ID: 1035333278

View in Genome Browser
Species Human (GRCh38)
Location 7:158110368-158110390
Sequence TTCCATGGCAGGCATGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 267}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035333278_1035333284 6 Left 1035333278 7:158110368-158110390 CCATGGCCATGCCTGCCATGGAA 0: 1
1: 0
2: 0
3: 22
4: 267
Right 1035333284 7:158110397-158110419 GAGACTCGGGATCCAAAGCCAGG 0: 1
1: 0
2: 0
3: 13
4: 126
1035333278_1035333282 -8 Left 1035333278 7:158110368-158110390 CCATGGCCATGCCTGCCATGGAA 0: 1
1: 0
2: 0
3: 22
4: 267
Right 1035333282 7:158110383-158110405 CCATGGAAGCTGCAGAGACTCGG No data
1035333278_1035333285 16 Left 1035333278 7:158110368-158110390 CCATGGCCATGCCTGCCATGGAA 0: 1
1: 0
2: 0
3: 22
4: 267
Right 1035333285 7:158110407-158110429 ATCCAAAGCCAGGTCTCCGAAGG 0: 1
1: 0
2: 2
3: 9
4: 91
1035333278_1035333286 17 Left 1035333278 7:158110368-158110390 CCATGGCCATGCCTGCCATGGAA 0: 1
1: 0
2: 0
3: 22
4: 267
Right 1035333286 7:158110408-158110430 TCCAAAGCCAGGTCTCCGAAGGG No data
1035333278_1035333283 -7 Left 1035333278 7:158110368-158110390 CCATGGCCATGCCTGCCATGGAA 0: 1
1: 0
2: 0
3: 22
4: 267
Right 1035333283 7:158110384-158110406 CATGGAAGCTGCAGAGACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035333278 Original CRISPR TTCCATGGCAGGCATGGCCA TGG (reversed) Intronic
900351767 1:2238407-2238429 TGCCATGGCAGGCCTGTCCTGGG - Intronic
901036458 1:6338905-6338927 TTCCATGGTTACCATGGCCAAGG + Intronic
901956950 1:12793292-12793314 CTCCATGGCAGAGATGGACAAGG - Exonic
901964956 1:12859074-12859096 CTCCATGGCAGAGATGGACAAGG - Exonic
901980345 1:13029428-13029450 CTCCATGGCAGAGATGGACAAGG - Intronic
901989092 1:13097885-13097907 CTCCAGGGCAGAGATGGCCAAGG + Intergenic
901992721 1:13128882-13128904 CTCCAGGGCAGAGATGGCCAAGG - Intergenic
902001742 1:13199503-13199525 CTCCATGGCAGAGATGGACAAGG + Intergenic
902020970 1:13345228-13345250 CTCCATGGCAGAGATGGACAAGG + Exonic
905797536 1:40824057-40824079 ATCAGTGGCAGGCAGGGCCATGG - Intronic
905894126 1:41534265-41534287 TTCCTTGGCAGGAAAGGCCCAGG + Intronic
906106064 1:43293379-43293401 TTTCATGGCATACATGGCCCTGG - Intergenic
909014443 1:70367861-70367883 TTCTATGGCAGGCAGGGGCGGGG - Exonic
914509018 1:148314859-148314881 TTCTTAGGCAGGCATTGCCATGG - Intergenic
915039616 1:152957694-152957716 TTCCAAGGCAGGCAGGGCTGAGG + Intergenic
915243844 1:154542633-154542655 TTCCTTGGAGGGCAGGGCCAAGG + Intronic
916918522 1:169437738-169437760 TTCCAAGGCTTGCATGGCAAAGG + Intronic
917536595 1:175878643-175878665 TTCCCAAGCAGGCCTGGCCATGG + Intergenic
917980828 1:180267920-180267942 GTCCATGGCAGGAGTGGGCAGGG + Intronic
918888237 1:190226143-190226165 TTCCATGGCTTGAATGTCCATGG + Exonic
