ID: 1035329569

View in Genome Browser
Species Human (GRCh38)
Location 7:158087558-158087580
Sequence AGGAAGCGTTTGCATCTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035329569_1035329570 -10 Left 1035329569 7:158087558-158087580 CCACTCAGATGCAAACGCTTCCT No data
Right 1035329570 7:158087571-158087593 AACGCTTCCTCCCCTGACGAAGG No data
1035329569_1035329572 -6 Left 1035329569 7:158087558-158087580 CCACTCAGATGCAAACGCTTCCT No data
Right 1035329572 7:158087575-158087597 CTTCCTCCCCTGACGAAGGAGGG No data
1035329569_1035329571 -7 Left 1035329569 7:158087558-158087580 CCACTCAGATGCAAACGCTTCCT No data
Right 1035329571 7:158087574-158087596 GCTTCCTCCCCTGACGAAGGAGG No data
1035329569_1035329577 28 Left 1035329569 7:158087558-158087580 CCACTCAGATGCAAACGCTTCCT No data
Right 1035329577 7:158087609-158087631 AAACCTTCCTCCCCTGATGAAGG 0: 2
1: 7
2: 0
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035329569 Original CRISPR AGGAAGCGTTTGCATCTGAG TGG (reversed) Intronic