ID: 1035335383

View in Genome Browser
Species Human (GRCh38)
Location 7:158124704-158124726
Sequence GAGCCCAGCTGCCGGGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035335372_1035335383 18 Left 1035335372 7:158124663-158124685 CCTCCCAGACGGGACAGGTGCAG 0: 1
1: 0
2: 0
3: 27
4: 253
Right 1035335383 7:158124704-158124726 GAGCCCAGCTGCCGGGGCGGAGG No data
1035335373_1035335383 15 Left 1035335373 7:158124666-158124688 CCCAGACGGGACAGGTGCAGAGC No data
Right 1035335383 7:158124704-158124726 GAGCCCAGCTGCCGGGGCGGAGG No data
1035335374_1035335383 14 Left 1035335374 7:158124667-158124689 CCAGACGGGACAGGTGCAGAGCT 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1035335383 7:158124704-158124726 GAGCCCAGCTGCCGGGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035335383 Original CRISPR GAGCCCAGCTGCCGGGGCGG AGG Intronic