919844957 1:201636215-201636237 CTCCATGCCAGTCTTGGCCAAGG + Intronic
920095103 1:203481579-203481601 TTCCAAGGCAGGCCTCTCCAAGG - Intronic
920754531 1:208716511-208716533 TTTCAGGGCAGGCATGTCCCAGG - Intergenic
922554247 1:226520980-226521002 TTCCATGGCAACTGTGGCCAAGG + Intergenic
1063053371 10:2477079-2477101 TTCCAGGGCTTGCTTGGCCATGG + Intergenic
1063890022 10:10619606-10619628 TTCCAGGGCAGGCAAGGGCCAGG - Intergenic
1064292878 10:14051659-14051681 TTTCATGGCAGGGTTGGCCCTGG + Intronic
1067008815 10:42691079-42691101 TTCCATGGGAATCATGGGCATGG - Intergenic
1067449132 10:46370765-46370787 TTCCAGGCCGGGCAGGGCCAAGG + Intronic
1067580101 10:47439368-47439390 GTCCATGGCAGGCAACTCCATGG + Intergenic
1067588237 10:47490000-47490022 TTCCAGGCCGGGCAGGGCCAAGG - Intronic
1067635362 10:47998091-47998113 TTCCAGGCCGGGCAGGGCCAAGG - Intergenic
1067897549 10:50200595-50200617 TTCCATGAAAGGCATGCACAAGG - Intronic
1068991800 10:63158400-63158422 TTCCATGTCAGTCATTGGCAGGG - Intergenic
1069896627 10:71684182-71684204 TTCCCTGGCAGTCATGACCATGG + Intronic
1069917501 10:71796392-71796414 TTCCATGGCAGTCCTAGCAAGGG - Intronic
1070131922 10:73662097-73662119 TTCCAGGCCAGGCAGGGCCAAGG - Intronic
1071609766 10:87021979-87022001 TTCCAGGCCGGGCAGGGCCAAGG + Intronic
1071845473 10:89517262-89517284 TTCCATGGGGGGCAGGGCGACGG + Intronic
1075971288 10:126655893-126655915 TTCCATGACATGCATGCCCTGGG + Intronic
1077672374 11:4167848-4167870 CTCCATGGCAGGGACAGCCAGGG + Intergenic
1078660954 11:13285051-13285073 ATCCAAGGCAGGCACGGGCAAGG - Intronic
1079102770 11:17552019-17552041 TTCCCAGGAAGACATGGCCACGG - Exonic
1079673906 11:23202061-23202083 TAGCAGGGGAGGCATGGCCAGGG + Intergenic
1085041887 11:73331483-73331505 TTCCAGGGCTGTCATTGCCATGG + Intronic
1086647534 11:89243130-89243152 TTCCAGAGCGGGCATGGCAAAGG + Intronic
1089002792 11:115066074-115066096 TTCTCTGGCATGCATGTCCAGGG - Intergenic
1089236233 11:117028717-117028739 AGCCATATCAGGCATGGCCAGGG + Intronic
1089258255 11:117205539-117205561 TTTCAGGACAGGCATGTCCAGGG + Exonic
1089268269 11:117282449-117282471 CACCATGGCAGGCCTGACCATGG + Exonic
1089318194 11:117606284-117606306 TTCCATGGCTTCCATGGCCCTGG + Intronic
1089613760 11:119684021-119684043 CTCCATGGCAGGCAGGGCCTTGG - Intronic
1090570543 11:128039870-128039892 TTGCAAGGCAGTCATCGCCAGGG + Intergenic
1091778318 12:3198964-3198986 TACCACAACAGGCATGGCCATGG - Intronic
1092191907 12:6527369-6527391 TTCCATTGCTGGCCTGGCCCCGG + Intronic
1093067012 12:14668738-14668760 GTCCATGACTGGCTTGGCCAGGG - Intronic
1096628884 12:52912736-52912758 TTTCATGGAGGCCATGGCCATGG - Intronic
1098162302 12:67657330-67657352 GTCCATGGAAGGCATGGGGAAGG + Exonic
