ID: 1035339369

View in Genome Browser
Species Human (GRCh38)
Location 7:158150679-158150701
Sequence GGTGAGATCTGTCATGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035339367_1035339369 -7 Left 1035339367 7:158150663-158150685 CCAGGGGGGTCACTGAGGTGAGA 0: 1
1: 0
2: 0
3: 10
4: 194
Right 1035339369 7:158150679-158150701 GGTGAGATCTGTCATGCAGAGGG No data
1035339353_1035339369 27 Left 1035339353 7:158150629-158150651 CCTGCCCCTCTAATTCCACCCTT 0: 1
1: 0
2: 2
3: 12
4: 283
Right 1035339369 7:158150679-158150701 GGTGAGATCTGTCATGCAGAGGG No data
1035339366_1035339369 -6 Left 1035339366 7:158150662-158150684 CCCAGGGGGGTCACTGAGGTGAG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1035339369 7:158150679-158150701 GGTGAGATCTGTCATGCAGAGGG No data
1035339356_1035339369 21 Left 1035339356 7:158150635-158150657 CCTCTAATTCCACCCTTGTGAAC 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1035339369 7:158150679-158150701 GGTGAGATCTGTCATGCAGAGGG No data
1035339357_1035339369 12 Left 1035339357 7:158150644-158150666 CCACCCTTGTGAACATAACCCAG 0: 1
1: 0
2: 0
3: 15
4: 102
Right 1035339369 7:158150679-158150701 GGTGAGATCTGTCATGCAGAGGG No data
1035339354_1035339369 23 Left 1035339354 7:158150633-158150655 CCCCTCTAATTCCACCCTTGTGA 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1035339369 7:158150679-158150701 GGTGAGATCTGTCATGCAGAGGG No data
1035339362_1035339369 8 Left 1035339362 7:158150648-158150670 CCTTGTGAACATAACCCAGGGGG 0: 1
1: 0
2: 0
3: 2
4: 83
Right 1035339369 7:158150679-158150701 GGTGAGATCTGTCATGCAGAGGG No data
1035339355_1035339369 22 Left 1035339355 7:158150634-158150656 CCCTCTAATTCCACCCTTGTGAA 0: 1
1: 0
2: 1
3: 11
4: 807
Right 1035339369 7:158150679-158150701 GGTGAGATCTGTCATGCAGAGGG No data
1035339360_1035339369 9 Left 1035339360 7:158150647-158150669 CCCTTGTGAACATAACCCAGGGG 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1035339369 7:158150679-158150701 GGTGAGATCTGTCATGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035339369 Original CRISPR GGTGAGATCTGTCATGCAGA GGG Intronic
No off target data available for this crispr