ID: 1035328066

View in Genome Browser
Species Human (GRCh38)
Location 7:158077596-158077618
Sequence CACCCTCCGTGGCGCCCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035328052_1035328066 25 Left 1035328052 7:158077548-158077570 CCCCCTATGAGCCACACCCCCAC 0: 1
1: 0
2: 0
3: 13
4: 207
Right 1035328066 7:158077596-158077618 CACCCTCCGTGGCGCCCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
1035328063_1035328066 3 Left 1035328063 7:158077570-158077592 CCACACAGGGCTGAGTGCCAGAG 0: 1
1: 0
2: 3
3: 31
4: 300
Right 1035328066 7:158077596-158077618 CACCCTCCGTGGCGCCCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
1035328061_1035328066 7 Left 1035328061 7:158077566-158077588 CCCACCACACAGGGCTGAGTGCC 0: 1
1: 1
2: 1
3: 33
4: 243
Right 1035328066 7:158077596-158077618 CACCCTCCGTGGCGCCCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
1035328062_1035328066 6 Left 1035328062 7:158077567-158077589 CCACCACACAGGGCTGAGTGCCA 0: 1
1: 0
2: 4
3: 26
4: 259
Right 1035328066 7:158077596-158077618 CACCCTCCGTGGCGCCCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
1035328053_1035328066 24 Left 1035328053 7:158077549-158077571 CCCCTATGAGCCACACCCCCACC 0: 1
1: 0
2: 3
3: 31
4: 284
Right 1035328066 7:158077596-158077618 CACCCTCCGTGGCGCCCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
1035328055_1035328066 22 Left 1035328055 7:158077551-158077573 CCTATGAGCCACACCCCCACCAC 0: 1
1: 0
2: 1
3: 44
4: 443
Right 1035328066 7:158077596-158077618 CACCCTCCGTGGCGCCCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
1035328054_1035328066 23 Left 1035328054 7:158077550-158077572 CCCTATGAGCCACACCCCCACCA 0: 1
1: 0
2: 2
3: 26
4: 222
Right 1035328066 7:158077596-158077618 CACCCTCCGTGGCGCCCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
1035328060_1035328066 8 Left 1035328060 7:158077565-158077587 CCCCACCACACAGGGCTGAGTGC 0: 1
1: 0
2: 2
3: 32
4: 237
Right 1035328066 7:158077596-158077618 CACCCTCCGTGGCGCCCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
1035328059_1035328066 9 Left 1035328059 7:158077564-158077586 CCCCCACCACACAGGGCTGAGTG 0: 1
1: 0
2: 4
3: 72
4: 1451
Right 1035328066 7:158077596-158077618 CACCCTCCGTGGCGCCCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
1035328058_1035328066 14 Left 1035328058 7:158077559-158077581 CCACACCCCCACCACACAGGGCT 0: 1
1: 1
2: 10
3: 113
4: 854
Right 1035328066 7:158077596-158077618 CACCCTCCGTGGCGCCCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035328066 Original CRISPR CACCCTCCGTGGCGCCCGAG AGG Intronic
900358302 1:2275263-2275285 GAGCCGCCGTGGCGCCTGAGCGG - Intronic
904688180 1:32275304-32275326 CCACCTCCGTGGCGCAGGAGCGG + Exonic
906640400 1:47437863-47437885 CTCCTTCCGTTGCGCCCCAGCGG + Exonic
912625991 1:111204620-111204642 CACCCTCCGTGGGGCTCCCGGGG + Intronic
915934252 1:160081603-160081625 CACCCTTCGGGGGGCCCGTGGGG + Exonic
923684792 1:236146534-236146556 CACCCTCCCTGGTGACCCAGAGG + Intronic
1064354312 10:14604049-14604071 CACCCCGCGCGGCGCCCGGGAGG - Intronic
1064423470 10:15210105-15210127 CACCCTCCGTGGGGAGAGAGAGG + Intergenic
1067082465 10:43219360-43219382 CCTCCTCCGTGGCACCCTAGGGG - Intronic
1069651614 10:70053464-70053486 CACCTTCAGAGGCCCCCGAGCGG - Intronic
1075235360 10:120722966-120722988 CACCCTCCATGGCTCCCAAGGGG + Intergenic
1076876517 10:133218961-133218983 CCCCCGCCTTGGGGCCCGAGGGG - Intronic
1078066247 11:8081212-8081234 CTCCCGCCTTGGCGCCAGAGGGG + Intronic
1082814625 11:57499806-57499828 GACCCTCCCTGGCGGCCGGGTGG - Intronic
1084640896 11:70425025-70425047 CACCCTCCGTCGCCACCCAGAGG - Intronic
1089312733 11:117570765-117570787 GACCCTCAGTGGCCCCTGAGTGG - Intronic
