ID: 1035339390

View in Genome Browser
Species Human (GRCh38)
Location 7:158150840-158150862
Sequence GAACAGAAAGGAGGCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1833
Summary {0: 2, 1: 3, 2: 67, 3: 373, 4: 1388}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035339390_1035339401 28 Left 1035339390 7:158150840-158150862 CCACTCTGGCCTCCTTTCTGTTC 0: 2
1: 3
2: 67
3: 373
4: 1388
Right 1035339401 7:158150891-158150913 CCTACTGGTTTGCAGCAAATGGG 0: 1
1: 0
2: 0
3: 9
4: 74
1035339390_1035339399 27 Left 1035339390 7:158150840-158150862 CCACTCTGGCCTCCTTTCTGTTC 0: 2
1: 3
2: 67
3: 373
4: 1388
Right 1035339399 7:158150890-158150912 TCCTACTGGTTTGCAGCAAATGG No data
1035339390_1035339398 13 Left 1035339390 7:158150840-158150862 CCACTCTGGCCTCCTTTCTGTTC 0: 2
1: 3
2: 67
3: 373
4: 1388
Right 1035339398 7:158150876-158150898 TGCTGGTGGAATTATCCTACTGG 0: 1
1: 0
2: 0
3: 7
4: 120
1035339390_1035339394 -1 Left 1035339390 7:158150840-158150862 CCACTCTGGCCTCCTTTCTGTTC 0: 2
1: 3
2: 67
3: 373
4: 1388
Right 1035339394 7:158150862-158150884 CTTCCAACCCAACGTGCTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 112
1035339390_1035339393 -4 Left 1035339390 7:158150840-158150862 CCACTCTGGCCTCCTTTCTGTTC 0: 2
1: 3
2: 67
3: 373
4: 1388
Right 1035339393 7:158150859-158150881 GTTCTTCCAACCCAACGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035339390 Original CRISPR GAACAGAAAGGAGGCCAGAG TGG (reversed) Intronic
900320393 1:2080721-2080743 GGACAGAAAGGGGGCAGGAGGGG - Intronic
900827203 1:4936247-4936269 GAACAGAACGGGGGCCCGAATGG - Intergenic
901007177 1:6177824-6177846 AAGCAGCAAGGAGGCCAGCGTGG + Intronic
901259368 1:7860383-7860405 GAACAGCCAGGAGGCCCGTGTGG + Intergenic
901472392 1:9466687-9466709 GCCCAGCAAGCAGGCCAGAGAGG - Intergenic
901481280 1:9527040-9527062 GAACTGAAAGGAGGCCCGTGTGG - Intergenic
901485643 1:9558997-9559019 GAACAAAAAGGAGGCTGGAGAGG - Intronic
901677177 1:10892362-10892384 GAGCAGCAAGGAGGCCAGTGGGG - Intergenic
901860280 1:12069979-12070001 GAACAGGAAGGAGGCCGGGGTGG + Intronic
901987558 1:13088138-13088160 AAACAGAAAGGCAGACAGAGAGG + Intergenic
901994254 1:13138629-13138651 AAACAGAAAGGCAGACAGAGAGG - Intergenic
902097507 1:13958792-13958814 GAACAGAGAGGAGACCAATGTGG + Intergenic
902195582 1:14795746-14795768 GAAAAGCAAGGAGGTCAGAGGGG - Intronic
902283237 1:15389476-15389498 GAAGAGAAAGGAGGGAAGAGAGG + Intronic
902375620 1:16028775-16028797 GAGAAGCAAGGTGGCCAGAGCGG - Exonic
902619425 1:17642328-17642350 GGACAGAAGGAAGCCCAGAGTGG + Intronic
902644467 1:17788775-17788797 AACCAGAAAGGAACCCAGAGTGG + Intronic
902655988 1:17868776-17868798 GAACAGCAAGGAGATCAGTGGGG + Intergenic
902667022 1:17946660-17946682 GAACAGCAAGGAGGCCATTGTGG + Intergenic
902760599 1:18578360-18578382 GAACAGCGAGAAGGCCAGAGGGG + Intergenic
902812813 1:18898663-18898685 GAACATAAGGGAGCCCAGAGAGG + Intronic
902897330 1:19487798-19487820 GGCCAGACAGGAGGCCAGTGTGG + Intergenic
902921076 1:19666214-19666236 GGGCAGGAAGGAGGCGAGAGCGG - Exonic
902921740 1:19670122-19670144 GAACAGCAAGGAGGCCAGTATGG - Intronic
902961174 1:19963728-19963750 GAGCAGCAAGAAGGCCAGAGTGG - Intergenic
903120737 1:21215505-21215527 GAAGAGGAAGGAGGCCAAGGCGG + Intergenic
903232443 1:21930123-21930145 GAAAAGCAAGGAGGCCCGTGGGG - Intronic
903274057 1:22209602-22209624 GAAGAGCAAGGAGGTCTGAGTGG + Intergenic
903377472 1:22875961-22875983 GAACAGAAAGGCTGCCAGTGTGG + Intronic
903477437 1:23629186-23629208 GAACAGCAAGGAGGCCAGTGGGG - Intronic
903696167 1:25208766-25208788 AAGCAGCAAGGAGGCCAGTGTGG - Intergenic
903710217 1:25317811-25317833 GAACAGTAAGGAGACCAGTGTGG + Intronic
903716899 1:25374595-25374617 GAACAGTAAGGAGACCAGTGTGG - Intronic
903786765 1:25866325-25866347 GAGCAGTAAGGAGGCCCCAGAGG - Intronic
903790792 1:25891682-25891704 GTACAGAGAGGCGGCCAGTGGGG + Intronic
903956146 1:27027436-27027458 GAACATCAGGGAGGCCAGTGTGG - Intergenic
904089661 1:27935911-27935933 GAACAGCAAGGAAGCCCGCGTGG + Intronic
904200633 1:28816966-28816988 GAACAGACAGGAGGCCAGGTAGG - Intronic
904255148 1:29249980-29250002 GCACAGAAAGGAGCCCAGGTTGG - Intronic
904442247 1:30539471-30539493 GTACAGAAAACAGGTCAGAGGGG - Intergenic
904449815 1:30603632-30603654 GGACAGCCAGGAGGCCAGTGTGG + Intergenic
904551735 1:31324719-31324741 GCACAGGAGGGAGGCCAAAGGGG + Intronic
904555259 1:31358193-31358215 GAACATTAAGGACGCCAGTGTGG + Intronic
904675217 1:32195053-32195075 GCCCTGAGAGGAGGCCAGAGGGG + Exonic
904754943 1:32763410-32763432 GAAGAGAGAGGAGGCCAGTATGG - Intronic
904804773 1:33123033-33123055 GAACAGAGGGGAGGCCAGTGTGG - Intergenic
904888058 1:33756616-33756638 GGACAGAAGGGAGGCCAGCATGG + Intronic
904961149 1:34334004-34334026 GAAAAACAAGGAGGCCAGTGTGG - Intergenic
905076029 1:35270829-35270851 GAACAGAAAGAGGGATAGAGGGG - Intronic
905111350 1:35596988-35597010 GAACAGAAAGGAAACCAATGTGG - Intergenic
905268272 1:36769990-36770012 GAACAGCAAAGAGGCCACTGTGG - Intergenic
905305346 1:37013958-37013980 GAACAGAAAGAAGGCCCATGTGG - Intronic
905460645 1:38120736-38120758 GAACAGCCAGGAGGGCAGTGGGG - Intergenic
905476702 1:38233789-38233811 GATCAGAGAGGTGGGCAGAGTGG - Intergenic
905509091 1:38504235-38504257 GAAGAGACTGGAGCCCAGAGAGG + Intergenic
905536336 1:38725036-38725058 GAAGAAACAGAAGGCCAGAGAGG + Intergenic
905554453 1:38871302-38871324 GAAGTCTAAGGAGGCCAGAGTGG - Intronic
905624975 1:39483540-39483562 GAACAGCAAGGAAGCTAGTGTGG + Intronic
905696024 1:39974289-39974311 GGACAGAAAGGAGACCAGTGTGG + Intergenic
905813973 1:40933626-40933648 GAACTCAGAGAAGGCCAGAGTGG + Intergenic
905956933 1:42005013-42005035 GGACAGCAAGGAGGCCAGCGTGG - Intronic
905958989 1:42027549-42027571 GAACAGCAAGGAGGACATTGTGG - Intronic
906071899 1:43022982-43023004 GGACTGAAAAGAGGCCAGTGTGG + Intergenic
906100308 1:43256074-43256096 GAACTGAAAGGACGCCAATGTGG - Intronic
906114235 1:43345451-43345473 GCACAGAAAGAAGGCCTGTGCGG + Intronic
906305709 1:44717523-44717545 GAACACAAAGGAAGCCAGGTTGG - Intronic
906364350 1:45193443-45193465 AAACAGAAAGAAAGCCAGAATGG + Intronic
906367584 1:45223401-45223423 GAATAGAAAGGCGGGAAGAGTGG + Intronic
906452042 1:45958557-45958579 GAACAGAAAGAGGGAGAGAGAGG - Intronic
906634674 1:47401169-47401191 GAACAGCAAGGAGACCCGTGTGG - Intergenic
906665624 1:47619788-47619810 GACCAGAAAGAAGGCCAGCGTGG + Intergenic
906705298 1:47890438-47890460 TAACAGAAAGGAGGCCAGCAAGG - Intronic
906824058 1:48959777-48959799 GAGCAGCAAAGAGGCCAGTGTGG + Intronic
906831019 1:49032114-49032136 GAACTGTAAGAAGGCCAGTGTGG + Intronic
906916870 1:50021953-50021975 GAACTGAAAGGAGACAAGTGTGG - Intronic
906942045 1:50264007-50264029 GAACCTAAAGGAGGGCAGGGAGG - Intergenic
907020272 1:51060110-51060132 CAGCAGAGAGGAGACCAGAGTGG - Intergenic
907256549 1:53183416-53183438 GGAAAGCAAGGAGGCCAGTGTGG + Intergenic
907477473 1:54715292-54715314 GAACAGCAAGGAGGCCAGTGGGG - Intronic
907533137 1:55122329-55122351 GAACAGCAAGGAGCCCAGGGTGG + Intronic
907677250 1:56529876-56529898 AGACAGCAAAGAGGCCAGAGAGG + Intronic
907697375 1:56745867-56745889 GAGCTGCAAGGAGGCCAGTGTGG - Intronic
907817731 1:57936915-57936937 GAAGAGAAAGGAGGCCAGTGTGG - Intronic
907869964 1:58433988-58434010 AAACAGCAAGGAGGCCAATGAGG + Intronic
907900954 1:58741008-58741030 GAACAGAAAGAAGGGGAGAGGGG + Intergenic
908007710 1:59743823-59743845 GGACAGAAAGGAGGCTGCAGGGG - Intronic
908280797 1:62532825-62532847 AAACAGAAAGTAGGCCAGCATGG + Intronic
908309005 1:62856980-62857002 GAACAGAAAGCAAGCCAGCGTGG - Intronic
