1075070664 10:119318025-119318047 CCCAGCGATGCTGATGCTGCTGG + Intronic
1075200253 10:120396379-120396401 ACAAGCCATGCTGCTGCTGCTGG + Intergenic
1079414223 11:20218066-20218088 ATGAGAAATGCTGAGCATGCTGG - Intergenic
1086395373 11:86409982-86410004 CCAGGCAATGCTGATACTGCTGG - Intronic
1087142104 11:94774716-94774738 CCAAGCAATGCTGATGCTGCTGG + Intronic
1088723706 11:112616647-112616669 ACGCCCAATCCTGGTCCTGCTGG + Intergenic
1089191620 11:116658084-116658106 AAGAGCAGTGCTGACCCTGTAGG - Intergenic
1091806261 12:3358361-3358383 ACAAGCAATGTTGATGCTGCTGG + Intergenic
1094160556 12:27385395-27385417 ATTAGCAATGCTGCTGCTGCTGG - Intronic
1096678857 12:53241800-53241822 CTGAGCCTTGCTGATCCTGCAGG - Intergenic
1099449503 12:82791681-82791703 ACCAACAATGTTGATGCTGCTGG - Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1106885376 13:34179096-34179118 ATGAGTAATGCTCTTCCTGCTGG + Intergenic
1107645723 13:42492504-42492526 CCAAGCAATGCTGTTGCTGCTGG - Intergenic
1108818875 13:54321484-54321506 ACTAGCAATGCTGATGTTCCAGG - Intergenic
1119449437 14:74695933-74695955 ACAGGTAATGCTGATGCTGCTGG + Intronic
1121335521 14:93075604-93075626 GCCTGCAATGCTGAACCTGCAGG + Intronic
1125519427 15:40339810-40339832 AGGCGCATTGCTGAGCCTGCAGG + Intronic
1127576847 15:60299976-60299998 GCCAGAAATGCTGAGCCTGCAGG - Intergenic
1130380479 15:83367925-83367947 CCCAGAAATGCTGATGCTGCTGG + Intergenic
1132320956 15:100924767-100924789 ACCTGCCATGCTCATCCTGCAGG + Intronic
1133312537 16:4859389-4859411 ACGACCCCTGCTGAGCCTGCTGG - Intronic
1133551702 16:6862321-6862343 ACAGGCGATGCTGATCGTGCAGG + Intronic
1135941000 16:26821876-26821898 CTGAGTAATGCTGATGCTGCTGG + Intergenic
1140803170 16:78507656-78507678 AGGTGCAATGCTGATCTGGCTGG - Intronic
1141908194 16:87041391-87041413 ACGAGCCAGGCAGGTCCTGCGGG - Intergenic
1145107840 17:20134781-20134803 ATGAGAAATGCTGTCCCTGCAGG + Intronic
1149189504 17:54042562-54042584 TCCAGCAATGCTGATGCTGCCGG + Intergenic
1152283333 17:79398172-79398194 GAGAGCAGTCCTGATCCTGCTGG + Intronic
1154336682 18:13471563-13471585 GAGAGTAATGCTGATGCTGCTGG + Intronic
1155868791 18:30999565-30999587 AAAAGCAATGCTGAGCCTACAGG + Intronic
1155977518 18:32146536-32146558 CCAAGTAATGCTGATGCTGCTGG - Intronic
1157212243 18:45753594-45753616 ATCAGCAATGCAGATCCTGAAGG + Intergenic
1157932585 18:51839749-51839771 TCCAACAATGCTGATGCTGCTGG - Intergenic
1158561349 18:58516443-58516465 AAGACCAATGCTGACCCTTCTGG + Intronic
1158973791 18:62692415-62692437 ATCACCAATGCTGCTCCTGCAGG - Intergenic
1158973806 18:62692493-62692515 ATCACCAATGCTGCTCCTGCAGG - Intergenic
1160950352 19:1663980-1664002 CCGGGCAGTGCGGATCCTGCAGG - Intergenic
926212875 2:10884195-10884217 TCAAGCAATGATGATCCTGTTGG - Intergenic
934129571 2:88935109-88935131 ATGAGAAATGCTGATTCTTCTGG - Intergenic
936974736 2:118207756-118207778 CAGAGCAATGCAGATACTGCTGG + Intergenic
938219333 2:129551986-129552008 ACTAGCAAAGGTGAACCTGCAGG + Intergenic
942577053 2:177374798-177374820 CCCAGCAATGCTGATGTTGCTGG + Intronic
945946627 2:216001473-216001495 ACGAGCAGGTCAGATCCTGCTGG - Intronic
948628098 2:239283115-239283137 AGGAGCAATGCTGAGGCTGAGGG + Intronic
1169672821 20:8122799-8122821 CCAAGCAATGTTGATGCTGCTGG + Intergenic
1175671403 20:60906107-60906129 AAGAGAAATGATGATGCTGCTGG + Intergenic
1175877146 20:62235748-62235770 CTGAGAAATGCTCATCCTGCAGG - Intronic
1178930536 21:36814806-36814828 CCAGGCAATGCTGATACTGCTGG + Intronic
1179407279 21:41136451-41136473 ACAAGCACTTCTGAGCCTGCAGG - Intergenic
1181856785 22:25787401-25787423 CACAGCAATGCTGATGCTGCTGG + Intronic
