ID: 1035328097

View in Genome Browser
Species Human (GRCh38)
Location 7:158077723-158077745
Sequence AGTCTGCAGAGACCCTCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035328097_1035328101 9 Left 1035328097 7:158077723-158077745 CCGGGTGAGGGTCTCTGCAGACT 0: 1
1: 0
2: 1
3: 13
4: 161
Right 1035328101 7:158077755-158077777 CAAAAGCAAACAGTTTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035328097 Original CRISPR AGTCTGCAGAGACCCTCACC CGG (reversed) Intronic
900522545 1:3112724-3112746 AGCTGGCAGAAACCCTCACCGGG - Intronic
900707388 1:4089179-4089201 AGGCAGCAGGGACCCTCCCCAGG - Intergenic
900804652 1:4759540-4759562 ACTCTGCAGTGACCATAACCAGG + Intronic
902422642 1:16293520-16293542 AGTCTGCAGATGGCCACACCAGG - Intronic
902799462 1:18820216-18820238 AGTGCGCAGAGACCCTGGCCCGG - Intergenic
903116722 1:21184365-21184387 TGTCTGCAGAGACTGTCAACAGG + Intergenic
903210411 1:21814895-21814917 TGTCGGCAGCGGCCCTCACCGGG - Intronic
903216445 1:21846089-21846111 CCACTGCAGGGACCCTCACCGGG + Exonic
904887549 1:33752443-33752465 AGCCTCCTGAGACCCTCACCAGG + Intronic
905753798 1:40489760-40489782 AGTTTCCTGAGGCCCTCACCAGG - Intronic
906217410 1:44051425-44051447 ATCCTGAAGAGACCTTCACCTGG + Intergenic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
910832319 1:91473442-91473464 AGTCTGCAGAAACCCTGGCTAGG + Intergenic
915545943 1:156597865-156597887 AGACTGCCCAGACCCTCAGCAGG - Intronic
918738870 1:188102381-188102403 AGCCTGCAGAGACCCTAAGTGGG + Intergenic
919769976 1:201151875-201151897 AGTATGCAGAGACCCTGCCTGGG + Intronic
920079018 1:203358683-203358705 CGTCTGCAGAGATTCTGACCTGG - Intergenic
921283202 1:213587005-213587027 AGTCTCCAAAAACCCTCACTTGG - Intergenic
922804619 1:228378824-228378846 CGTCTGCAGCGACCCCCAGCGGG - Exonic
1063193048 10:3716073-3716095 AGCCTGCAGACACCCTGAGCTGG + Intergenic
1071520589 10:86329534-86329556 AGTGTGCAGACTCCCTCAGCTGG + Intronic
1072368217 10:94736235-94736257 AATCTCCAGAAATCCTCACCAGG + Intronic
1073456630 10:103640749-103640771 AGTGTGCAGAGCCCCTTCCCAGG - Intronic
1075028443 10:119004116-119004138 AGGCTGCAGACACACCCACCAGG + Intergenic
1075655037 10:124155828-124155850 GGTGTCCAGAGACCCCCACCAGG + Intergenic
1077097129 11:803842-803864 GGTCTGGAGAGACCCCCACTGGG + Intronic
1077151086 11:1073447-1073469 AGTGTGCGGAGGCCCACACCAGG + Intergenic
1077385079 11:2265485-2265507 AGCCTGGACAGAGCCTCACCTGG - Intergenic
1077453865 11:2666302-2666324 AAGCTGCAGAGACCCCCACCAGG + Intronic
1081708458 11:45200719-45200741 AGTCTGCAGGGACCCTCCCCTGG - Intronic
1083180688 11:60982825-60982847 AGTCTGCAGGGACTCTTTCCAGG + Intronic
1084858048 11:72001321-72001343 TGGCTGCTGCGACCCTCACCTGG - Exonic
1087147788 11:94828926-94828948 TGTTTGCAGGCACCCTCACCTGG + Intronic
1089593334 11:119559203-119559225 AGGGAGCAGTGACCCTCACCTGG - Intergenic
1090989084 11:131800033-131800055 AGTGTGCTGAGAACCACACCAGG - Intronic
1091571562 12:1691210-1691232 ACACTCCAGAGACCCTCACCCGG - Intronic
1092151157 12:6249824-6249846 ACTCTGCAGAGCCCCTCCTCTGG - Intergenic
1092780793 12:11984928-11984950 AACCTGCAGAGACGCTCACATGG + Intergenic
1092828832 12:12424016-12424038 AGGATTCAGAGACCCACACCAGG - Intronic