908338844 1:63155447-63155469 GAATAGAAATGGGGCCAGATCGG + Intergenic
908432290 1:64071075-64071097 GAACAGAAAGAAGGCCAGCGTGG + Intronic
908621563 1:65986987-65987009 GAACAAAAAGGAGGCCAGTGTGG + Intronic
908641399 1:66228045-66228067 TAACAGCAAGTAGGCCAGTGTGG - Intronic
908727550 1:67193066-67193088 GAGCAGCAAGGAGGTCAGTGAGG - Intronic
908869467 1:68592257-68592279 GAAGAGAAAGCAGCCCAGTGTGG - Intergenic
909004953 1:70265002-70265024 GAACAGCCAGGAGGCCAATGTGG + Intronic
909258492 1:73455496-73455518 GAACAGCAAAAAGGCCAGTGTGG - Intergenic
909406135 1:75291685-75291707 GGACAGAAAGGAGACCAGTGTGG + Intronic
909679066 1:78271013-78271035 GAACAGCAAGAAGGCCAATGTGG - Intergenic
909762128 1:79303095-79303117 AATCAGCAAGGAGGCCAGTGAGG - Intergenic
910060170 1:83081464-83081486 GACATGAAAGGAGGCCAGTGTGG + Intergenic
910087366 1:83419514-83419536 GAACAGCAGGGTGGCCAGTGTGG - Intergenic
910184397 1:84521426-84521448 GAACAGAAAGGAGGCTGATGTGG - Intergenic
910521213 1:88124309-88124331 GGACTGAAAGAAGACCAGAGTGG - Intergenic
910659242 1:89652967-89652989 GAACAGCAAGAAGGCCAGTGTGG + Intronic
911098229 1:94073224-94073246 GAACAGAAAGGAGAAGATAGCGG - Intronic
911199922 1:95034041-95034063 GAACAGACAGAAGACCAGTGTGG - Intronic
911293694 1:96087773-96087795 GAACAGCAAGAAGGAGAGAGAGG - Intergenic
911936302 1:103978535-103978557 GAACAGAAAGAAGACCAGTATGG - Intergenic
912017453 1:105059957-105059979 GAACAGAAAGAAAGGGAGAGGGG + Intergenic
912210393 1:107550771-107550793 GACCAGAAAGGAGGCCAATACGG + Intergenic
912497967 1:110103411-110103433 GTACTCAAAGGAGGCCTGAGAGG - Intergenic
912560289 1:110546656-110546678 GAACAGCAAGGAGGCCATTATGG - Intergenic
912664299 1:111565170-111565192 GAATGGGAAGGAGGCCAGTGTGG + Intronic
912884677 1:113457942-113457964 GGACAGAAAGGAGGCCAATGTGG + Intronic
913164817 1:116175341-116175363 GAACTGCAAGGAGGTCAGCGTGG + Intergenic
913262135 1:117008732-117008754 AAAGAGTAAGGAGACCAGAGTGG - Intronic
913435344 1:118841730-118841752 GAACTGAAAGAAGGTCAGTGTGG - Intergenic
914424543 1:147562975-147562997 GAACTGAAAAAAGGCCAGTGTGG - Intronic
914701641 1:150139327-150139349 GAACAGAAAGAAGGTTAGTGTGG - Intronic
914810997 1:151028041-151028063 GAACAGAAAAGAAACCAGTGTGG - Intronic
914976506 1:152368668-152368690 GAACATCAAGGAGGCCAGTGTGG - Intergenic
915030399 1:152875297-152875319 GAACAGCAAGGAGGTGAGTGTGG + Intergenic
915072907 1:153287083-153287105 GAACACCAAAGAGGCCAGTGAGG + Intergenic
915737401 1:158093777-158093799 GAGAAGGCAGGAGGCCAGAGAGG - Intronic
915899722 1:159837729-159837751 GAAGAGAGTGGAGGCCAGAGGGG + Intronic
915914357 1:159932098-159932120 GAACAGAAACAGAGCCAGAGAGG - Intronic
915986628 1:160472360-160472382 GAAAAGCAAGGAAGCCAGTGTGG + Intergenic
915996848 1:160572331-160572353 CAACAGTGAGGAGGCAAGAGTGG + Intronic
916062885 1:161113483-161113505 TAACAGAAGGTAGGCCTGAGCGG + Intronic
916107120 1:161440675-161440697 GAAAAGACAGGAGGCCAAGGAGG + Intergenic
916166352 1:161970138-161970160 GTAAAGAAAGGAGGGGAGAGAGG + Intergenic
916250878 1:162736881-162736903 GAACAACAAGGAGGCCAGTGTGG + Intronic
916511322 1:165474573-165474595 GAAGAGGGAGGAGGCCAGTGTGG + Intergenic
916517383 1:165532326-165532348 AAACAGGAAGGAGGCCAGTGTGG + Intergenic
916576995 1:166076309-166076331 GAACAGCACAGAGGCCAGAATGG - Intronic
916672611 1:167036707-167036729 GAAGAGTAAGGAGGACAGTGTGG - Intergenic
916755702 1:167768249-167768271 GAACAGAAGTGAGGCTAAAGTGG - Intronic
916796603 1:168173306-168173328 GAAGAGCAAGAAGGCCAGTGTGG - Intergenic
916821310 1:168401277-168401299 AAAGGGAAAGGAGGCCAGTGTGG + Intergenic
916922936 1:169487630-169487652 AAAGAGAAAGCAAGCCAGAGAGG + Intergenic
916965566 1:169938907-169938929 GAAGAGAAGGGAGTCCAGAGTGG + Intronic
916971166 1:170018023-170018045 AAACAGATAGCAGGCCAGATAGG - Intronic
916990718 1:170241608-170241630 GAACAGAAAGAAGGTCAGTGAGG - Intergenic
917039943 1:170793924-170793946 GAACAGAAAGGAGGGCAATGTGG - Intergenic
917516310 1:175711390-175711412 GAACAGGAAGGAGGCCAGTGTGG + Intronic
917958514 1:180124654-180124676 GAATAGAAAGAAGACCAGTGCGG + Intergenic
918103246 1:181394833-181394855 GAACAACATGGAGGCCAGTGTGG + Intergenic
918104041 1:181401065-181401087 GAGCAGCAAGGAGGCCAGTGTGG - Intergenic
918237202 1:182592181-182592203 CAGCAGCAAGGAGGCCAGTGAGG + Intergenic
918316192 1:183324582-183324604 GAACTCAAAGAAAGCCAGAGTGG - Intronic
918368158 1:183831328-183831350 GAACTGAAGGAAGGCCAGTGTGG + Intronic
918413251 1:184282419-184282441 GAACAGCAAGGAGGCCAGCATGG + Intergenic
918503793 1:185228915-185228937 GAACTGAAAGAAGGCCAGTGTGG + Intronic
918522066 1:185425425-185425447 GAACTGACAGGAGGCCTGAGAGG + Intergenic
918715251 1:187778438-187778460 GAACAGCAAGGAGGTCAGGGTGG + Intergenic
919083877 1:192897520-192897542 TAGCAGAAAGGAGCCAAGAGAGG + Intergenic
919339485 1:196285742-196285764 GAACAGAAAGAACGGGAGAGAGG - Exonic
919469159 1:197957516-197957538 GAACAGAAAACAGGTCAGGGTGG + Intergenic
919513491 1:198494358-198494380 GCACAGGAAGGAGGCCAAGGGGG - Intergenic
919540476 1:198839278-198839300 TAACAGCAAGGTGGCCAGTGGGG + Intergenic
919608796 1:199719677-199719699 GAAAAGAAAGGAGAGGAGAGAGG + Intergenic
919661866 1:200255338-200255360 GAACAGAAAGCCTGGCAGAGTGG + Intergenic
919788383 1:201274720-201274742 GAACAGAAAGGTGCCGAGAGAGG + Intergenic
919924494 1:202185415-202185437 GACCAGAAAGGTGGGCAGGGAGG + Intergenic
920615285 1:207486347-207486369 GCACAGCAAGGAGGCCAGTGTGG + Intronic
920873458 1:209813226-209813248 GACCAGCAGGGAGGCCAGTGTGG + Intergenic
920912077 1:210228389-210228411 GAACAGAAAGGAGGCCAGAGTGG + Intergenic
920940962 1:210481944-210481966 GAATAGCAAGAAGGCCAGTGTGG + Intronic
920953914 1:210599916-210599938 GAACAGAAAGAAGAACAGAGAGG - Intronic
921422366 1:214963335-214963357 CAACAGAAAGAGGGACAGAGAGG - Intergenic
921862402 1:220053554-220053576 GAACTTAAAGGAAGCCACAGTGG - Intergenic
922158889 1:223063348-223063370 GAACAGCCAAGAGGCCAGCGTGG - Intergenic
922359935 1:224812033-224812055 GAACAAAAAGCAGGCAGGAGAGG + Intergenic
922500792 1:226095547-226095569 GGAGCGAAAGCAGGCCAGAGAGG + Intergenic
922502709 1:226109128-226109150 GAAGAGCAGGGAGGCCAGAGTGG - Intergenic
922503683 1:226114744-226114766 GAACAGAAAGGGGGCAAAGGTGG - Intergenic
922577483 1:226672032-226672054 GAACAGAAAGCAGGCGAGAAAGG + Intronic
922633567 1:227140545-227140567 GCCCAGAAAGGAGGCCTGTGTGG + Intronic
922646219 1:227289302-227289324 GAACAGAAGGAAGACCAGTGTGG - Intronic
922776461 1:228216355-228216377 GCACAGAAAGGTGAACAGAGGGG - Intronic
923138616 1:231140948-231140970 GAGCAGCAAGGAGGCCAGAAGGG + Intergenic
923259838 1:232258145-232258167 GAGCAGCAAGGTGGCCAGGGTGG + Intergenic
923326266 1:232882915-232882937 GAACAGCAAAGAGGTCAGAGTGG - Intergenic
923424401 1:233854371-233854393 GGCAAGAAAGGAAGCCAGAGAGG - Intergenic
923720759 1:236464775-236464797 GCAGAGAAAGGAGGTCAGAGAGG - Intronic
923839329 1:237651006-237651028 GAACAGAAAGGAGGAAAAAAAGG - Intronic
923905863 1:238383014-238383036 AAAGAGAAAGGAGGTCAAAGAGG - Intergenic
924124958 1:240840571-240840593 GTACACAAAGAAGGCCAGTGAGG - Intronic
924283884 1:242465606-242465628 GAACAGCAGAGAGGCCAGTGTGG - Intronic
924510149 1:244723302-244723324 GAACATAAGGGAGGCTGGAGAGG + Intergenic
924559144 1:245143280-245143302 GGACAGACAGGTGGACAGAGTGG - Intergenic
924559192 1:245143486-245143508 GAACAGACAGGTGGACAGAGTGG - Intergenic
924573788 1:245261022-245261044 GAAAAGAAAGAAAGACAGAGAGG - Intronic