1100553670 12:95671622-95671644 TTCCATGGATGGCAGGGGCAGGG - Intronic
1101306521 12:103533512-103533534 TGCCATGCCAGGCATGGTCTGGG + Intergenic
1102427410 12:112855050-112855072 TTCCATGACAGGAAAGGGCAGGG + Intronic
1104775874 12:131389831-131389853 TTCCATGGGAAGCAGAGCCAGGG - Intergenic
1104972547 12:132538507-132538529 TTCCCTGGCAGTGATGGCCACGG + Intronic
1106099465 13:26682007-26682029 TGACTTGGCATGCATGGCCAGGG - Intronic
1108861089 13:54859830-54859852 TTTTATGGCAGACATGCCCAAGG - Intergenic
1110979236 13:81874721-81874743 TTCTCTGGCAGGCAGGGGCAGGG - Intergenic
1112377259 13:98854842-98854864 TCCCATGGCTGGCATTGACATGG - Intronic
1112731531 13:102368046-102368068 TTCCTTGGCAGTCGAGGCCAAGG - Intronic
1113880489 13:113622904-113622926 TTCCATAGCAGACATCGCCGAGG + Intronic
1114140671 14:19906362-19906384 TTCCTCAGCAGGTATGGCCAAGG + Intergenic
1114699527 14:24663190-24663212 TTCCATGGGCAGGATGGCCACGG + Intergenic
1117648041 14:57873009-57873031 ATCCATTGCAGACATGGCCCAGG - Intronic
1118309749 14:64683557-64683579 CACGATGGCAAGCATGGCCAGGG + Intergenic
1118816422 14:69317431-69317453 TCCCATGCCAGGCTTGGCCATGG - Intronic
1119692234 14:76683555-76683577 TCACATGGCAGCCATGGCAAGGG + Intergenic
1120771801 14:88387188-88387210 TCCCATGGTAGGGATGGGCAGGG + Intronic
1121790554 14:96696484-96696506 TTCCTTGGGTGTCATGGCCAAGG - Intergenic
1122009756 14:98736441-98736463 GTCCATGGCAGCCCAGGCCAGGG + Intergenic
1123552878 15:21399302-21399324 GTGCATGCCAGGCAAGGCCAAGG - Intergenic
1123589124 15:21836690-21836712 GTGCATGCCAGGCAAGGCCAAGG - Intergenic
1123937901 15:25202857-25202879 TTCCCTAGCAGGAAGGGCCAAGG + Intergenic
1123942402 15:25222897-25222919 TTCGGTGGCAGGGAGGGCCAAGG + Intergenic
1123945242 15:25235735-25235757 TTCGGTGGCAGGGAGGGCCAAGG + Intergenic
1123947741 15:25246989-25247011 TTCGGTGGCAGGCAGGGCCAAGG + Intergenic
1126802289 15:52309796-52309818 TTCCTTAGCAGGCATAGTCAAGG - Exonic
1128393543 15:67200038-67200060 TTCCATGGCAGGCCAAGGCAAGG + Intergenic
1128450098 15:67800840-67800862 TTACATGGCAAGCATGGGCTAGG - Intronic
1129259915 15:74359587-74359609 TTCTTTGGCAGGCACGGGCAGGG - Intronic
1129934958 15:79439687-79439709 TGCCCCTGCAGGCATGGCCAGGG + Intronic
1130337798 15:82972402-82972424 TTCCATGGCCGACGTGGCCATGG - Intronic
1132294851 15:100727431-100727453 TTCCAGGGCAGCCCTGGCCCTGG - Intergenic
1132347049 15:101114666-101114688 TCCCAGGGCAGCCAAGGCCAGGG + Intergenic
1202961227 15_KI270727v1_random:126522-126544 GTGCATGCCAGGCAAGGCCAAGG - Intergenic
1132625062 16:887736-887758 TACCCTGGAAGGCATGGCCGTGG + Intronic
1132896454 16:2231664-2231686 TCCCAAGGCAGGCTTGGCCTGGG - Intronic
1133528736 16:6632600-6632622 TTAGAAGGCAGGCCTGGCCATGG + Intronic
