ID: 1035335660

View in Genome Browser
Species Human (GRCh38)
Location 7:158125923-158125945
Sequence TCTTCTCGCTGAACCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 122}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035335654_1035335660 12 Left 1035335654 7:158125888-158125910 CCCGTCCTGGCACCCTGCTGGTT No data
Right 1035335660 7:158125923-158125945 TCTTCTCGCTGAACCCCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 122
1035335656_1035335660 7 Left 1035335656 7:158125893-158125915 CCTGGCACCCTGCTGGTTCTCGT No data
Right 1035335660 7:158125923-158125945 TCTTCTCGCTGAACCCCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 122
1035335657_1035335660 0 Left 1035335657 7:158125900-158125922 CCCTGCTGGTTCTCGTGATGCGC 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1035335660 7:158125923-158125945 TCTTCTCGCTGAACCCCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 122
1035335655_1035335660 11 Left 1035335655 7:158125889-158125911 CCGTCCTGGCACCCTGCTGGTTC No data
Right 1035335660 7:158125923-158125945 TCTTCTCGCTGAACCCCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 122
1035335658_1035335660 -1 Left 1035335658 7:158125901-158125923 CCTGCTGGTTCTCGTGATGCGCT 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1035335660 7:158125923-158125945 TCTTCTCGCTGAACCCCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 122
1035335653_1035335660 13 Left 1035335653 7:158125887-158125909 CCCCGTCCTGGCACCCTGCTGGT No data
Right 1035335660 7:158125923-158125945 TCTTCTCGCTGAACCCCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 122
1035335651_1035335660 24 Left 1035335651 7:158125876-158125898 CCTCGGCTGCACCCCGTCCTGGC No data
Right 1035335660 7:158125923-158125945 TCTTCTCGCTGAACCCCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 122
1035335649_1035335660 29 Left 1035335649 7:158125871-158125893 CCGGACCTCGGCTGCACCCCGTC 0: 1
1: 0
2: 0
3: 5
4: 153
Right 1035335660 7:158125923-158125945 TCTTCTCGCTGAACCCCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035335660 Original CRISPR TCTTCTCGCTGAACCCCTGA GGG Intronic