ID: 1035329575 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:158087582-158087604 |
Sequence | GAAGACTCCCTCCTTCGTCA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1035329575_1035329580 | 8 | Left | 1035329575 | 7:158087582-158087604 | CCCTGACGAAGGAGGGAGTCTTC | No data | ||
Right | 1035329580 | 7:158087613-158087635 | CTTCCTCCCCTGATGAAGGAGGG | 0: 2 1: 16 2: 30 3: 29 4: 235 |
||||
1035329575_1035329577 | 4 | Left | 1035329575 | 7:158087582-158087604 | CCCTGACGAAGGAGGGAGTCTTC | No data | ||
Right | 1035329577 | 7:158087609-158087631 | AAACCTTCCTCCCCTGATGAAGG | 0: 2 1: 7 2: 0 3: 10 4: 129 |
||||
1035329575_1035329579 | 7 | Left | 1035329575 | 7:158087582-158087604 | CCCTGACGAAGGAGGGAGTCTTC | No data | ||
Right | 1035329579 | 7:158087612-158087634 | CCTTCCTCCCCTGATGAAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1035329575 | Original CRISPR | GAAGACTCCCTCCTTCGTCA GGG (reversed) | Intronic | ||