1092936849 12:13372158-13372180 TGTCTTCAGAGATCCTTACCAGG + Exonic
1095843048 12:46715308-46715330 AGCTTTCAGAGGCCCTCACCAGG - Intergenic
1098919070 12:76286397-76286419 AGACTTCATAGCCCCTCACCTGG - Intergenic
1101587703 12:106099513-106099535 GGTCTGCAGAGACCCCTAACTGG - Intronic
1102256554 12:111418648-111418670 AGGCTGCTGAGACCCCCGCCCGG + Exonic
1106433371 13:29703412-29703434 TTTCTGCTGATACCCTCACCTGG + Intergenic
1107357963 13:39588110-39588132 AGGCTGCTGAGCCCCTCACGTGG + Intronic
1110531492 13:76603490-76603512 AGGCAGCTGAGACCCGCACCAGG - Intergenic
1116862227 14:50003699-50003721 CTGCTGCAGAGACCATCACCCGG - Intronic
1121454674 14:94030537-94030559 GCTTTGCAGAGACCCTGACCTGG - Intronic
1121466096 14:94116344-94116366 AGACTCCAGTGACCCTCAGCAGG - Intronic
1124414420 15:29463193-29463215 AGGCTGCAGAGACACCCACCAGG + Intronic
1124511713 15:30333156-30333178 TGTCTGCAGAAACCCTGGCCTGG + Intergenic
1124731201 15:32197601-32197623 TGTCTGCAGAAACCCTGGCCTGG - Intergenic
1125716672 15:41823461-41823483 AGTCTGCAGGCCCCTTCACCAGG + Exonic
1125725752 15:41867325-41867347 ACACTGCAGAGACCCACACGGGG - Intronic
1128580506 15:68806730-68806752 AGTCTTCAGAGACCACAACCAGG + Intronic
1128680402 15:69647346-69647368 ACTCTGCAGAGCTCCTCCCCAGG + Intergenic
1128785052 15:70389078-70389100 AGTCTTCATAGCCCCTCACTGGG - Intergenic
1129230195 15:74192781-74192803 GCTCTGCAGAGACCCTCAAAGGG - Intronic
1129567197 15:76635149-76635171 AGGCTCCAGAGACCCTGAACTGG - Intronic
1130765934 15:86871280-86871302 TATCTGCAGAGACCCTCAAAAGG + Intronic
1131350184 15:91692601-91692623 ACTGTGCTGAGACCCTCACTGGG - Intergenic
1131875060 15:96796992-96797014 AGCCTGCAGAGAGCCACAACAGG + Intergenic
1132225956 15:100141635-100141657 GGGCTACAGAGACCGTCACCTGG + Intronic
1132277818 15:100584699-100584721 ACTCTGCATAGACCATGACCTGG + Intronic
1133602362 16:7351925-7351947 AGCCCACAGTGACCCTCACCAGG + Intronic
1138264837 16:55652873-55652895 AGTCTCCCGAGGCCCCCACCAGG + Intergenic
1139592766 16:67942652-67942674 CATCCGCAGAGACACTCACCGGG + Exonic
1139653520 16:68374281-68374303 AGTCTGCAGTCACCATCTCCAGG + Intronic
1141393276 16:83682241-83682263 AGGCAGCAAAGACCCACACCAGG + Intronic
1143977062 17:10837741-10837763 TGTCTGCCAAGACCCTCAGCAGG + Intronic
1151392490 17:73797141-73797163 AGTCTGTAGAGACTCTCACTGGG - Intergenic
1152438531 17:80290725-80290747 AGCCTACAGACACGCTCACCTGG - Exonic
1152441485 17:80312656-80312678 AGTCTGCAGGGCCCCTCTCTGGG + Intronic
1152772781 17:82180331-82180353 AGCCTGGAGAGACCCTGAGCCGG + Intronic
1153562457 18:6384833-6384855 AGTCTGTGGAGAGGCTCACCTGG + Intronic
1155867850 18:30988399-30988421 AGTTTCAAGAGACCCTCCCCAGG - Intergenic
1156945190 18:42821052-42821074 AGTTTCCTGAGGCCCTCACCAGG + Intronic
1158941948 18:62412647-62412669 AGAAAGCAGAGACCCTCACAGGG - Intergenic
1160230551 18:77045394-77045416 AGGCTCCAGAGGCCCTGACCTGG - Intronic
1160230565 18:77045481-77045503 AGGCTCCAGAGACCCTGACCTGG - Intronic
1163031040 19:14544324-14544346 AGTATCCAGAGACCCTCCCCAGG - Intronic
1163847073 19:19643775-19643797 AGGCTGCAGTGCCCCTGACCTGG + Intergenic
1164724789 19:30458811-30458833 AGTCTCCCCAGCCCCTCACCAGG - Intronic
1166253222 19:41585492-41585514 AGACTGAAGGGACACTCACCGGG - Exonic