924599695 1:245477722-245477744 GAACAGCAAGGAGTCCAGGTTGG + Intronic
924680304 1:246224384-246224406 GGACAGAAAGAAAGCCAGTGTGG + Intronic
924835328 1:247641122-247641144 TAACAGAAATAAGTCCAGAGGGG + Intergenic
1062812999 10:479634-479656 GGATAGAAAGGAGGACAGTGTGG - Intronic
1064063249 10:12157840-12157862 GAAAAGAACAGAGACCAGAGAGG - Intronic
1064256359 10:13745838-13745860 GAACAGCCAGGAGGCTACAGAGG + Intronic
1064348451 10:14554486-14554508 CAACAGAAGGGAGGCAGGAGAGG + Intronic
1064379911 10:14832297-14832319 GAACAGCCAGAAGGCCAGTGTGG + Intronic
1064959844 10:20951950-20951972 GAATAAAAAGGAGGGCAGAGAGG - Intronic
1065204058 10:23341701-23341723 GAGCAGCAAGGAGGCCAGTGTGG - Intronic
1065341227 10:24707869-24707891 GAACAGACAAGATTCCAGAGAGG - Intronic
1065364940 10:24926177-24926199 TAAGAGCATGGAGGCCAGAGGGG - Intronic
1065482596 10:26210775-26210797 GAACAGCAAGGAGACCACTGTGG - Intronic
1065585326 10:27211994-27212016 AAACAGAGAGAAGGCCAGGGTGG + Intronic
1065648906 10:27866684-27866706 TAAAAGAAAGGAAGCAAGAGAGG + Intronic
1065797753 10:29322796-29322818 GAAGAGAAAGAAGGAAAGAGAGG + Intergenic
1066029163 10:31399863-31399885 GAACAGCAAAGAAGCCAGTGTGG - Intronic
1066129838 10:32382018-32382040 GAAGGGAAATGAGGCCAGTGTGG + Intergenic
1066132855 10:32410825-32410847 GAACAACAAGGAGGCCAGAGTGG + Intergenic
1066454871 10:35564409-35564431 GAACAGTAAGGAGGCGGGTGGGG - Intronic
1066478690 10:35773792-35773814 GAACTGAAAGGAGGCCTGCATGG + Intergenic
1066999669 10:42596901-42596923 AAAAAGAAAGGAGACTAGAGTGG - Intronic
1067111188 10:43401753-43401775 GGAGAGAAAGGAGGCCTGTGGGG + Intronic
1067231884 10:44417900-44417922 GAAAAGGAAGAAGGCCAGTGTGG + Intergenic
1067414204 10:46091462-46091484 GCCCAGGAAGGAGGCCAGGGAGG - Intergenic
1067434255 10:46265977-46265999 GCCCAGGAAGGAGGCCAGGGAGG - Intergenic
1067439436 10:46300352-46300374 GCCCAGGAAGGAGGCCAGGGAGG + Intronic
1067687482 10:48475914-48475936 GAACAGCAAGGAGGCCAGTGTGG - Intronic
1067760637 10:49043022-49043044 GATTAGCAAGGAGGCCAGTGTGG + Intronic
1067773899 10:49147623-49147645 GAACAGAAAGGTGAACAGAGGGG - Intergenic
1067959165 10:50828546-50828568 GAACAGAAATGAGGCAGCAGAGG + Intronic
1068121615 10:52786586-52786608 GAACAGAACAGAGCCCACAGGGG - Intergenic
1068220750 10:54042604-54042626 GAACAGCAAGAAGCCCAGTGTGG + Intronic
1068422461 10:56812936-56812958 GAATAGGAAGAAGGCCAGTGTGG - Intergenic
1068444146 10:57098345-57098367 GAAATGAAAGGAGGCCACTGTGG - Intergenic
1068631480 10:59303104-59303126 GAACAGAGAGAAGGCCAGGGTGG - Intronic
1069032915 10:63617069-63617091 GAACTGCAAGGAGGCCAGTGTGG - Intronic
1069156206 10:65034338-65034360 GCACAGAAAGGAGGCCAAGGAGG + Intergenic
1069384575 10:67872924-67872946 GAACAGAATAGAGTCCAGAAGGG + Intergenic
1069866114 10:71503915-71503937 GAACAGAAAGAAGGCATGTGGGG + Intronic
1070026774 10:72639373-72639395 CAAGAGAAATGAGGTCAGAGAGG - Intergenic
1070183788 10:74039960-74039982 GAACTGGAAAGAGGCCAGAGTGG - Intronic
1070268026 10:74923663-74923685 AAACAGATAAGAGGCCAGTGTGG + Intronic
1070280627 10:75045645-75045667 GAACAGAAAGGAAGCCAGTGTGG + Intronic
1070319750 10:75345674-75345696 AAAAAGAAAGGACCCCAGAGGGG + Intergenic
1070381222 10:75882133-75882155 GAACCGAAAAGAGGCCTGAGTGG + Intronic
1070392926 10:75986976-75986998 GGACAGAAAGGAGAACTGAGAGG - Intronic
1070470589 10:76775381-76775403 GAAATGAAAAGAGGGCAGAGCGG + Intergenic
1070511854 10:77168986-77169008 AAACAGGCAGTAGGCCAGAGTGG + Intronic
1070672538 10:78388247-78388269 GAACAAAACAGAGGCCAGACAGG + Intergenic
1070771215 10:79083380-79083402 GAAAAGCAGGGAGGCCAGTGTGG + Intronic
1071110514 10:82150043-82150065 GAACAGCAGGGAGTCCAGATGGG - Intronic
1071394476 10:85207793-85207815 GAACAGAAAGGAGGCAAGAATGG - Intergenic
1071409653 10:85376437-85376459 GAACAGAAAGAAGGCTAGTATGG - Intergenic
1071446172 10:85749693-85749715 GAACAGAAAGTGGGCCAGTGTGG - Intronic
1071530983 10:86390121-86390143 GAGCAGACAGAAGGCCAGTGTGG + Intergenic
1071712976 10:88067842-88067864 GAACAGCAAGGTGGCCAGTATGG + Intergenic
1071967677 10:90868749-90868771 GAAGAGAAGGGAGACCAGAGAGG - Intergenic
1072008020 10:91274825-91274847 GAATTGCAAGGAGGCCAGTGGGG + Intronic
1072753270 10:97999499-97999521 GCACAGAAGGGAAGCCAAAGGGG + Intronic
1072800540 10:98389560-98389582 GCACAGGGACGAGGCCAGAGTGG - Intronic
1072894836 10:99357975-99357997 GGACAGAAACAAGGGCAGAGAGG - Intronic
1072926839 10:99623214-99623236 GAACAGAAAGAAGGCCAGTGTGG + Intergenic
1072978382 10:100078931-100078953 GAACAGCAAGGGGGCCAGTGCGG - Intronic
1073138176 10:101230926-101230948 GACCAGAAAAGGGCCCAGAGAGG + Intergenic
1073251966 10:102125842-102125864 GAAAAGAAAGAAAGACAGAGTGG - Intergenic
1073318523 10:102599790-102599812 GAACAGACAGGAGGCCAGGTTGG + Intronic
1073522665 10:104148633-104148655 GGTCAGAGAGGAGGCAAGAGAGG - Intronic
1073632624 10:105163632-105163654 GAAGAAAAAGAAGGGCAGAGAGG + Intronic
1073700050 10:105916441-105916463 GGACGGAAAGAAGCCCAGAGAGG - Intergenic
1074119347 10:110481836-110481858 GAACAGCAAGGAGGGCAGCAGGG - Intergenic
1074296183 10:112191776-112191798 GAAAAGAGTGGAGGCCAGAATGG + Intronic
1074307548 10:112292840-112292862 GCACAGCAAGGAGGCCAGTGTGG - Intronic
1074469279 10:113712572-113712594 GAGCAGACAGTAGGCAAGAGTGG - Intronic
1074534991 10:114322396-114322418 GAACAACAAGGAGGCCAGCATGG - Intronic
1074572642 10:114638321-114638343 GGAGAGAAAGTAGGCCAAAGAGG + Intronic
1075408318 10:122209434-122209456 AAACAGCGAGGAGGCCAGTGTGG - Intronic
1075659396 10:124182923-124182945 TGACAGAATTGAGGCCAGAGGGG - Intergenic
1076290888 10:129344501-129344523 GACCAGGAAGGAGGTCAGTGAGG - Intergenic
1076324462 10:129610382-129610404 GAACAGCAAGGAGGGCAGCATGG - Intronic
1076442616 10:130490799-130490821 GAGCAGGAAGGAGGAGAGAGAGG - Intergenic
1076545137 10:131240138-131240160 GCACAGAATGGAAGCCAGCGGGG - Intronic
1076993160 11:285929-285951 CAACAGAAATGAGTCCACAGGGG - Intergenic
1077492101 11:2866173-2866195 GAACTGAGAGCAGGCCCGAGTGG - Intergenic
1077695227 11:4387275-4387297 AGAAAGAAAGGAGGGCAGAGAGG + Intronic
1077695633 11:4390154-4390176 AATCAGCCAGGAGGCCAGAGAGG - Exonic
1077801419 11:5542303-5542325 GGATAGAAACAAGGCCAGAGCGG - Intronic
1078177257 11:8979073-8979095 GAATAGAAAGGCGGGAAGAGTGG + Intergenic
1078229629 11:9427828-9427850 GAACAGAAAAAAGGACATAGTGG - Intronic
1078939918 11:15991058-15991080 AAACAGGAAGGAGGGCAGAAAGG + Intronic
1079030728 11:16984495-16984517 AAACAGCAAGGAGGCCAGAGTGG - Intronic
1079140055 11:17802631-17802653 GAAGAGCAAGGAGACCAGTGTGG - Intronic
1079224089 11:18589919-18589941 ACACAGCAAGGAGGCCAGTGTGG + Intergenic
1079254064 11:18811353-18811375 GATCAGAAAGCAGGAAAGAGTGG - Intergenic
1079346381 11:19656420-19656442 GAACAGAAAGAAGGCCATTGTGG + Intronic
1079454308 11:20623710-20623732 GAACAGCAAAGAGGCCAGTGTGG - Intronic
1079554924 11:21747767-21747789 GAGAAGGAAGAAGGCCAGAGTGG - Intergenic
1079993064 11:27266845-27266867 GAACAGAAAGAAGCCTAGTGGGG - Intergenic
1080030622 11:27656933-27656955 AAACAAAGAGGAGACCAGAGGGG + Exonic
1080133469 11:28824806-28824828 CATCAATAAGGAGGCCAGAGTGG - Intergenic
1080180988 11:29426100-29426122 GTACAGTGAGGAGGCCAGGGTGG - Intergenic
1080189068 11:29523859-29523881 AAACAGAAAAGTGGACAGAGAGG + Intergenic
1080607531 11:33876002-33876024 AACCAGAAAGAAGGCCAGTGTGG - Intronic
1080740847 11:35063128-35063150 GAATAGCTAGGAGGTCAGAGTGG + Intergenic
1080795599 11:35560173-35560195 GAACAGCAGGGAGGCCGGTGTGG + Intergenic
