ID: 1035329568 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:158087557-158087579 |
Sequence | GGAAGCGTTTGCATCTGAGT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 101 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 95} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1035329568_1035329572 | -5 | Left | 1035329568 | 7:158087557-158087579 | CCCACTCAGATGCAAACGCTTCC | 0: 1 1: 0 2: 0 3: 5 4: 95 |
||
Right | 1035329572 | 7:158087575-158087597 | CTTCCTCCCCTGACGAAGGAGGG | No data | ||||
1035329568_1035329571 | -6 | Left | 1035329568 | 7:158087557-158087579 | CCCACTCAGATGCAAACGCTTCC | 0: 1 1: 0 2: 0 3: 5 4: 95 |
||
Right | 1035329571 | 7:158087574-158087596 | GCTTCCTCCCCTGACGAAGGAGG | No data | ||||
1035329568_1035329577 | 29 | Left | 1035329568 | 7:158087557-158087579 | CCCACTCAGATGCAAACGCTTCC | 0: 1 1: 0 2: 0 3: 5 4: 95 |
||
Right | 1035329577 | 7:158087609-158087631 | AAACCTTCCTCCCCTGATGAAGG | 0: 2 1: 7 2: 0 3: 10 4: 129 |
||||
1035329568_1035329570 | -9 | Left | 1035329568 | 7:158087557-158087579 | CCCACTCAGATGCAAACGCTTCC | 0: 1 1: 0 2: 0 3: 5 4: 95 |
||
Right | 1035329570 | 7:158087571-158087593 | AACGCTTCCTCCCCTGACGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1035329568 | Original CRISPR | GGAAGCGTTTGCATCTGAGT GGG (reversed) | Intronic | ||