949409927 3:3752738-3752760 ATTAGCAATGCTAATCCTGGAGG - Intronic
949713219 3:6896532-6896554 AGGTGCAATGCTTACCCTGCAGG - Intronic
950010097 3:9716886-9716908 CCAAGTAATGCTGATGCTGCTGG - Intronic
950796053 3:15511550-15511572 CCAACCAATGCTGCTCCTGCAGG + Intronic
950899422 3:16483820-16483842 CCAGGCAATGCTGATGCTGCTGG - Intronic
951740965 3:25923007-25923029 TCCAGTAATGCTGATTCTGCTGG - Intergenic
958579512 3:96000020-96000042 TCGAGAAAGGCTGCTCCTGCCGG + Intergenic
962207606 3:133447752-133447774 CCCAGGGATGCTGATCCTGCTGG + Intronic
962971174 3:140403473-140403495 CCAGGCAATGCTGATGCTGCTGG + Intronic
965185526 3:165457286-165457308 ACTAGGAATGCTCATCCTTCTGG + Intergenic
968389224 4:175215-175237 ATGAGGACTGCTGATCCTGCGGG - Intergenic
974023158 4:56709455-56709477 AAGAGGAAAGCTGATCCAGCCGG + Intergenic
976732187 4:88274151-88274173 ACGAGCAATGCTGCTTCAGTAGG + Intronic
978966110 4:114743765-114743787 AGGAGCAATGCTGTGGCTGCTGG + Intergenic
979580401 4:122352078-122352100 CCAGGCAATGCTGATTCTGCTGG + Intronic
983605810 4:169582311-169582333 CCAGGTAATGCTGATCCTGCTGG - Intronic
987025336 5:13921284-13921306 CCCAGGAATGCTGATCCTGCTGG - Intronic
989112366 5:37918841-37918863 AATAGCACTGCTGATCTTGCAGG + Intergenic
990047632 5:51453888-51453910 ACAGGCAATGCTGATGTTGCTGG - Intergenic
991035609 5:62124562-62124584 CTGAGCAATGGTGATGCTGCGGG - Intergenic
998405007 5:141869321-141869343 GCTAGCACTGCTGCTCCTGCTGG - Exonic
999592882 5:153168074-153168096 CCAAGCAATGCCGATCCTGCTGG + Intergenic
1007212707 6:40208349-40208371 CTGAGCGATGCTGATGCTGCTGG - Intergenic
1013119642 6:107130090-107130112 ACGAAGAGTTCTGATCCTGCTGG + Intergenic
1014677740 6:124388432-124388454 ACTGGTAATGCTGATGCTGCTGG + Intronic
1016521712 6:144953899-144953921 CCCAGCAATGCTGAGGCTGCTGG - Intergenic
1016581633 6:145634609-145634631 ACGAGGAAAGATGATCCTGCAGG - Intronic
1019092901 6:169554381-169554403 ACGAGCAAAGCTGCCCCTGTCGG + Intronic
1020292040 7:6729850-6729872 ACGAGAATCGCTGAGCCTGCGGG + Intergenic
1021054021 7:16024679-16024701 CCAGGCAATGCTGATGCTGCTGG + Intergenic
1024623578 7:51185209-51185231 CCCAGCGATGCTGATGCTGCAGG - Intronic
1028144083 7:87302750-87302772 CCAAGCAATGCTGATGCTGCAGG - Intergenic
1028525950 7:91786889-91786911 GAGAGAAATGCTGTTCCTGCAGG - Intronic
1030188762 7:106790214-106790236 ACACGCACTGCTGCTCCTGCAGG + Intergenic
1035327559 7:158074798-158074820 ACGAGCAATGCTGATCCTGCTGG - Intronic
1035674891 8:1449616-1449638 ACGGGCAATGCTGAGGCTGAGGG + Intergenic
1037000182 8:13707914-13707936 ACGAGCCATGATGACCCAGCAGG + Intergenic
1038951224 8:32416521-32416543 TCAAGTAATGCTGATTCTGCTGG - Intronic
1043756036 8:84005390-84005412 ACGAGCCAAGCACATCCTGCCGG - Intergenic
1047570041 8:126087809-126087831 CCAGGCAATGCTGATGCTGCTGG - Intergenic
1049950207 9:636337-636359 ATTAGCACTGCTGATCATGCAGG + Intronic
1050280037 9:4040886-4040908 CCAAGCAGTGCTGATGCTGCTGG - Intronic
1055564792 9:77557352-77557374 ACGAGCAATTATGATCCAGTGGG + Intronic
1056905757 9:90646243-90646265 ACCAGAATTGCTGATACTGCTGG - Intergenic
1062070632 9:134553359-134553381 CCGAGCAATGCTGTGCCTACAGG - Intergenic
1186551411 X:10509640-10509662 ACTAGCATTACTGATCCTCCAGG + Intronic
1186845889 X:13530719-13530741 ATTAGCAATGCAAATCCTGCTGG + Intergenic
1187420684 X:19131067-19131089 TTGAGCAATGCTGATGCTGCTGG + Intergenic
1196963945 X:121035099-121035121 TCAGGCAATGCTGATGCTGCTGG - Intergenic
1198090699 X:133326349-133326371 CCAAGTGATGCTGATCCTGCTGG - Intronic
1198562064 X:137861141-137861163 ACCAGTGATGCTGATGCTGCTGG + Intergenic
1200276545 X:154738249-154738271 ATGAGCAATGATGGTCCTGGAGG + Intronic