1080819861 11:35795135-35795157 GAACAGAAAGAAAGCCAGCGTGG + Intronic
1080913135 11:36625947-36625969 GACCAGCAAGGAGGCCGGTGTGG + Intronic
1080924326 11:36740249-36740271 GAACATCAAGGAGGCCAGTGTGG + Intergenic
1081164671 11:39792949-39792971 GAACAGAAAGCAGGTCAGTGTGG - Intergenic
1081552756 11:44129423-44129445 GAACAGCAAGGAGGCTATTGTGG - Intronic
1081761494 11:45579547-45579569 GAACAGATAGGGCCCCAGAGAGG - Intergenic
1081766599 11:45615619-45615641 GAACAGTGAGGAGACCAGGGAGG + Intergenic
1081795704 11:45817933-45817955 GACCAGAGAGAAGGCCAGGGTGG + Intergenic
1081938989 11:46924708-46924730 GAACTGAAAGGGAGCCAGCGTGG - Intergenic
1082819656 11:57536449-57536471 GAATAGGAAGGAGGCCAGTGTGG + Intergenic
1082938285 11:58676663-58676685 AAGCAGTAAGGAGGCCAGTGTGG - Intronic
1083166272 11:60890054-60890076 GAACAGGAAGGAGGTCATGGTGG - Intergenic
1083190521 11:61048650-61048672 AAACAGAATGGAGGCCTGAATGG - Intergenic
1083213750 11:61205678-61205700 GAACAGCAAGCAGACCAGTGTGG + Intronic
1083216635 11:61224507-61224529 GAACAGCAAGCAGACCAGTGTGG + Intronic
1083219517 11:61243333-61243355 GAACAGCAAGCAGACCAGTGTGG + Intronic
1083408848 11:62477979-62478001 GAAGCGAAAGAAGGCCAGGGTGG + Intronic
1083553251 11:63606731-63606753 CAACAGCAAGGAGGCCAACGAGG + Intronic
1083750352 11:64757712-64757734 GAAGAGAAGGAAGCCCAGAGAGG - Intronic
1083795214 11:65012981-65013003 GAACAGATAGGCTGCCTGAGTGG - Intergenic
1083807099 11:65081066-65081088 AAACAACAAGGAGGCCAGTGTGG + Intronic
1083988370 11:66231777-66231799 AAACAGAAACGAGGGCAGTGGGG - Intronic
1084041347 11:66544500-66544522 GAACAGCAAGAAGGCCAGTGTGG - Intronic
1084168278 11:67387272-67387294 GAACAGCAAGAAGCCTAGAGCGG - Intronic
1084279855 11:68081049-68081071 GACCAGAAAGGGGGTGAGAGAGG + Intronic
1084335600 11:68455781-68455803 CCACAGAAAAGAGGCCAGTGAGG - Intergenic
1084691930 11:70732593-70732615 GAACAGCAAGAAGGGCAGCGCGG - Intronic
1084822541 11:71702811-71702833 AAAACAAAAGGAGGCCAGAGTGG + Intergenic
1084890459 11:72234240-72234262 GAACAAACAGGAGGACTGAGAGG - Intronic
1084942822 11:72622900-72622922 GAACAGATAGGGGGCAAGAGAGG + Intronic
1084960530 11:72713938-72713960 TAACGGTCAGGAGGCCAGAGAGG + Intronic
1085059784 11:73434560-73434582 GAACAGCAAAAAGGCCAGTGTGG + Intronic
1085186426 11:74579675-74579697 GATCAGAAATGAGGACAGAGAGG - Intronic
1085254645 11:75165590-75165612 GGAGAGAAATGAGGGCAGAGTGG - Intronic
1085435136 11:76493272-76493294 GCACGGGAAGGAGGCCAAAGGGG + Intronic
1085520679 11:77137465-77137487 GAAGAAAAAGGAGGAAAGAGGGG + Intronic
1085738166 11:79057309-79057331 AAGCAGCAAGGAGGCCAGAGTGG - Intronic
1086002559 11:82000026-82000048 GAAGAGAAAGGAACTCAGAGAGG + Intergenic
1086081559 11:82908237-82908259 GAGCAGAAAGAAGGCCAGCATGG + Intronic
1086495730 11:87402740-87402762 GAATAGCAAAGAGGCCAGTGCGG + Intergenic
1086678190 11:89635724-89635746 GAACAGAAACAGGGGCAGAGGGG - Intergenic
1086980745 11:93195719-93195741 GAATAGCAAGGAGGACAAAGTGG - Intronic
1086992565 11:93320304-93320326 GGACAGAGAGGGAGCCAGAGAGG - Intergenic
1087015088 11:93546871-93546893 GAACAGAAAGAAAGCCAGTTGGG - Intergenic
1087031165 11:93706024-93706046 GCACAGAAAGCAGGCAAGAGTGG - Intronic
1087111397 11:94473142-94473164 GAACAGCAAGGAGAACAGAAGGG + Intronic
1087115057 11:94515738-94515760 GAAAGGAAAGGAGGGGAGAGGGG - Intergenic
1087193921 11:95285780-95285802 GGTGAGAAATGAGGCCAGAGAGG - Intergenic
1087342013 11:96917964-96917986 GGACAGAAAGAAAGCCAGTGTGG - Intergenic
1087380499 11:97399026-97399048 GAAGAGAAAAGAGGAAAGAGTGG - Intergenic
1087416676 11:97865096-97865118 AAAAAGAAAGAAAGCCAGAGTGG + Intergenic
1087534143 11:99422792-99422814 GAACTTAAAGGAAGCCAGTGTGG + Intronic
1087740754 11:101884011-101884033 GGGCAGAAAAGAAGCCAGAGAGG - Intergenic
1088202398 11:107352904-107352926 GAGCAGAAAGAAGGCAGGAGTGG - Intronic
1088355549 11:108940318-108940340 TAACAGAAAGAAGGCCAGGTGGG + Exonic
1088533535 11:110836303-110836325 GGAAAGAAAGGAGGCCTGTGTGG - Intergenic
1088634549 11:111807319-111807341 GAAGAAACAGGAGGCCAGTGAGG - Intronic
1088828577 11:113516132-113516154 GAGCAGGAGGGAGGGCAGAGTGG - Intergenic
1088846178 11:113670008-113670030 GTGCAGAAAGGAGACAAGAGGGG + Intergenic
1088968726 11:114752235-114752257 GAACAGAAAGGAAGCCAGTATGG + Intergenic
1089109826 11:116046617-116046639 GAACAGAGGGGAGGACACAGAGG - Intergenic
1089144662 11:116316874-116316896 GAAAAGAAAGGAGGACAAAAGGG + Intergenic
1089149533 11:116354150-116354172 GGAGAGAAAGGAGGCAGGAGAGG - Intergenic
1089223434 11:116895131-116895153 GAAGAGAGATGAGGTCAGAGAGG - Intronic
1089554217 11:119306440-119306462 AATCAGACAGGAGGCCAGAGAGG + Exonic
1089630148 11:119779392-119779414 TAACATGATGGAGGCCAGAGAGG + Intergenic
1089636740 11:119819153-119819175 GAGCTGAGAAGAGGCCAGAGAGG + Intergenic
1089658259 11:119968126-119968148 GAACAGGAAGGAGGCCTCTGTGG + Intergenic
1089852878 11:121515507-121515529 GAGCAGGGAGGAGGCCAGGGTGG + Intronic
1090254715 11:125275377-125275399 GAAGAGAAAGGAGGTCAGGGAGG + Intronic
1090479869 11:127058695-127058717 AAACAGCAAGGAGGCCAGCTGGG - Intergenic
1090719528 11:129459000-129459022 GGAAAGAAAGGAGGCCAGGCCGG - Intergenic
1090906791 11:131084088-131084110 GAATAGAAAGGCGGGAAGAGTGG - Intergenic
1090946144 11:131431241-131431263 AAGCAGAAAGGATGCCCGAGGGG + Intronic
1090979746 11:131709106-131709128 GAACAGGAAGGAGGTCAATGTGG + Intronic
1091384394 12:83584-83606 GAAGGGAAGGGGGGCCAGAGGGG + Intronic
1091408137 12:221532-221554 GAAGAGAAAGGTGGCCTGAGGGG + Exonic
1091470397 12:721261-721283 AGACAGCAAGGAGGCCAGTGTGG + Intergenic
1091509048 12:1103264-1103286 GAGCAGCAAGGAGTCCATAGTGG + Intronic
1091800685 12:3322923-3322945 GAAGAGAAAGGATGAAAGAGAGG + Intergenic
1092047787 12:5444571-5444593 GAACTGAAAGAAGCCCAGGGAGG + Intronic
1092074295 12:5660402-5660424 GAACAGGAAGGAAGCCAGTGTGG - Intronic
1092078564 12:5693722-5693744 GAACAGCAAAGAGGTCAGTGTGG - Intronic
1092328524 12:7560541-7560563 GAACAGCAAGATGGCCAGTGTGG - Intergenic
1092420573 12:8328047-8328069 AAAACAAAAGGAGGCCAGAGTGG - Intergenic
1092527383 12:9317486-9317508 GACCTGAAAGGAGGCCAGTGTGG - Intergenic
1092539893 12:9414289-9414311 GACCTGAAAGGAGGCCAGTGTGG + Intergenic
1092808396 12:12249047-12249069 GAACTCAAAGAAGGCCAGAAAGG + Intronic
1093126236 12:15331476-15331498 GAACAAAAGGGAATCCAGAGAGG - Intronic
1093498473 12:19783578-19783600 CCACAGAAAAGAGGCCAGACTGG - Intergenic
1093554445 12:20453896-20453918 AAACTGTAAGGAGGCAAGAGTGG - Intronic
1093731776 12:22573371-22573393 GGCCAGAATGGGGGCCAGAGGGG - Intergenic
1093934942 12:24990536-24990558 AAACAGCAAGGAGGTCAGCGGGG - Intergenic
1094074431 12:26457308-26457330 GCACAGCCAGGAGGCCAGTGTGG + Intronic
1094080199 12:26526427-26526449 GAACAGAAAGGACACCACTGTGG + Intronic
1094332865 12:29315285-29315307 GGACAGCAAGGAGGCCAGTATGG + Intronic
1094347444 12:29486255-29486277 GAAGTGAATGGAAGCCAGAGAGG - Exonic
1094524361 12:31221938-31221960 GACCTGAAAGGAGGCCAGTGTGG - Intergenic
1095309520 12:40681321-40681343 GAACAGAAAGAAGGCCAGTGTGG + Intergenic
1095336860 12:41039012-41039034 GAACAGCAAGGAGACCAGTACGG + Intronic
1095448289 12:42303600-42303622 AGACAGTAAGGAGGCCACAGTGG + Intronic
1095658076 12:44694998-44695020 GAGAAGAAAGGAGGCCAAAGGGG + Intronic
1096078024 12:48816948-48816970 GAAGAGAAAGGATGAAAGAGGGG + Intronic
1096101932 12:48974810-48974832 GATTAGAAAAGAGGCCAGTGAGG + Intergenic
1096115636 12:49053351-49053373 GAAAGGAAATGAGGGCAGAGAGG - Intronic