1135225998 16:20658574-20658596 TTCCTTGGCAGGACTGCCCATGG - Intronic
1136682972 16:31978674-31978696 TTCCATGGGAAGGATGGCCAGGG + Intergenic
1136783613 16:32922230-32922252 TTCCATGGGAAGGACGGCCAGGG + Intergenic
1136886178 16:33931576-33931598 TTCCATGGGAAGGACGGCCAGGG - Intergenic
1139291887 16:65866958-65866980 TTCCATGGTAGGAATGTTCAAGG + Intergenic
1139653819 16:68375698-68375720 TACCATTGCTGGCAGGGCCATGG - Intronic
1140331561 16:74062314-74062336 TTCCAGGGCTGGCAAGGACATGG + Intergenic
1140442805 16:74999827-74999849 CTCGGTGGCAGGCATGGGCATGG + Exonic
1141259993 16:82443991-82444013 TTCCATGACAGGAATGGCTTTGG + Intergenic
1141704648 16:85658184-85658206 TCCCAGGGCAGGCAGGGGCAGGG - Intronic
1203086259 16_KI270728v1_random:1186224-1186246 TTCCATGGGAAGGACGGCCAGGG + Intergenic
1142967222 17:3589160-3589182 TTCCATGGCAGGCAGGAGCATGG - Intronic
1143046863 17:4088389-4088411 CCCCATGGCAGCCACGGCCAGGG + Intronic
1144041440 17:11414481-11414503 TTCAATGGCAGGGAGGGGCAGGG - Intronic
1145897899 17:28471200-28471222 TTGCCTGGGAGTCATGGCCAGGG - Intronic
1146532945 17:33625962-33625984 TTCCAGGGCAGGCATATACAGGG + Intronic
1146654844 17:34629001-34629023 TACCCTGGCAGGGAGGGCCAGGG + Exonic
1146901442 17:36592008-36592030 CTCCATGCCGGGCCTGGCCATGG - Exonic
1148770085 17:50061473-50061495 TTCCATTACAGGCGTGCCCAAGG + Intronic
1148845672 17:50528498-50528520 TGCCATGCCATGAATGGCCATGG - Intronic
1151679266 17:75615086-75615108 CAGCATGGCAGGCATGGCCTGGG + Intergenic
1152405863 17:80097424-80097446 TTCCATGGCCGTCATCCCCAGGG - Intronic
1152626037 17:81388407-81388429 CCCCATGGGAGCCATGGCCAAGG + Intergenic
1155057925 18:22201093-22201115 TTCCATAGCAGGCAAGGCCCAGG - Exonic
1156454829 18:37287063-37287085 TTCCATGGCAGCCAGGGCTAAGG - Intronic
1157442708 18:47722699-47722721 TTGCATGGCAGCCCTGGCCTGGG - Intergenic
1157602761 18:48904258-48904280 TCCCATGGCAGACAAGGACAGGG + Intergenic
1158576287 18:58641400-58641422 TTCTCTGGCAGGCAGGGACAGGG + Intergenic
1159082581 18:63752511-63752533 TTCCATGGCAGTCATTGACTAGG - Intergenic
1160164279 18:76496117-76496139 TTACAGGGCAGGGATGGCCGGGG + Intronic
1160258878 18:77272379-77272401 TTCCTTTTCAGTCATGGCCATGG + Exonic
1160512439 18:79460105-79460127 CTCCCGGGCTGGCATGGCCAGGG + Intronic
1160533612 18:79579308-79579330 CTCCCAGGCACGCATGGCCATGG + Intergenic
1162322895 19:9980150-9980172 CTGCATGCCAGGCATGGGCAGGG + Intronic
1162389080 19:10378329-10378351 TCCCATGGCAGCCATGGGCTGGG + Exonic
1162784835 19:13028191-13028213 GTGCCTGGCAGGCATGGGCATGG - Intronic
1162954112 19:14089080-14089102 CTCCATGGCAGCCATGAACAAGG - Exonic
1164373171 19:27659011-27659033 TTCCATGACTGGGATAGCCAAGG + Intergenic
1164770641 19:30806116-30806138 TAGCATGGCAGGCAGGGTCAGGG - Intergenic
