ID: 1035329574

View in Genome Browser
Species Human (GRCh38)
Location 7:158087581-158087603
Sequence AAGACTCCCTCCTTCGTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 17, 2: 36, 3: 22, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035329574_1035329579 8 Left 1035329574 7:158087581-158087603 CCCCTGACGAAGGAGGGAGTCTT 0: 1
1: 17
2: 36
3: 22
4: 84
Right 1035329579 7:158087612-158087634 CCTTCCTCCCCTGATGAAGGAGG No data
1035329574_1035329580 9 Left 1035329574 7:158087581-158087603 CCCCTGACGAAGGAGGGAGTCTT 0: 1
1: 17
2: 36
3: 22
4: 84
Right 1035329580 7:158087613-158087635 CTTCCTCCCCTGATGAAGGAGGG 0: 2
1: 16
2: 30
3: 29
4: 235
1035329574_1035329577 5 Left 1035329574 7:158087581-158087603 CCCCTGACGAAGGAGGGAGTCTT 0: 1
1: 17
2: 36
3: 22
4: 84
Right 1035329577 7:158087609-158087631 AAACCTTCCTCCCCTGATGAAGG 0: 2
1: 7
2: 0
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035329574 Original CRISPR AAGACTCCCTCCTTCGTCAG GGG (reversed) Intronic