1096201748 12:49688487-49688509 GAACTGCAAGAAGGCCAGACTGG - Intronic
1096417548 12:51426676-51426698 GACCTGAAATGAGGCCAGTGTGG + Intronic
1096599426 12:52718817-52718839 GAAGAGGGAGGAGGCCAGACAGG - Intergenic
1096636788 12:52965373-52965395 GAACAGGATGGGGGACAGAGAGG + Intergenic
1096777892 12:53974863-53974885 GAGCAGACAGGGGGCCCGAGGGG + Intronic
1097026082 12:56056563-56056585 GAACAGAAAGGAGGCCAGTGTGG - Intergenic
1097041289 12:56157673-56157695 GCAGAGAGAGGAGGCAAGAGGGG - Intronic
1097178562 12:57157816-57157838 GAACAGCACGAAGGCCAGCGGGG + Intronic
1097348999 12:58527009-58527031 GAACAGATAGAAGGCCTGTGTGG + Intergenic
1097516282 12:60611123-60611145 GAAAACAAAGAAAGCCAGAGAGG - Intergenic
1097933772 12:65221697-65221719 GATCAGGAAGAAGGCCAGGGTGG - Intronic
1098015711 12:66102560-66102582 AAACAGCAAGGAGTCCAGAATGG + Intergenic
1098026128 12:66203441-66203463 GAACAGAAAAGAGGCATTAGTGG + Intronic
1098090280 12:66893983-66894005 GAGTAGAAAGGAGACCAGTGTGG - Intergenic
1098130772 12:67347691-67347713 GCACAACAAGGAGGCCAGTGGGG + Intergenic
1098287170 12:68919029-68919051 GAACAGAAGTGAGACCAGGGTGG - Intronic
1098349538 12:69543795-69543817 AAACAGCAAGGAGGCCACTGTGG + Intronic
1098420573 12:70292569-70292591 GAATAGCAAGGAGGCCAGTATGG + Intronic
1098466982 12:70798579-70798601 AAACAGAAACTAGGCCAGTGTGG - Intronic
1098689754 12:73472257-73472279 TAACAGCAAAGAGGCCAGTGTGG + Intergenic
1098812879 12:75118558-75118580 GAGCAGAAAGAAGACCAGTGGGG + Intronic
1098981971 12:76966133-76966155 GAACAGCAAGATGGCCAGTGTGG - Intergenic
1098994460 12:77102853-77102875 GAAGAGGAAGAAGGCAAGAGAGG - Intergenic
1099049414 12:77765233-77765255 GAACAGAACTGAGGCCAAAGTGG - Intergenic
1099616544 12:84942825-84942847 GAATAGAAAGGAAGCCAATGTGG - Intergenic
1099888568 12:88561758-88561780 GAACATAAAGGAGGCCAGTGTGG - Intronic
1099940488 12:89182369-89182391 GAACTGAAAGAAGCTCAGAGTGG - Intergenic
1100011654 12:89961199-89961221 AAAGAGAAAGGAAGACAGAGAGG - Intergenic
1100059751 12:90560109-90560131 AAGAAGAAAGGAGGCAAGAGAGG + Intergenic
1100201270 12:92300132-92300154 GAAGAGAAAGGAGGCCAGTTGGG + Intergenic
1100341375 12:93683015-93683037 GACCTGACAGGAGCCCAGAGAGG - Intronic
1100497410 12:95138648-95138670 GAAGATAAAGAAGGCCAGTGTGG - Intronic
1100554523 12:95679878-95679900 AAACAGCAAGAAGGCCAGTGTGG - Intronic
1100797871 12:98201517-98201539 GAACAGCAGAGAGGCCAGTGTGG - Intergenic
1100815038 12:98378693-98378715 GAACAGCAAAGAGACCAGTGTGG - Intergenic
1100882952 12:99038699-99038721 GACCAGCAAGGAAGCCAGTGTGG - Intronic
1100902013 12:99252224-99252246 GAACAGTAAGAAGGCCAGTGTGG + Intronic
1100934094 12:99643545-99643567 GAATAGAAAGGAGGACTCAGAGG - Intronic
1100955658 12:99905101-99905123 GAACAGAAAGAAGGAGAGATAGG - Intronic
1101208734 12:102514618-102514640 GAAATGAAACAAGGCCAGAGTGG + Intergenic
1101329192 12:103743803-103743825 GAACAGCAAGAAGACCAGGGTGG + Intronic
1101607026 12:106255017-106255039 GAGCAAAAAGGAGGCTAGTGTGG - Intronic
1101630097 12:106484868-106484890 GAACAGAAAAAAGGCCAGTCTGG + Intronic
1101701277 12:107176606-107176628 AAAGAGAAAGGAGGACAGTGTGG + Intergenic
1102039686 12:109792833-109792855 GACCACAAGAGAGGCCAGAGGGG + Intronic
1102162778 12:110782876-110782898 GAACAGCAAGGAGGCCTGTGTGG + Intergenic
1102198976 12:111044410-111044432 GCACAGCAAGGAGGCCACAGGGG - Intronic
1102199561 12:111048021-111048043 GAACCAAAGGGAGGCCAGTGAGG + Intronic
1102247948 12:111367107-111367129 GAACAGAAAGGAGGCCAGGATGG - Intronic
1102396359 12:112589414-112589436 GAACAGCAAGGAGGCCATGGTGG - Intronic
1102439372 12:112949520-112949542 GAGCAGCCAGGAGGCCAGTGTGG - Intronic
1102456550 12:113074455-113074477 GAACAGCAAGGAGGCCAGGGTGG + Intronic
1102500822 12:113351148-113351170 GAACATCAAGGAGGCCAGGGTGG + Intronic
1102510915 12:113414836-113414858 GAACAGCAGAGAGGCCAGTGTGG - Intronic
1102540646 12:113616751-113616773 GAACAGAATGAAGGCCGGCGAGG - Intergenic
1102571180 12:113827845-113827867 AAACTGAGAGGAGCCCAGAGAGG - Intronic
1102609316 12:114097413-114097435 AAAAAGAAAGGAGTACAGAGTGG + Intergenic
1102694135 12:114785066-114785088 GAAGAGCAAGGAGGCCACAGGGG + Intergenic
1102811274 12:115826105-115826127 GAACAGCAAGGAGGCCCATGTGG - Intergenic
1103044583 12:117725269-117725291 GAAAAGACAAGAGGCCAGAGAGG + Intronic
1103158226 12:118706008-118706030 GAACAGCAAGGAAGCCAGGGTGG - Intergenic
1103334349 12:120178034-120178056 GAACAGAGAGGAGGCGAGCGGGG - Intronic
1103367054 12:120390934-120390956 GAACTGAAAGGCAGCCAGTGTGG - Intergenic
1103399297 12:120632066-120632088 GACCATAAAGGAGGCCACGGTGG + Intergenic
1103448632 12:121012094-121012116 TAACATAAAGGTGGGCAGAGAGG + Intronic
1103474751 12:121210181-121210203 GAACAGGAAGGCCGCCAGCGCGG - Exonic
1103733552 12:123044126-123044148 CAACAGAAACAAGCCCAGAGGGG + Intronic
1103992289 12:124807313-124807335 GAAGAGATATGAGGACAGAGTGG + Intronic
1104093982 12:125539269-125539291 GAAAAGAAAGGAGGCCAGCATGG - Intronic
1104353846 12:128067915-128067937 GCAGAGAAAGGAGGCAAGAAAGG + Intergenic
1104386500 12:128355698-128355720 GGACAGCAAGGAGGACAGTGTGG - Intronic
1104439500 12:128783228-128783250 GAACAGAAAGAAGGTCTGGGAGG - Intergenic
1104661723 12:130616249-130616271 GTACAGAAAGGAGAGGAGAGCGG - Intronic
1104704698 12:130934310-130934332 GCACAGGAAGGAGGCTGGAGTGG - Intergenic
1104756262 12:131271111-131271133 GAACAGCAAGATGGCCAGAGAGG - Intergenic
1104777516 12:131399914-131399936 GAACAGCAAGAAGGCCAAAGAGG + Intergenic
1105073350 12:133251914-133251936 GACTAGAAAGGAGCCCACAGAGG + Intergenic
1105586055 13:21743778-21743800 AAACAGAAAGAAGGCCAGTGTGG - Intergenic
1105950150 13:25223050-25223072 AATGATAAAGGAGGCCAGAGAGG + Intergenic
1105966770 13:25391777-25391799 GTACAGAAGGAAGGCCACAGTGG + Intronic
1106000109 13:25714250-25714272 GAACAGAAAGGAGTCCAATGTGG - Intronic
1106267108 13:28120320-28120342 GAACTGAAATAAGGCCTGAGGGG + Intergenic
1107031422 13:35857835-35857857 TACGAGAAAGGAGGCCAGTGTGG + Intronic
1107169774 13:37327104-37327126 GAACAGCAAAGAGGGCAGTGTGG + Intergenic
1107560585 13:41553773-41553795 GAACAGCAAGGAGGCTGGGGTGG - Intergenic
1107679109 13:42829539-42829561 GAGCAGCAAGGAGGCCAATGTGG - Intergenic
1107734791 13:43387439-43387461 GAAGTAAAAGGAGGCCAGTGTGG + Intronic
1107900628 13:45010150-45010172 GAACAGCAAGGAGCCCAGTGTGG - Intronic
1107944616 13:45406829-45406851 GAAAAGAAAAGAAGTCAGAGGGG - Intronic
1108468073 13:50739026-50739048 GAACAGAAATCAGGCCAGTGTGG - Intronic
1108547365 13:51509123-51509145 GACCAGAAAGGAGGGCTGGGAGG + Intergenic
1108698952 13:52927344-52927366 GAAAAGAAGGGAGGGAAGAGAGG - Intergenic
1109489071 13:63071212-63071234 GATCAGTAAGAAGGCCAGGGAGG - Intergenic
1110097350 13:71544826-71544848 GATCAGAGAGGAAGGCAGAGAGG - Intronic
1110284523 13:73734025-73734047 GAACAGTTAGGAGGCCACTGTGG - Intronic
1110319943 13:74149820-74149842 GAACAACAAGGAGGCCAGAGGGG - Intergenic
1110639753 13:77809094-77809116 CAACAGAAAGAAGGCCACTGAGG - Intergenic
1112130165 13:96514617-96514639 GAGAAGAAAGGAGGCCTCAGAGG + Intronic
1112367335 13:98766536-98766558 AAACAGAAAGGCGGACAGAGAGG + Intergenic
1112433512 13:99373760-99373782 GGACAGAAAGGAGGCCAGACAGG + Intronic
1112622567 13:101066917-101066939 GACCATGAAGGAGGCCTGAGGGG - Intronic
1112665983 13:101574022-101574044 GAACTGAAATGAGGCAAAAGTGG - Intronic
1112804605 13:103149985-103150007 GAACAGCAATGAGGCTAGTGTGG - Intergenic
1112822775 13:103355650-103355672 GAATGAAAAGGAGGCCAGGGTGG - Intergenic