1166960499 19:46493638-46493660 TGCCAGGGCAGGCGAGGCCAAGG - Exonic
1167133361 19:47601867-47601889 TCCCAGGGCAGGGATTGCCAGGG + Intergenic
925258218 2:2507649-2507671 CTCCGTGGCTGGCCTGGCCACGG + Intergenic
925608522 2:5683685-5683707 TTCCAGGGCAGCTCTGGCCAGGG - Intergenic
928344324 2:30476739-30476761 TTCCATGGATGGCAGGGGCAGGG - Intronic
930272930 2:49277787-49277809 TTCTTTGGCAGGCAGGGGCAGGG - Intergenic
930871707 2:56177712-56177734 TACTATGGCAGAAATGGCCAGGG - Intergenic
933651182 2:84851596-84851618 GTACATGGCAGTCATGGACAGGG - Intronic
935631826 2:105218393-105218415 TACCCTAGCAGGCAGGGCCAGGG + Intergenic
936062600 2:109305345-109305367 TTTAATGGCAGGTATGGCCATGG + Intronic
937099314 2:119256516-119256538 TTCTCTGGCAGGCAGAGCCAGGG - Intronic
938305193 2:130248517-130248539 TTCCCTGGTAGGCATCGCCACGG + Intergenic
938448823 2:131398690-131398712 TTCCCTGGTAGGCATCGCCACGG - Intergenic
939076656 2:137610360-137610382 ATCCATGGAAGGCATGGCTAGGG + Intronic
940326673 2:152432936-152432958 TTGCATGGCAGGCATTGACATGG + Intronic
940417633 2:153441021-153441043 TACCATTCCAGACATGGCCATGG - Intergenic
941638463 2:167961688-167961710 TTCCATTGTTGGTATGGCCAGGG - Intronic
946035288 2:216737075-216737097 GTCCATGGCAGGGATGTCCTGGG + Intergenic
946506240 2:220304073-220304095 TCCCATGCATGGCATGGCCATGG + Intergenic
947490419 2:230590052-230590074 TCCCCTTGCAGACATGGCCATGG + Intergenic
948116251 2:235495617-235495639 CTGCATGTCAGGCAGGGCCATGG + Intronic
948283253 2:236764873-236764895 TGCTATGGCAGGGATGGCAAGGG - Intergenic
1168808673 20:688701-688723 TTCCATGGCGGGGATGGGGAGGG + Intergenic
1169286173 20:4309112-4309134 TTTCATGGTAGGCAAGACCATGG + Intergenic
1169657040 20:7936403-7936425 TTCCAAGGCTGGCATGCCAATGG - Intronic
1169937379 20:10898531-10898553 TTCTTTGGCTGGCATTGCCATGG - Intergenic
1171344878 20:24458609-24458631 TTCCCTGGCAGGCATCTCCCAGG - Intergenic
1172276950 20:33685235-33685257 TTCCATGGCAACCAGGGCCTGGG + Intronic
1172356161 20:34281484-34281506 TTCCATGACAGGCAGAGACAAGG + Intronic
1175468311 20:59208006-59208028 TTCCAGGGTAGGCAAGGACATGG + Intronic
1176121171 20:63455257-63455279 TTCCCTGGCAGCCGTTGCCAAGG + Intronic
1176144880 20:63561129-63561151 TGACGAGGCAGGCATGGCCACGG - Exonic
1176820394 21:13650606-13650628 GTGCATGCCAGGCAAGGCCAAGG + Intergenic
1178146933 21:29751008-29751030 TTCGCTGGCAGGCAGGGACAGGG + Intronic
1178919572 21:36729670-36729692 TTCCAAGGCAGGCGAGGCTATGG - Intronic
1181009449 22:20032012-20032034 TCACATGGCAGGGATGGGCAAGG - Intronic
1181620437 22:24087458-24087480 TTCCTGGGCAGGCATGGCTCTGG + Exonic
1182427978 22:30284860-30284882 TTCAAAGGCAGGCATGGGAAGGG + Intergenic
1182711221 22:32324647-32324669 TCCCATGGCAGAGATGTCCACGG + Intergenic
