ID: 1035329580

View in Genome Browser
Species Human (GRCh38)
Location 7:158087613-158087635
Sequence CTTCCTCCCCTGATGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 2, 1: 16, 2: 30, 3: 29, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035329573_1035329580 12 Left 1035329573 7:158087578-158087600 CCTCCCCTGACGAAGGAGGGAGT No data
Right 1035329580 7:158087613-158087635 CTTCCTCCCCTGATGAAGGAGGG 0: 2
1: 16
2: 30
3: 29
4: 235
1035329576_1035329580 7 Left 1035329576 7:158087583-158087605 CCTGACGAAGGAGGGAGTCTTCA No data
Right 1035329580 7:158087613-158087635 CTTCCTCCCCTGATGAAGGAGGG 0: 2
1: 16
2: 30
3: 29
4: 235
1035329574_1035329580 9 Left 1035329574 7:158087581-158087603 CCCCTGACGAAGGAGGGAGTCTT 0: 1
1: 17
2: 36
3: 22
4: 84
Right 1035329580 7:158087613-158087635 CTTCCTCCCCTGATGAAGGAGGG 0: 2
1: 16
2: 30
3: 29
4: 235
1035329575_1035329580 8 Left 1035329575 7:158087582-158087604 CCCTGACGAAGGAGGGAGTCTTC No data
Right 1035329580 7:158087613-158087635 CTTCCTCCCCTGATGAAGGAGGG 0: 2
1: 16
2: 30
3: 29
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035329580 Original CRISPR CTTCCTCCCCTGATGAAGGA GGG Intronic