1112937173 13:104815607-104815629 GAAGGGAAAGGAAGTCAGAGAGG - Intergenic
1113039232 13:106086256-106086278 GAAGAGAAAGGAATACAGAGTGG - Intergenic
1113135152 13:107080761-107080783 GACCAGAAAGAAGGCCAGTGTGG - Intergenic
1113138996 13:107126310-107126332 GAAGGGAAAGGAGGCCAGCGAGG + Intergenic
1113351943 13:109537999-109538021 AAAAAGAAAGGAGGCCACTGTGG - Intergenic
1113376525 13:109769428-109769450 GAACAGGAAGGAGGCCAGTGTGG - Intronic
1113376821 13:109772060-109772082 ACAAAGAAAGGAGGGCAGAGAGG + Intronic
1113679050 13:112229629-112229651 GACCAGGAAGGACTCCAGAGAGG + Intergenic
1114034739 14:18612827-18612849 GGACAGCAAGGAGGCCAGTATGG + Intergenic
1114123903 14:19702189-19702211 GGACAGCAAGGAGGCCAGTATGG - Intergenic
1114482848 14:23046189-23046211 GAACACAAAGGAGGAGGGAGAGG - Intergenic
1114572622 14:23684207-23684229 GAACAGCGAGAAGGCCAGTGTGG + Intergenic
1115104563 14:29744992-29745014 AAACAGTAATAAGGCCAGAGTGG - Intronic
1115465905 14:33713895-33713917 GAATAGCAAGGAGGCCAATGTGG - Intronic
1116182419 14:41551894-41551916 TAACAGAAAGGAGGGCAGAGAGG + Intergenic
1116510865 14:45744968-45744990 GAACAGAAAGAAGACCAGTGTGG - Intergenic
1116745275 14:48810151-48810173 GAACATCAAGGAGGCCAGTGAGG + Intergenic
1116774938 14:49168110-49168132 GAATAGCAAGAAGGCCAGAGTGG + Intergenic
1116805189 14:49487653-49487675 GAGCAGAAAGGAGGGAAAAGGGG - Intergenic
1116823808 14:49651934-49651956 GAACAGAAGGGAGGCTAGTGTGG + Intronic
1116863748 14:50014979-50015001 GAAAAGAAAGGAAGACAGGGAGG + Intergenic
1117000036 14:51363181-51363203 GAACAGCAATGAGGCCAGAGTGG + Intergenic
1117102901 14:52368833-52368855 CAACAGAAGGAAGGCCAGTGTGG + Intergenic
1117251179 14:53940288-53940310 GAACAGAAAGAAGGCCAGTATGG + Intergenic
1117294997 14:54370952-54370974 GAACAGCAAGGAGGCCAGTGTGG - Intergenic
1117314164 14:54557680-54557702 GAACTGAATGCAGGCCAGGGTGG + Intergenic
1117475046 14:56085585-56085607 GAACAGGAAAGAGGCCAGTGTGG - Intergenic
1117533451 14:56681471-56681493 GAAGAGAAAGGGGGTAAGAGAGG - Intronic
1117819608 14:59634101-59634123 GCACATAAAAGAGGACAGAGTGG + Intronic
1117825855 14:59702902-59702924 GAACCGCAAGGAAGCCAGGGTGG - Intronic
1117872595 14:60216957-60216979 GAACAGAGTGGAGGCCTGAAGGG + Intergenic
1118020826 14:61712295-61712317 GAACAGTAAGGAGGCTAGTATGG + Intronic
1118506940 14:66423702-66423724 AAACAGCAAGGAAGCCAGTGTGG - Intergenic
1118517251 14:66544123-66544145 GAACAGCAATGAGGTCAGTGTGG - Intronic
1118682757 14:68260266-68260288 GAACAAAAAGAGGGCCAGTGTGG + Intronic
1118715137 14:68554374-68554396 GAACAGCAAGGAGACCAGCCTGG - Intronic
1118812045 14:69282333-69282355 GGAAAGAAAGGAGGTCAGTGTGG - Intronic
1118967280 14:70599616-70599638 GAACAGCAAGGAGGTCAGTGTGG - Intronic
1119119586 14:72062267-72062289 GAACAGCAAAGAGACCAGTGTGG + Intronic
1119204346 14:72783014-72783036 GAACAGAAAGGAGTGCAGTGAGG - Intronic
1119412508 14:74442460-74442482 GATAAGAAAGAAGGCCAGTGAGG + Intergenic
1119623609 14:76151906-76151928 GACCGGAAATGAGGTCAGAGAGG + Intronic
1119637591 14:76289362-76289384 GAAGAACAAGGAGGCCAGTGTGG + Intergenic
1119766895 14:77195994-77196016 GAGCTGCAAGGAGGCCAGGGAGG + Intronic
1120052480 14:79883244-79883266 GAACAGAAATGAGGCCGGTTAGG + Intergenic
1120164590 14:81182851-81182873 GAACAGCAAGGAGGCCTGTGTGG - Intronic
1120814971 14:88846471-88846493 GAACAGTAAGAAGGCCAGTGTGG + Intronic
1121007416 14:90499261-90499283 GATCAGAATGGAAGACAGAGGGG + Intergenic
1121410702 14:93746494-93746516 GAGCAGGAAGGAGGCCAGTGTGG + Intronic
1121464992 14:94110074-94110096 GAGCAGCAAGGGGGCCAGTGTGG - Intronic
1121604661 14:95231650-95231672 GAACAGAATGCAGCTCAGAGAGG + Intronic
1121780565 14:96619292-96619314 GAACAGACAGCAGTCCATAGAGG - Intergenic
1121795287 14:96729431-96729453 CCACAGAAAGGATCCCAGAGGGG - Intergenic
1121843914 14:97156663-97156685 GAACAGTCAAGAAGCCAGAGTGG + Intergenic
1121851927 14:97229146-97229168 GAAAAGCAGGGAGGCCAGTGTGG + Intergenic
1123573923 15:21646033-21646055 AAGCAGAAAGGAGGCTAGTGTGG - Intergenic
1123610540 15:22088618-22088640 AAGCAGAAAGGAGGCTAGTGTGG - Intergenic
1123946726 15:25242408-25242430 CCACATGAAGGAGGCCAGAGGGG + Intergenic
1124387644 15:29223724-29223746 GAATGGAAAGGTAGCCAGAGAGG + Intronic
1124395667 15:29299644-29299666 AGGCAGAAAGGGGGCCAGAGAGG - Intronic
1124680670 15:31727905-31727927 GAGCATAAAGGAGCTCAGAGTGG - Intronic
1124688071 15:31799125-31799147 GAACAGAGAGAAGGCTGGAGTGG + Intronic
1124805533 15:32878211-32878233 GAACACAAAGAAGGCCCGTGTGG + Intronic
1124878788 15:33622272-33622294 GAACAGAAAGGAGGGTGGCGTGG - Intronic
1125168438 15:36738552-36738574 GAAGAGCAAAGAGGCCAGAATGG - Intronic
1125472957 15:40022315-40022337 GAAGGGAAGGGAGGCAAGAGAGG + Intronic
1125507896 15:40277637-40277659 GACCCGAAAGGAGGGCAGAGAGG + Intergenic
1125536518 15:40443642-40443664 CAACAGAAAGGAAGAAAGAGAGG - Intronic
1125605011 15:40935214-40935236 GAGCAGATGGGGGGCCAGAGTGG - Intronic
1125679641 15:41522806-41522828 GAAGAGAGAGGAGGGCAGTGAGG + Exonic
1125756649 15:42069737-42069759 CATCAGCAAGGAGGCCAGGGTGG + Intronic
1126462403 15:48927672-48927694 GAGTAGAAAGGAGGCCAATGTGG - Intronic
1126478670 15:49093889-49093911 GAACACAAAGGGGGCCTGTGTGG - Intergenic
1126727525 15:51647401-51647423 GAACTGGAAGGAAGCCAGTGTGG + Intergenic
1126862241 15:52896700-52896722 GATCAGAAGGAAGGCAAGAGAGG - Intergenic
1127082765 15:55396857-55396879 AAACAGCAAGGAGGCCTGTGTGG + Intronic
1127202703 15:56673738-56673760 GAATAGCAAGGAGGCCAGTGTGG - Intronic
1127560942 15:60135431-60135453 GAACAGAAAGGAGGCTAGTGCGG + Intergenic
1127566505 15:60194313-60194335 AAATGGAAAGGAGGTCAGAGTGG - Intergenic
1127569988 15:60232391-60232413 GAAGAGAAGGGAGGCAAAAGAGG - Intergenic
1127769883 15:62222683-62222705 GAACATAAAGGAAACGAGAGTGG - Intergenic
1127810573 15:62561742-62561764 GAAAGGGAAGGAGGCCAGGGTGG - Intronic
1128026526 15:64442002-64442024 GAACAACAAGGAAGCCAGTGTGG + Intronic
1128040553 15:64568990-64569012 AAAAAGAAAGAAGGCCAGTGTGG - Intronic
1128112059 15:65082666-65082688 GAGGAGCAATGAGGCCAGAGAGG - Intergenic
1128224580 15:65993116-65993138 GAACAGCAGGGAGGACAGTGCGG - Intronic
1128343786 15:66841252-66841274 GAAGAGAAAACAGGCCAGGGAGG - Intergenic
1128427664 15:67558682-67558704 AGACCGAAAGGAAGCCAGAGTGG - Intronic
1128479508 15:68025155-68025177 GAAGAACAATGAGGCCAGAGAGG - Intergenic
1128568505 15:68716783-68716805 GAGCAGAAGGGAGGTCAGTGTGG + Intronic
1128674064 15:69595910-69595932 GAGCAGAAAGACGCCCAGAGAGG + Intergenic
1128779771 15:70351698-70351720 GAACAGCCAGGAGGCCTGTGTGG - Intergenic
1129128768 15:73470927-73470949 GAGCAGGAAGGAGGCTAGTGTGG + Intronic
1129168373 15:73792610-73792632 AAATAGAAAGGTGGCCAGGGAGG + Intergenic
1129168486 15:73793330-73793352 ACACAGCAAGGAGGCCAGTGTGG - Intergenic
1129196423 15:73969866-73969888 GAACAGCAAGGAGGCCATTGTGG - Intergenic
1129239163 15:74241458-74241480 AAACAGCCAGGAGGCCAGTGTGG + Intronic
1129465768 15:75723449-75723471 GCAAATAAAGGAGGACAGAGGGG - Intergenic
1129466186 15:75725539-75725561 GAACAGCTAGGAGGCCAGTGGGG + Intronic
1129503690 15:76063425-76063447 GTACAGCAAGGAGGCCAGTGTGG - Intronic
1129545032 15:76386744-76386766 AAACAGCAAGAAGGCCAGTGTGG + Intronic
1129813089 15:78526595-78526617 GAACAACAGGGAGGCCAGGGTGG + Intronic
1129889066 15:79059125-79059147 GAAAAGAAAGGAGGAAGGAGAGG - Intronic
1129917413 15:79286184-79286206 CAACAGAAAACAGACCAGAGAGG + Intergenic
1130124994 15:81085770-81085792 TAACAGAGGGGAAGCCAGAGTGG - Intronic