1184257272 22:43294433-43294455 TGCCCTGCCAGGCCTGGCCAGGG - Intronic
1185188154 22:49415582-49415604 TGGCATGGCAGGCATGCCCTCGG + Intronic
1185347459 22:50316891-50316913 TCCCATGCCAGGCAAGGACAGGG + Intronic
949997671 3:9631286-9631308 TTCCAAGGCTGGCATGGCAAAGG + Intergenic
951153953 3:19326278-19326300 TGTCATGGCAGGCAGGGGCACGG - Intronic
951364772 3:21768141-21768163 TCCCATGACAGGAATGGCCTGGG - Intronic
952901724 3:38115613-38115635 CTCAGGGGCAGGCATGGCCAGGG - Intronic
953350167 3:42209584-42209606 TTTCATGGCAGGAAGGGCTAAGG + Intronic
955705322 3:61721703-61721725 TTACATGGCAGCCCTAGCCAGGG - Intronic
956860831 3:73322136-73322158 TTCTATGGGAGGCTTGACCAGGG - Intergenic
957452018 3:80391240-80391262 TTCTCTGGCAGGCAGGGGCAGGG - Intergenic
957986255 3:87575561-87575583 TTCTCTGGCAGGCAGGGGCAGGG - Intergenic
958965797 3:100556749-100556771 TTTCTTGGCAGGCATGGCTGGGG + Exonic
959663978 3:108901240-108901262 TTCCATGGCAACCATGGGGATGG + Intergenic
960428245 3:117535891-117535913 TTCCATGGAAGGCAAATCCAGGG - Intergenic
962244943 3:133784707-133784729 TTCCATGGAAGGTAGGGGCATGG - Intronic
962405218 3:135094529-135094551 TTCTGAGGCAGGCAGGGCCAAGG + Intronic
962840485 3:139228017-139228039 TTCCCTGGCAGACATGGCCCAGG - Intronic
963003947 3:140708472-140708494 TTCCAAGGAAGACATGGCTATGG - Intergenic
965417782 3:168418591-168418613 TTCGATGAAAAGCATGGCCAAGG - Intergenic
967154357 3:186678946-186678968 TACCTTGGCAGTCATGTCCATGG - Intergenic
967646413 3:191929189-191929211 TTCTCTGGCAGGCAGGGGCAGGG - Intergenic
968379684 4:80644-80666 TTCTCTGGCAGGCAGGGACAGGG + Intronic
968521973 4:1038130-1038152 CTACATGGCAGGAAGGGCCAGGG + Intergenic
969158307 4:5232722-5232744 TTGCATGGCAGGGATGGTCTGGG + Intronic
969570555 4:8005833-8005855 TTCATAAGCAGGCATGGCCAGGG + Intronic
970984096 4:22135420-22135442 GTCCATGGAAGGCAAGGCTACGG + Intergenic
975392175 4:73833268-73833290 CTCCATGGCAGGCATGAGTACGG - Intergenic
977722395 4:100254740-100254762 TCCCATGGCAGCCATGGGAATGG - Intergenic
977782788 4:100997254-100997276 TTCTCTGGCAGGCAGGGGCAGGG + Intergenic
979795705 4:124844039-124844061 TTCCATAGCAGGAATAGACAAGG + Intergenic
984412258 4:179409094-179409116 TTCTCTGGCAGGCAGGGGCAGGG - Intergenic
985881568 5:2642300-2642322 CTCCATGGCAGGCAGGGACTGGG - Intergenic
986442450 5:7793986-7794008 TTCCATAACAGGCATGCCAAGGG + Intronic
986865050 5:11976546-11976568 CTCCAGGGCAGGAGTGGCCAAGG + Intergenic
987401910 5:17486652-17486674 TGCCATGGCTGGAATAGCCAAGG + Intergenic
987403158 5:17498650-17498672 TGCCATGGCTGGAATAGCCAAGG + Intergenic
987409998 5:17605200-17605222 TGCCATGGCTGGAATAGCCAAGG + Intergenic
987412927 5:17632507-17632529 TGCCATGGCTGGAATAGCCAAGG + Intergenic
