ID: 1035329575

View in Genome Browser
Species Human (GRCh38)
Location 7:158087582-158087604
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035329575_1035329580 8 Left 1035329575 7:158087582-158087604 CCCTGACGAAGGAGGGAGTCTTC No data
Right 1035329580 7:158087613-158087635 CTTCCTCCCCTGATGAAGGAGGG 0: 2
1: 16
2: 30
3: 29
4: 235
1035329575_1035329577 4 Left 1035329575 7:158087582-158087604 CCCTGACGAAGGAGGGAGTCTTC No data
Right 1035329577 7:158087609-158087631 AAACCTTCCTCCCCTGATGAAGG 0: 2
1: 7
2: 0
3: 10
4: 129
1035329575_1035329579 7 Left 1035329575 7:158087582-158087604 CCCTGACGAAGGAGGGAGTCTTC No data
Right 1035329579 7:158087612-158087634 CCTTCCTCCCCTGATGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035329575 Original CRISPR GAAGACTCCCTCCTTCGTCA GGG (reversed) Intronic