1166500710 19:43339017-43339039 AGACTCCAGAGACCATCACTTGG - Intergenic
1166509381 19:43394388-43394410 AGACTCCAGAGACCATCACTTGG + Intergenic
1166956866 19:46470729-46470751 GGTCTGTAGAGACCCTACCCAGG - Exonic
1168130934 19:54318109-54318131 ATCCTGCAGAGACCTTCACCTGG + Intergenic
927209750 2:20631803-20631825 AGGCTGCAGAGACCTGCAGCTGG - Intronic
930002237 2:46869241-46869263 AGTCTGCAGGGACACTGTCCAGG - Intergenic
933219236 2:79669599-79669621 AGTCAGCAGCCACCCTCTCCAGG - Intronic
935339120 2:102044085-102044107 GGTCAGCTGAGACCCTCAACTGG - Intergenic
935845306 2:107159815-107159837 TGGCTGCAGAGACCCTCAATGGG + Intergenic
937819164 2:126288325-126288347 AGTATGAAGAGTCCCCCACCAGG - Intergenic
940291423 2:152080950-152080972 AGCTTGCTGAGGCCCTCACCAGG + Intronic
941618818 2:167754329-167754351 AGTCTGCAGTTAGACTCACCTGG + Intergenic
944054434 2:195508726-195508748 AGTCTGCAGAGGCTATCACAGGG + Intergenic
948326572 2:237126637-237126659 TGTCTCCACAGACCCTCACCAGG + Intergenic
948408836 2:237743385-237743407 AGTGTCCAGAGACCACCACCAGG + Intronic
948660415 2:239503252-239503274 AGGCTTCAGAGACCCCCACTGGG - Intergenic
1169282435 20:4279049-4279071 ACTCTGGAGAGACCTTCTCCTGG - Intergenic
1175574129 20:60047863-60047885 ATTCTGCAGAGATTCTCAACAGG - Intergenic
1176270228 20:64232419-64232441 AGTCAGTAGGGACCCTCGCCTGG + Intronic
1179729513 21:43359970-43359992 GGTCTGCAGAGAACCTGAGCCGG + Intergenic
1179959154 21:44758591-44758613 CCCCTGCAGAGACACTCACCTGG + Intergenic
1179986380 21:44923201-44923223 AGGCTGAAGAAACCCTCACAAGG + Intronic
1185254588 22:49825303-49825325 TGCTTGCAGAGACCCTCACCAGG + Intronic
949612174 3:5714258-5714280 AGTTTCCTGAGGCCCTCACCAGG + Intergenic
951400633 3:22228409-22228431 AACCTGGAGAGACCTTCACCTGG + Intronic
953671960 3:44970299-44970321 TGGCTGGAGAGCCCCTCACCAGG - Intronic
954302544 3:49707605-49707627 AGACAGCAGATACCCTGACCTGG - Intronic
954811579 3:53251557-53251579 CGTGTGCAGTGAACCTCACCAGG - Intronic
955143496 3:56292797-56292819 AGTCTTCTGAGATCCTCACATGG + Intronic
955328015 3:58024485-58024507 AGTCTGGAGAGACCACCCCCAGG - Intronic
955359521 3:58261013-58261035 AGTCAACAGAGAGCCACACCGGG + Intronic
956567101 3:70651486-70651508 AGACTGCAGAGACCCAGACTAGG + Intergenic
959972806 3:112426327-112426349 AGCTTTCAGAGGCCCTCACCAGG - Intergenic
960610844 3:119553577-119553599 AGTCTGCAGTGCCCCTCCCAGGG + Intronic
960965957 3:123104867-123104889 AGTCTGCAGGGAGCAGCACCTGG - Intronic
965934378 3:174088894-174088916 ACTCTGCAGAGACCAACACTTGG - Intronic
967577039 3:191106595-191106617 AGTGTCCTGAGGCCCTCACCAGG + Intergenic
967826998 3:193884984-193885006 AGTCTGCAGAGAAGTTCACCAGG + Intergenic
968498414 4:931884-931906 CCTCGGCAGAGACCCTCCCCTGG + Intronic
968703379 4:2067073-2067095 GGTCTGCAGCGACTCACACCTGG - Exonic
968972710 4:3804219-3804241 GGTCTGCAGGGACACACACCTGG - Intergenic
971287903 4:25308003-25308025 AACCTGCAGAGACCCTGCCCCGG - Intergenic
976607898 4:86999752-86999774 AGTCTGCAGAGAGCCTTTCATGG + Intronic
979820081 4:125160480-125160502 AGCTTCCTGAGACCCTCACCAGG - Intergenic
979989250 4:127355125-127355147 AATCTGGAGAGAAACTCACCAGG + Intergenic