987413201 5:17634879-17634901 TGCCATGGCTGGAATAGCCAAGG + Intergenic
987414582 5:17649465-17649487 TGCCATGGCTGGAATAGCCAAGG + Intergenic
988069831 5:26273785-26273807 GTCTATTGCAGGCATGCCCAGGG - Intergenic
989689176 5:44119917-44119939 TTCTCTGGCAGGCAGGGGCAGGG + Intergenic
991274674 5:64830499-64830521 ATTCATGACAGGCATGGGCAAGG + Intronic
992292771 5:75296646-75296668 TGCAATGGCATGCATGGCAATGG - Intergenic
992871286 5:81007925-81007947 TTCCATAACTGCCATGGCCAAGG - Intronic
994506857 5:100654287-100654309 TTCCAGGAAAGGAATGGCCATGG - Intergenic
997497863 5:134345640-134345662 TTCTTTGGCAGGCAGGGGCAGGG + Intronic
997855100 5:137366045-137366067 TGCCATGGGAGGCAGGGACAGGG + Intronic
999051099 5:148524592-148524614 TTCCATGCCATGCCTGGGCATGG - Intronic
999428599 5:151507365-151507387 CTCGATGGCAGGCATGGCTTGGG + Exonic
1000749661 5:165078247-165078269 TTCCACTACAGGCATTGCCAGGG - Intergenic
1001028466 5:168244330-168244352 GGACATGGCTGGCATGGCCAGGG - Intronic
1001268211 5:170290568-170290590 CTCCATGGCAGGCAGGGAGACGG - Intronic
1002442124 5:179269955-179269977 TGCCAAGGCCAGCATGGCCAGGG + Intronic
1006175038 6:32116487-32116509 GGCCATGGCAGGCATCACCAGGG + Exonic
1006970304 6:38037156-38037178 TTCTAAGGTAGACATGGCCAAGG - Intronic
1008067206 6:47062181-47062203 GTCCATGGCAGCCATTGTCAGGG + Intergenic
1012246929 6:96936808-96936830 TTCTAAGGCAGGAATGGGCAAGG - Intronic
1012914776 6:105157529-105157551 TTCTATGGCTGACATGGGCATGG - Intergenic
1015076522 6:129165591-129165613 TGACATGGCTGGCATGGCCTTGG - Exonic
1015886231 6:137921596-137921618 TTCCCTAGCAGGCATGGGCTTGG - Intergenic
1018459792 6:163986627-163986649 TTTCATGTGAGGCATGACCATGG - Intergenic
1018787722 6:167121361-167121383 TTTCCAGGCAGGCATTGCCAGGG + Intergenic
1018854248 6:167664107-167664129 TTCCACGTCAGGCAGGGCTAGGG - Intergenic
1018869077 6:167767862-167767884 TACGATGGCAGGCAGGGCCTGGG - Intergenic
1019126663 6:169845291-169845313 TTCCATGGCAGGTAGGGCACTGG + Intergenic
1019153090 6:170022181-170022203 AACCATGGCAGGCATCACCAGGG - Intergenic
1021939341 7:25664244-25664266 TTCCATGCCAGGCAGGGCAGAGG + Intergenic
1023185482 7:37528804-37528826 TTCCATGGCAGAATGGGCCAGGG + Intergenic
1023990636 7:45126323-45126345 TTTCAGGGCAAGCAGGGCCAGGG + Intergenic
1024189837 7:46994696-46994718 TTCCATGGGCTGCATGGCCCTGG - Intergenic
1026018911 7:66693411-66693433 TTCCAGGGCAGGCCTGGCTCAGG + Intronic
1026217815 7:68365126-68365148 GTGCCTGGCAGGCATGGCCATGG + Intergenic
1030682421 7:112448278-112448300 TTCTGCGGCAGGCCTGGCCATGG - Intronic
1031005843 7:116470406-116470428 TTCGATGGTAGGCTTAGCCAGGG - Intronic
1032164399 7:129534093-129534115 TTCTCTGGCAGGCAGGGGCAGGG + Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1033212225 7:139468454-139468476 TTCTCTGGCAGGCAGGGGCAAGG - Intronic
