ID: 1035329568

View in Genome Browser
Species Human (GRCh38)
Location 7:158087557-158087579
Sequence GGAAGCGTTTGCATCTGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035329568_1035329572 -5 Left 1035329568 7:158087557-158087579 CCCACTCAGATGCAAACGCTTCC 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1035329572 7:158087575-158087597 CTTCCTCCCCTGACGAAGGAGGG No data
1035329568_1035329571 -6 Left 1035329568 7:158087557-158087579 CCCACTCAGATGCAAACGCTTCC 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1035329571 7:158087574-158087596 GCTTCCTCCCCTGACGAAGGAGG No data
1035329568_1035329577 29 Left 1035329568 7:158087557-158087579 CCCACTCAGATGCAAACGCTTCC 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1035329577 7:158087609-158087631 AAACCTTCCTCCCCTGATGAAGG 0: 2
1: 7
2: 0
3: 10
4: 129
1035329568_1035329570 -9 Left 1035329568 7:158087557-158087579 CCCACTCAGATGCAAACGCTTCC 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1035329570 7:158087571-158087593 AACGCTTCCTCCCCTGACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035329568 Original CRISPR GGAAGCGTTTGCATCTGAGT GGG (reversed) Intronic