982263796 4:153520018-153520040 AGTCTACACAGACCTTCCCCAGG - Intronic
983461160 4:168027403-168027425 AGTCTTCAGAGAACCTACCCAGG + Intergenic
984446001 4:179836517-179836539 AGTCTGGGCAGACCCTCGCCTGG - Intergenic
985548345 5:520974-520996 AGCCTGCAGCCACCCGCACCAGG - Intronic
985884754 5:2668855-2668877 ACCCTGCAGAGACCCTGACTGGG + Intergenic
988560387 5:32275518-32275540 TGTTTGCAGAGGGCCTCACCAGG - Intronic
996412386 5:123172428-123172450 AGTCTGTTGATACTCTCACCAGG - Intronic
997304598 5:132828283-132828305 GGTCTGCTGAGAGCCTCTCCTGG - Intronic
998218040 5:140252381-140252403 AGTCCTCAGAGACCCTCTGCTGG + Intronic
1002316711 5:178348667-178348689 GGTCTGCAGAGCCCCTTCCCAGG + Intronic
1002560745 5:180080362-180080384 AGTCTGCAGAGCCACTCATCTGG + Intergenic
1002837076 6:874179-874201 ACTCTGCACAAACCCTCTCCTGG - Intergenic
1007216802 6:40246675-40246697 AACCTCCATAGACCCTCACCTGG + Intergenic
1010009588 6:71035218-71035240 AGTCTGCAGAAAACATCTCCTGG + Intergenic
1017064192 6:150513775-150513797 AATATGCAGAGAACATCACCTGG - Intergenic
1017995164 6:159525882-159525904 AGTGTGTAAACACCCTCACCAGG - Intergenic
1019187597 6:170229917-170229939 TGGCTGCAGTGACCCACACCAGG - Intergenic
1022012565 7:26321581-26321603 AGTCTGCAGTGCACCTGACCTGG - Intronic
1024157001 7:46636244-46636266 AGTGTGCACAGACACTGACCTGG + Intergenic
1026564696 7:71480373-71480395 TGACTGCAGAGACCCTGCCCAGG - Intronic
1034426759 7:151018118-151018140 AGTCCCCAGCGACCCTCGCCAGG + Intronic
1034472190 7:151261139-151261161 GGACTGCAGAGACCCTGCCCAGG - Intronic
1035328097 7:158077723-158077745 AGTCTGCAGAGACCCTCACCCGG - Intronic
1035374869 7:158401315-158401337 AATCTTCAGAGACCTCCACCAGG + Intronic
1038420715 8:27432358-27432380 AGTGCCCAGAGACACTCACCTGG - Exonic
1042129601 8:65574384-65574406 AGCTTCCTGAGACCCTCACCAGG + Intergenic
1042666750 8:71215595-71215617 ACCCCGCAGAGAGCCTCACCGGG + Exonic
1044522924 8:93220473-93220495 AGTCAGCAGAGGCCGTCACGGGG - Intergenic
1045385146 8:101665305-101665327 AGTCAACAGATACCCTCTCCTGG - Intronic
1050992972 9:12175182-12175204 ATGCTGGAGAGACCTTCACCTGG - Intergenic
1052412106 9:28134989-28135011 AGGCTGCATAGGCCCACACCAGG + Intronic
1052817186 9:33110851-33110873 AGTCAGCAGAGACCCTGTCCAGG + Exonic
1055156816 9:73072874-73072896 AGCTTCCTGAGACCCTCACCAGG + Intronic
1055409319 9:76011194-76011216 GGTCTGGAGAGAATCTCACCAGG + Intronic
1060209881 9:121703155-121703177 AGCTTCCAGGGACCCTCACCTGG + Intronic
1188162322 X:26819317-26819339 AGTCTGCACAGAGCATCACTGGG - Intergenic
1189129073 X:38479663-38479685 AGTTTGCAGAGAGCTTCAGCTGG - Intronic
1189374408 X:40455510-40455532 AGCTTCCTGAGACCCTCACCAGG - Intergenic
1195313942 X:103659476-103659498 AACCTGGAGAGACCTTCACCCGG - Intergenic
1196987424 X:121290310-121290332 AGTCTGCATAGTCCCCCAGCTGG + Intergenic
1197338068 X:125232549-125232571 AGTTTCCTGAGGCCCTCACCAGG - Intergenic
1199896124 X:152129526-152129548 AGTCTGCAGTGACCCTGTCGTGG - Intergenic
1200703638 Y:6423182-6423204 ATTCTGCAGAAAGCCCCACCTGG + Intergenic
1201030473 Y:9741525-9741547 ATTCTGCAGAAAGCCCCACCTGG - Intergenic
1202176675 Y:22104832-22104854 GGTCTGCAGGGAGCCCCACCTGG + Intergenic
1202214686 Y:22481552-22481574 GGTCTGCAGGGAGCCCCACCTGG - Intergenic