ID: 1035332327

View in Genome Browser
Species Human (GRCh38)
Location 7:158104491-158104513
Sequence ACTATAGGGCTCACCTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 43}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035332321_1035332327 6 Left 1035332321 7:158104462-158104484 CCCCTCACAAGATGAAAAAGGAG 0: 1
1: 0
2: 0
3: 18
4: 247
Right 1035332327 7:158104491-158104513 ACTATAGGGCTCACCTAGGCAGG 0: 1
1: 1
2: 0
3: 2
4: 43
1035332322_1035332327 5 Left 1035332322 7:158104463-158104485 CCCTCACAAGATGAAAAAGGAGA No data
Right 1035332327 7:158104491-158104513 ACTATAGGGCTCACCTAGGCAGG 0: 1
1: 1
2: 0
3: 2
4: 43
1035332319_1035332327 24 Left 1035332319 7:158104444-158104466 CCAAGATCAGCAGCAGGGCCCCT No data
Right 1035332327 7:158104491-158104513 ACTATAGGGCTCACCTAGGCAGG 0: 1
1: 1
2: 0
3: 2
4: 43
1035332323_1035332327 4 Left 1035332323 7:158104464-158104486 CCTCACAAGATGAAAAAGGAGAT No data
Right 1035332327 7:158104491-158104513 ACTATAGGGCTCACCTAGGCAGG 0: 1
1: 1
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035332327 Original CRISPR ACTATAGGGCTCACCTAGGC AGG Intronic