ID: 1035329577

View in Genome Browser
Species Human (GRCh38)
Location 7:158087609-158087631
Sequence AAACCTTCCTCCCCTGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 2, 1: 7, 2: 0, 3: 10, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035329568_1035329577 29 Left 1035329568 7:158087557-158087579 CCCACTCAGATGCAAACGCTTCC 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1035329577 7:158087609-158087631 AAACCTTCCTCCCCTGATGAAGG 0: 2
1: 7
2: 0
3: 10
4: 129
1035329576_1035329577 3 Left 1035329576 7:158087583-158087605 CCTGACGAAGGAGGGAGTCTTCA No data
Right 1035329577 7:158087609-158087631 AAACCTTCCTCCCCTGATGAAGG 0: 2
1: 7
2: 0
3: 10
4: 129
1035329569_1035329577 28 Left 1035329569 7:158087558-158087580 CCACTCAGATGCAAACGCTTCCT No data
Right 1035329577 7:158087609-158087631 AAACCTTCCTCCCCTGATGAAGG 0: 2
1: 7
2: 0
3: 10
4: 129
1035329574_1035329577 5 Left 1035329574 7:158087581-158087603 CCCCTGACGAAGGAGGGAGTCTT 0: 1
1: 17
2: 36
3: 22
4: 84
Right 1035329577 7:158087609-158087631 AAACCTTCCTCCCCTGATGAAGG 0: 2
1: 7
2: 0
3: 10
4: 129
1035329573_1035329577 8 Left 1035329573 7:158087578-158087600 CCTCCCCTGACGAAGGAGGGAGT No data
Right 1035329577 7:158087609-158087631 AAACCTTCCTCCCCTGATGAAGG 0: 2
1: 7
2: 0
3: 10
4: 129
1035329575_1035329577 4 Left 1035329575 7:158087582-158087604 CCCTGACGAAGGAGGGAGTCTTC No data
Right 1035329577 7:158087609-158087631 AAACCTTCCTCCCCTGATGAAGG 0: 2
1: 7
2: 0
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035329577 Original CRISPR AAACCTTCCTCCCCTGATGA AGG Intronic