1096148628 12:49295374-49295396 CAGCTTCCGTAGCCCCCGAGCGG + Exonic
1096220962 12:49828042-49828064 CACACTCCGTGGCCCCGGAAGGG - Intronic
1113693034 13:112325513-112325535 CACCCTCCCTGGCTGCCGCGTGG - Intergenic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1123676512 15:22714870-22714892 CAGCCGCTGTGGCGCCCGGGCGG - Intergenic
1136292774 16:29285724-29285746 CACACACCGTGGCCCCCAAGCGG + Intergenic
1142098662 16:88259728-88259750 CACACACCGTGGCCCCCAAGCGG + Intergenic
1142150334 16:88509868-88509890 CCCCCTCCGTGACGCGCGTGTGG - Intronic
1142239539 16:88938950-88938972 CACCCTCCCTGCCACCCCAGAGG + Intronic
1142856638 17:2734261-2734283 CAGCCTCCGAGGCTCCCCAGAGG - Intergenic
1144816615 17:18039638-18039660 CACCCTCCTCGGCTCCCGCGCGG + Exonic
1144890440 17:18491137-18491159 CACCCTCCGTGGGGTCTGTGGGG + Intronic
1145141777 17:20453181-20453203 CACCCTCCGTGGGGTCTGTGGGG - Intronic
1146459375 17:33033529-33033551 CACCCTCAGTGGCCCCAGAAGGG + Intronic
1149545795 17:57502835-57502857 CACCCTCCATGGCCCCCAAGTGG + Intronic
1151497238 17:74466263-74466285 CACCCTCGGTGGTGCCCACGAGG - Intergenic
1157842037 18:50967949-50967971 CGCGCTCGGTGGCGCCCGCGCGG - Intergenic
1159458433 18:68693266-68693288 CACGCTCCGTGGAGCCAGCGGGG + Intronic
1161080476 19:2307826-2307848 CCCGCTCCTTGGCGCCCCAGAGG + Intronic
1162028102 19:7905488-7905510 CGCCCTCCCTGGCCCCTGAGTGG + Intronic
1163866316 19:19776349-19776371 CACTCTCCCTGGCGACCGGGCGG + Intergenic
1164181385 19:22821862-22821884 CACCCGCCTTGGCCCCCCAGAGG - Intergenic
1164499968 19:28810478-28810500 CACCCTCCCTGGCCTCCCAGAGG - Intergenic
1164934000 19:32197190-32197212 CACCCTACCTGGGGCCAGAGGGG - Intergenic
1165442721 19:35839540-35839562 CACACTCCGTGGGGCTGGAGTGG - Exonic
925331167 2:3059890-3059912 CACCCTCCGCGGAGGCCAAGGGG + Intergenic
934655750 2:96116241-96116263 CGCCCTCGGCGCCGCCCGAGGGG - Exonic
1169914861 20:10674315-10674337 CACGGCCCGGGGCGCCCGAGGGG - Intergenic
1171567556 20:26208926-26208948 CGCCCCTCGTGGGGCCCGAGGGG + Intergenic
1179658014 21:42857398-42857420 CACCCAGGGTGGGGCCCGAGGGG - Intronic
1184982211 22:48102713-48102735 CACACTCCATGGCGCCCAGGTGG + Intergenic
953334699 3:42084554-42084576 CACCCCCAGTGGGGCCCAAGGGG - Intronic
954459359 3:50617553-50617575 CACCATCCATGGCCCCCGCGGGG - Exonic
955060586 3:55488812-55488834 CAGTCTCCGTGGAGCCCCAGTGG - Intronic
966734614 3:183179220-183179242 CCTCCTCCGAGGAGCCCGAGGGG - Exonic
969627098 4:8311201-8311223 CACCCTCCATGGCTCCTTAGAGG + Intergenic
979919340 4:126478739-126478761 CACCCTCTCTGGGGCCCCAGAGG + Intergenic
991215933 5:64157429-64157451 CCCCCTCCGTGGGGCCCCAGAGG + Intergenic
994240100 5:97408668-97408690 CACACTCCGTGGAGCCAGTGGGG - Intergenic
994732378 5:103507871-103507893 CACCCACCATGGTGCCAGAGGGG + Intergenic
998261177 5:140633015-140633037 CAACCCCTGTGGCTCCCGAGTGG + Intronic
1029444434 7:100604536-100604558 CTCCCTCCGTCGGGCGCGAGGGG + Intronic
1035328066 7:158077596-158077618 CACCCTCCGTGGCGCCCGAGAGG + Intronic
1035609180 8:948858-948880 CACCAGCCCTGGCTCCCGAGTGG - Intergenic
1036454170 8:8893325-8893347 CATCCTCCGCGGCGCGCGGGCGG - Exonic
1037989967 8:23314899-23314921 GACCCTCCGTGGTGCCGCAGGGG - Intronic
1049493602 8:142917736-142917758 CACCGTCCTAGGGGCCCGAGCGG + Exonic
1060191766 9:121598462-121598484 CACCCTCCGCGGCACCTGTGGGG - Intronic
1060826921 9:126693010-126693032 CACCTGCCGTGGCTCCCCAGTGG - Intronic
1061773263 9:132944279-132944301 GCCCCTCCTTGGCCCCCGAGGGG - Intronic
1192307038 X:69972331-69972353 CACCCTCCCTGGAGCCCTTGGGG + Intronic
1192848086 X:74925836-74925858 CGCGCTCCCGGGCGCCCGAGGGG - Intergenic
1198683383 X:139204466-139204488 CAACCCCCGGGGCGGCCGAGAGG + Intronic
1201964412 Y:19715989-19716011 CAGCCTCCGTGACGCCCTGGGGG + Exonic