1034433175 7:151050974-151050996 TCCCATGGCGGGCAGGGCCCAGG + Intronic
1034496696 7:151427489-151427511 TCCCAGGGCAGGCATGGACCAGG + Intergenic
1035333278 7:158110368-158110390 TTCCATGGCAGGCATGGCCATGG - Intronic
1036162093 8:6398890-6398912 TTCCAAGGCTCGCATGGCAAAGG - Intergenic
1038643050 8:29342605-29342627 TTCTCTCCCAGGCATGGCCATGG + Intronic
1038732328 8:30138705-30138727 ACCCATGGCAGCCACGGCCAGGG + Exonic
1043706125 8:83352871-83352893 TTCCAAGGCTTGCATGGCAAAGG + Intergenic
1045040239 8:98216775-98216797 TTCTTTGGCAGGCTTGGTCATGG - Intronic
1045558201 8:103235360-103235382 TCCCATGGCAGGAGTTGCCAGGG + Intergenic
1048316988 8:133369906-133369928 TTCCATGCCAGGCAGAGACAGGG + Intergenic
1048561486 8:135542749-135542771 TTCCATGAGAGACAAGGCCAAGG + Exonic
1048814664 8:138321199-138321221 ATCCATGGCAAGCATGGGCATGG + Intronic
1048878627 8:138855904-138855926 TTCCACAGCAGGGAAGGCCAGGG - Intronic
1048888292 8:138925957-138925979 TTCTCTGGCAGGCAGGGACAGGG + Intergenic
1049288375 8:141788778-141788800 GTGCAGGGCAGGCATGGCCAGGG + Intergenic
1052632838 9:31062568-31062590 AGCCATGGAAGTCATGGCCACGG + Intergenic
1055621322 9:78127806-78127828 TTCCATGGCAGGCTGGTGCAGGG + Intergenic
1055831399 9:80383304-80383326 TTCCAAGGCTGGCATAGACAGGG - Intergenic
1056656551 9:88514316-88514338 TTCCCTGGCGGGCAGGGGCAGGG + Intergenic
1056715233 9:89023063-89023085 TTCCAAAGAAGGCAAGGCCAGGG - Intronic
1057383383 9:94588331-94588353 TTCTATGCCAGTCAGGGCCAGGG + Intronic
1057502415 9:95606034-95606056 TTCCATGGCGGGCCTGGGCCTGG + Intergenic
1057855274 9:98596579-98596601 TTCCATGGCAGGGCTGGGCTGGG - Intronic
1057920247 9:99091401-99091423 GTCCATGCCAGGGAAGGCCAGGG + Intergenic
1058388570 9:104467762-104467784 TTCCATTTCTGACATGGCCATGG + Intergenic
1058887266 9:109330881-109330903 TACCAGGGCAGGCAGGCCCACGG - Intergenic
1059582900 9:115571206-115571228 TTCTGTGGCAGGCATTGCAAAGG - Intergenic
1061793842 9:133072059-133072081 GTCCATGGCAGGAAATGCCAGGG - Intronic
1062651344 9:137579278-137579300 TTCCATGACAGGCCTTGCCCCGG + Intergenic
1203526856 Un_GL000213v1:98315-98337 GTGCATGCCAGGCAAGGCCAAGG - Intergenic
1189576652 X:42360961-42360983 TTCTGTGTCTGGCATGGCCACGG - Intergenic
1190713679 X:53087175-53087197 TTCCATTGAGGGCAAGGCCAGGG + Intronic
1190990721 X:55547500-55547522 TCCCATGCCAGTCATGGCTATGG - Intergenic
1191011872 X:55768825-55768847 TTCCATGGCATGGATGGCACTGG - Intergenic
1196457238 X:115899204-115899226 TTACATGGCAGCCATGGCAAGGG + Intergenic
1200042594 X:153380766-153380788 ATCCCTGGCCCGCATGGCCACGG + Intergenic
1201698285 Y:16851962-16851984 TTCTCTGGCAGGCAGGGGCAGGG + Intergenic