1130159726 15:81386521-81386543 GCACAGCAAGGAGGCCAGTGTGG - Intergenic
1130193269 15:81756168-81756190 GAAAAGAAAGGAGGTAAGAGAGG + Intergenic
1131098303 15:89669696-89669718 GAAGAGAAAACAGGTCAGAGAGG + Intronic
1131301116 15:91200432-91200454 GATCAGAAAGGAAACTAGAGGGG + Intronic
1131399119 15:92110486-92110508 GAACTGAAAAGAGACCAGTGAGG - Intronic
1131424591 15:92335183-92335205 GAAGAGAAAAGAGGCCAGTGTGG + Intergenic
1131639102 15:94270577-94270599 AAAGAGCAAGGAGGCCAGTGTGG - Intronic
1131664088 15:94551325-94551347 GGACAGAAAGCAAGACAGAGTGG + Intergenic
1131776237 15:95802308-95802330 GAACCGAAAGGAGGCTGGTGTGG - Intergenic
1132349693 15:101132225-101132247 GGGCAGAGGGGAGGCCAGAGGGG - Intergenic
1202982788 15_KI270727v1_random:380373-380395 AAGCAGAAAGGAGGCTAGTGTGG - Intergenic
1132771294 16:1564928-1564950 GAGCAGAAAGCAGGGCAGAGGGG + Intronic
1132812674 16:1809033-1809055 GAGGAGGAAGGAGGCCCGAGGGG + Exonic
1132834889 16:1947822-1947844 GGACAGAGAGGAGACCAGTGTGG + Intronic
1133594902 16:7281828-7281850 GAAAAGAAAGGAAGGCAGGGAGG - Intronic
1133837137 16:9377358-9377380 GACCAGCAAGGAGGCCAGTGTGG - Intergenic
1133866301 16:9646759-9646781 GAATAGAAAGAAAGCCAGTGTGG - Intergenic
1133892265 16:9891807-9891829 GAACTGAATGCAGACCAGAGAGG + Intronic
1134013559 16:10872736-10872758 GGAAAGAAAGGAGGCAAGAAAGG - Intergenic
1134331154 16:13252211-13252233 GAACAGCAAGGAGGCCAGTGGGG - Intergenic
1134379791 16:13713319-13713341 GCATAGGAAGGAGGCCAGGGTGG - Intergenic
1134518067 16:14903048-14903070 GAATAGCAAAGAGGCCAGGGTGG + Intronic
1134589495 16:15441023-15441045 GAAGAGACAGAAGGCCAGGGTGG + Intronic
1134692720 16:16201479-16201501 GAACTGAAAGGAGACCTGTGTGG + Intronic
1134705738 16:16301702-16301724 GAATAGCAAAGAGGCCAGGGTGG + Intergenic
1134961803 16:18410412-18410434 GAATAGCAAAGAGGCCAGGGTGG - Intergenic
1134966101 16:18493011-18493033 GAATAGCAAAGAGGCCAGGGTGG - Intronic
1134979125 16:18593202-18593224 GAACTGAAAGGAGACCTGTGTGG - Intergenic
1135046035 16:19156533-19156555 GAACAGCAAGGAGGCTGGTGTGG + Intronic
1135054380 16:19218811-19218833 GAACAAAGAGAAGGCCAGTGTGG - Intronic
1135100656 16:19602504-19602526 GAAGAGAGAGGAGGAGAGAGAGG - Intronic
1135128213 16:19829265-19829287 GAGCAGAAAAGAGACTAGAGGGG - Intronic
1135140231 16:19914997-19915019 GAACTGAAAGGAGACCAGCATGG - Intergenic
1135256405 16:20944888-20944910 GAGCAGAGAGGAAGCCAGGGTGG - Intronic
1135413718 16:22253439-22253461 GAAGAGAAAGGAGGCCAGGCTGG - Intronic
1135520243 16:23171288-23171310 AAACAGCAAGGAGGCCAGAGTGG + Intergenic
1135541000 16:23330427-23330449 GAACAGGAAAGAGGCCAGACAGG + Intronic
1135619663 16:23944993-23945015 GAAGAGAAAGAACGTCAGAGAGG + Intronic
1135641324 16:24122261-24122283 GAGCAGCAAGGAGGCCAGTGCGG + Intronic
1135649022 16:24189219-24189241 GAACAGTAAGGACTCCAGAGAGG - Intronic
1135707170 16:24685023-24685045 GAACTGCAAGAAGGCCAGAGGGG - Intergenic
1136082555 16:27861683-27861705 GGACAAGAAGGAGGCCAGAGAGG - Intronic
1136596406 16:31253175-31253197 GAATGGCAAGGAGGCCAGGGTGG + Intergenic
1137718379 16:50612745-50612767 GAACAAAAAGGAGGCCGATGTGG + Intronic
1137737720 16:50737276-50737298 GAACAGCAAAGAAGCCAGTGAGG - Intergenic
1137753776 16:50885774-50885796 GAACAGTAAAGAAGCCAGTGTGG + Intergenic
1137871908 16:51958203-51958225 GAACAAAAAGAAAGCCAGGGGGG - Intergenic
1137948295 16:52756999-52757021 GAATAAATAAGAGGCCAGAGTGG + Intergenic
1137960932 16:52881532-52881554 AATCAGAGAGGAGGCCAGTGTGG - Intergenic
1138087021 16:54142543-54142565 GAAGAGAAAGGAGGCCTGGGTGG + Intergenic
1138184515 16:54966172-54966194 GAGCAGAATGAAGGCCAGAGTGG + Intergenic
1138470791 16:57234142-57234164 GAGCAGCAAGGAGGCCAGGGTGG - Intronic
1138835359 16:60428280-60428302 GATCTGAAAGAAGGCCAGTGTGG - Intergenic
1138866847 16:60832154-60832176 GAACAGAGAAGTGGGCAGAGTGG - Intergenic
1138993665 16:62422114-62422136 GAACAAAGAGGAGGACAGAAAGG + Intergenic
1139106440 16:63832345-63832367 AAACAAAAAAGAGGTCAGAGAGG + Intergenic
1139198027 16:64944014-64944036 GAACCGAAAGATGGCCAGTGTGG + Exonic
1139346393 16:66306566-66306588 GAAAAGGAGGGAGGCCAGTGGGG + Intergenic
1139659663 16:68412003-68412025 GAACAGAAATGAGGGCATGGGGG + Intronic
1139690845 16:68641115-68641137 GAACAGCAAGAAAGCCAGTGTGG - Intronic
1139827201 16:69766581-69766603 GACCAGTCAGGAGGCCAGTGTGG - Intronic
1139828955 16:69781185-69781207 GAACAGTGAGGAGGCCTGTGTGG + Intronic
1140308171 16:73823282-73823304 GAACTAAAAGATGGCCAGAGAGG + Intergenic
1140478334 16:75250019-75250041 GTACAGACAGGAGGCCCTAGTGG + Intronic
1140479077 16:75252838-75252860 GATGAGAAAGGAGCCCAGAGAGG - Intronic
1140510506 16:75504140-75504162 GAACAGCAAAAAGGCCAGGGGGG + Intergenic
1140516265 16:75544455-75544477 GAACAGCAAAAAGGCCAGGGGGG + Intronic
1140830599 16:78747076-78747098 GAAAAGAAAGAAGACTAGAGTGG - Intronic
1140855183 16:78971738-78971760 GCACAAAAAGAAGGCCAGGGCGG - Intronic
1141020914 16:80495668-80495690 GAACAGGAAGGAGGAAAGTGGGG + Intergenic
1141321168 16:83010289-83010311 GAACAAATTGGAGGTCAGAGAGG + Intronic
1141441323 16:84031506-84031528 GAACAGTGAGGAGGCCGGTGTGG - Intronic
1141572507 16:84942379-84942401 AGACAAAAAGGAGGGCAGAGGGG - Intergenic
1141630910 16:85287491-85287513 GAACAGCAAGAAGGCCAGCAGGG - Intergenic
1142149108 16:88504949-88504971 GAATAGCAAGGAGGGCAGGGTGG - Intronic
1142578487 17:925355-925377 GAACACAGAGGAGGCTGGAGAGG + Intronic
1142661840 17:1435858-1435880 GAAAAGAAAGGAAGGGAGAGAGG + Intronic
1142669599 17:1481918-1481940 GGACAGCACGGAGGCCACAGCGG - Intronic
1142747134 17:1965551-1965573 CAGCAGGAAGCAGGCCAGAGTGG + Intronic
1143097720 17:4487363-4487385 GATCAGCAAGGAGGCCAGTGTGG + Intronic
1143129458 17:4667807-4667829 GGAAAGCAAGGAGGCCAGTGAGG - Intergenic
1143255266 17:5553045-5553067 AAACTGAAAGCAGGCCAGTGTGG - Intronic
1143303637 17:5929207-5929229 GGACAGAAAGGAGGGAAGGGAGG - Intronic
1143402205 17:6653644-6653666 GAACAGAAAGAAGGCCAGTGTGG + Intergenic
1143415111 17:6741591-6741613 AAACAGCAAGGAGACCAGTGTGG - Intergenic
1143623086 17:8092191-8092213 GTACAGCAAGAAGGCCAGAGTGG - Intergenic
1143696734 17:8626272-8626294 AAAAAGAAAGGAGGCCAGGTGGG + Intronic
1143858779 17:9872743-9872765 CACCAGAAAGCAGGCCAAAGGGG - Intronic
1143900441 17:10170392-10170414 GAACAGCAAGGAGGTCAGTGTGG - Intronic
1143996508 17:11011204-11011226 GAACAGCAAGGAGGCCAGTGTGG + Intergenic
1144208744 17:12997341-12997363 GAGAATGAAGGAGGCCAGAGCGG - Intronic
1144360497 17:14487289-14487311 GGACAGGAAGGGGGCCAGTGTGG + Intergenic
1144537482 17:16104997-16105019 GAACAGCAAAGAGGACAGTGTGG + Intronic
1144590252 17:16517651-16517673 GAACAGAGAGAAGGCCAGTGTGG - Intergenic
1144638347 17:16924762-16924784 GAACAGCCTGGAGGGCAGAGGGG - Intergenic
1145242254 17:21246889-21246911 GAAGAGCAAGGAGGCCAGAGTGG + Intronic
1145769198 17:27480154-27480176 GAACAGGAAGGTGGCCCAAGGGG - Intronic
1145838150 17:27970494-27970516 GGACAGTAAGGAGGCAGGAGGGG - Intergenic
1146186835 17:30729727-30729749 GAACAGGAGGGAGGACAGAATGG + Intergenic
1146265770 17:31451631-31451653 GAACAGAAAACAGGTCAGGGTGG - Intronic
1146467376 17:33096882-33096904 GAACAGCAAGGAGGCCAGAGTGG + Intronic
1146585119 17:34075688-34075710 GAATAGAAAGAAGGCTGGAGAGG - Intronic
1146648157 17:34589271-34589293 GAACAGCAAGGAGGCCAGCGGGG + Intronic
1146660309 17:34661243-34661265 GCAAAGAAAGGAGGAAAGAGGGG - Intergenic
1146669692 17:34728471-34728493 GACCAGAGAGGAGGGGAGAGAGG + Intergenic
1146786536 17:35726461-35726483 GAAAACACAGCAGGCCAGAGAGG + Intronic
1147238944 17:39077868-39077890 GAGCAGAGAGGAGGCCAGGAAGG - Intronic
1147293729 17:39463926-39463948 GAACAGAAGTGAGGCCACAAAGG - Intronic
1147452976 17:40517600-40517622 TTACAACAAGGAGGCCAGAGAGG + Intergenic
1147502108 17:40975542-40975564 CAGCAGAATGCAGGCCAGAGAGG - Intergenic
1147894856 17:43743915-43743937 GAACTAAGAGGAGCCCAGAGAGG + Intergenic
1148644191 17:49210098-49210120 GACCAGAGAGGTTGCCAGAGGGG - Intronic
1148872337 17:50666031-50666053 GAAAAGAAAGAAGACCAGACTGG - Intronic
1149097499 17:52861241-52861263 GGAGAAAAAGGAGGCGAGAGAGG + Intergenic
1149301463 17:55308039-55308061 GAGCAGAAGGAAGGCCAGTGTGG + Intronic
1149309279 17:55378516-55378538 GCATAGGAAGGAGGGCAGAGAGG - Intergenic
1149327594 17:55548046-55548068 GAACTGAAAGGAGACCAGTGTGG + Intergenic
1149340936 17:55685754-55685776 AAACATAAAGCAGGCCAGAGTGG - Intergenic
1149911664 17:60572475-60572497 AAACAGAAAGAAGGCCAGTGTGG - Intronic
1150098412 17:62399560-62399582 GAAGAGTAAGGAGGCCAGCATGG - Intronic
1150318202 17:64187673-64187695 GAACAGCAAGGAGGCCTGGCCGG - Intronic
1150489424 17:65564021-65564043 GAACAGAAATGTAGACAGAGGGG + Intronic
1150506049 17:65700164-65700186 GTATAGAAAGAAGGCTAGAGAGG - Intronic
1150520874 17:65865869-65865891 GCACAGAAGGGTGGACAGAGAGG + Intronic
1150625753 17:66840149-66840171 GCACAGAGAGGGGGCCAGTGAGG - Intronic
1150805099 17:68312556-68312578 GAGCAGAAAGGAGGACTCAGGGG + Intronic
1150975114 17:70077126-70077148 AAACAGCAAAGAGGCCAGTGTGG + Intronic
1151258766 17:72900431-72900453 GATCTGCAAGGAGGCCAGTGAGG + Intronic
1151440949 17:74128766-74128788 GACCAGGAGGGAGGGCAGAGAGG + Intergenic
1151647179 17:75441255-75441277 GAAAAGAGAGAAGGCCAGTGTGG + Intronic
1151727918 17:75895182-75895204 GAGGCGAAAGCAGGCCAGAGGGG - Intronic
1151906845 17:77054394-77054416 GAAAGGAAAGGTGGCCAGAGAGG - Intergenic
1151941910 17:77297984-77298006 GAACAGCAAGGAGGCCAGAGGGG + Intronic
1151972980 17:77468413-77468435 GAGCTGAAAGGCAGCCAGAGAGG + Intronic
1152089720 17:78239860-78239882 GGACAGAACAGAGGCCAGGGAGG - Exonic
1152144440 17:78559822-78559844 GAGCAGCAAGGAGGCCAGTGGGG - Intronic
1152184334 17:78844651-78844673 GGGCAGAAAGGAGCCCAGAAGGG - Intergenic
1152202351 17:78954487-78954509 CAACAGAATGGAGGACAAAGTGG - Intergenic
1152452903 17:80394548-80394570 GAAGAGAAATTAGTCCAGAGAGG - Exonic
1152579444 17:81159654-81159676 GAGCAGAAGGGAAGCCAGAGGGG + Intronic
1153179824 18:2420542-2420564 GAACAGGAAGGAGGCCAGTGTGG + Intergenic
1153181210 18:2435817-2435839 GAACTGCAAGGAGGCCACTGTGG - Intergenic
1153207527 18:2719283-2719305 GAAAAGAAAAGAGGGGAGAGGGG - Intronic
1153737217 18:8083338-8083360 GAACAGAAAGGAGGTCGGTGTGG - Intronic
1153922495 18:9804078-9804100 GAACACAGAGGCGGCCAGAGGGG + Intronic
1154235951 18:12605920-12605942 GAACATGAAGGAGGCCAGTGTGG - Intronic
1154935943 18:21056807-21056829 GAACATCAAGGAAGCCAGTGTGG - Intronic
1155034986 18:22018610-22018632 GAACAGAGAGGAAGCCAGTGAGG + Intergenic
1155469233 18:26173231-26173253 GAACAGTAAAGAGGCCAGTGTGG - Intronic
1155472297 18:26203913-26203935 GAACAGCAGGGAGGCCAGTGTGG - Intergenic
1155482661 18:26306094-26306116 GAACAGAAAGGAGGCAAACATGG - Intronic
1155549105 18:26946390-26946412 GGATAGAAAGGAGGCCAGCATGG + Intronic
1155723565 18:29050283-29050305 GAACAGAACAGAGGCCTCAGAGG - Intergenic
1155880769 18:31145508-31145530 GCTGAGAAAGGAGGCCAGACTGG + Intronic
1156135013 18:34027180-34027202 GAACAGAGAGGAGGATAGAGAGG + Intronic
1156171464 18:34491834-34491856 GAAGAGAAAGCAGTCAAGAGGGG - Intergenic
1156190860 18:34718853-34718875 GAACATACAGCAGGACAGAGAGG + Intronic
1156217419 18:35014037-35014059 GAAAAGGCAGGAGGCAAGAGGGG + Intronic
1156239458 18:35238885-35238907 GACCATAAAGGAAGCCAGACTGG + Intergenic
1156310739 18:35919406-35919428 GAACAGGGAGGAGGCCAGGGTGG + Intergenic
1156446818 18:37242732-37242754 GAACAGAAAGGAGGCTACCTAGG - Intergenic
1156530933 18:37814327-37814349 GAACAGACAGGAGGGTAGATGGG + Intergenic
1157141052 18:45106989-45107011 GCACAGAAGGAAGGCCAGTGAGG - Intergenic
1157737808 18:50065938-50065960 GAACTGAAAGAGGGCCAGTGTGG + Intronic
1157811805 18:50702659-50702681 AAACAGAAAAGGGGCCAGGGTGG - Intronic
1157871875 18:51237415-51237437 AAACAGCAAGGAGGCCAGTGTGG - Intergenic
1158023506 18:52870001-52870023 GGACAGAAAGGGGCCCAGTGAGG - Intronic
1158149295 18:54349440-54349462 GGTCAGAAATGAGGTCAGAGAGG + Intronic
1158159344 18:54462402-54462424 GAACAAGAAGAAGGCCAGTGTGG - Intergenic
1158526892 18:58223002-58223024 GAAGAGAAAGAATGCCACAGTGG + Intronic
1158536596 18:58313614-58313636 TTACAGATAGGAAGCCAGAGAGG - Intronic
1158539203 18:58337418-58337440 GAACAGAGGGGATGCCAAAGAGG - Intronic
1158711254 18:59840041-59840063 GAAGAACAATGAGGCCAGAGTGG + Intergenic
1159011059 18:63058717-63058739 GACCAGGACGGAGGCCACAGGGG + Intergenic
1159038422 18:63299453-63299475 GGGCAGCAAGGAGGCCAGATGGG - Intronic
1159908811 18:74123802-74123824 GAACAACACGGAGGGCAGAGTGG - Intronic
1159936364 18:74371245-74371267 GAAGAGCAAGAAGGCCCGAGTGG + Intergenic
1160524201 18:79525548-79525570 GGACAGGAGGGAGGCCTGAGAGG - Intronic
1160681666 19:414228-414250 GAGCAGAAGGGTGGCCAGTGTGG - Intergenic
1160758802 19:772156-772178 GAACAGGGAGGAGGCCCGTGTGG - Intergenic
1160988415 19:1850843-1850865 GAACAGCGAGGAGGCCAGTGTGG + Intergenic
1161138230 19:2633284-2633306 GAGCCGAGTGGAGGCCAGAGAGG - Intronic
1161243047 19:3233635-3233657 GAACAGCAAGGAGGCCCTTGTGG + Intronic
1161243341 19:3235092-3235114 AAACAGCAAGGAGGCCAGTGTGG - Intronic
1161245852 19:3251436-3251458 GAACAGGGAGGAGGCCCGTGTGG + Intronic
1161257292 19:3316465-3316487 GAACAGCGAGGAGGCCTGTGTGG + Intergenic
1161258903 19:3324759-3324781 GAACAGCAAGGAGGCCCGTGTGG - Intergenic
1161262325 19:3344927-3344949 GAACAGCGAGGAGGCCCGTGTGG + Intergenic
1161262488 19:3345547-3345569 GAACAGCAAGGAGGCCTGTGTGG - Intergenic
1161273095 19:3401108-3401130 GAACAGTGAGGAGGCCTGTGTGG + Intronic
1161274287 19:3406956-3406978 GAACAGCCAGGAGGCCTGTGTGG + Intronic
1161286444 19:3470975-3470997 GAACAGTGAGGAGGCCTGTGTGG + Intergenic
1161289393 19:3484978-3485000 GAACAGTGAGGAGGCCAGTGTGG + Intergenic
1161291835 19:3498114-3498136 GAACAGCGAGGAGGCCTGTGTGG - Intronic
1161301612 19:3545418-3545440 GAACAGGGAGGAGGCCTGTGTGG - Intronic
1161442597 19:4300783-4300805 GAACAGCGAGGAGGCCCGTGTGG + Intronic
1161480144 19:4506254-4506276 GAATAGGAAGGAGGCCTGGGAGG - Intronic
1161485702 19:4534700-4534722 AAACAGGAAGCAGCCCAGAGAGG - Intronic
1161488313 19:4547835-4547857 GAACAGCAAGGTGGCCGGTGTGG - Intronic
1161492148 19:4567918-4567940 GAACAGCAAGGAGGCCCTTGTGG - Intergenic
1161505767 19:4642692-4642714 GAGCAGCAAGGAGGCCCGTGGGG + Intronic
1161544234 19:4870249-4870271 GAACAGTGAGGAGGCCCCAGTGG + Intergenic
1161623210 19:5310084-5310106 GAACAGCGAGGAGGCCTGTGTGG - Intronic
1161624714 19:5319670-5319692 GAACAGCGAGGAGGCCTGTGTGG - Intronic
1161625395 19:5323616-5323638 GAACAGCGAGGAGGCCCGTGTGG + Intronic
1161629359 19:5344510-5344532 GCACAGCAAGGAGGCCCGAGTGG - Intergenic
1161642955 19:5435735-5435757 GAACAGCGAGGAGGCCTGTGTGG - Intergenic
1161664225 19:5565172-5565194 GAACAGCGAGGAGGCCCGTGTGG - Intergenic
1161706315 19:5823774-5823796 GAACAGCAAGGAGGCCGGAGCGG - Intergenic
1161829076 19:6589859-6589881 GAACAGAGAGAGGGACAGAGGGG - Intronic
1161863707 19:6818443-6818465 GAACAGCAAGGAGGCCCATGTGG - Intronic
1161910234 19:7188003-7188025 GTGCAGAAAGGAGGCCAGCCTGG - Intronic
1162079593 19:8210048-8210070 GAGCAGAAAAGAGGCCAGCCTGG + Intronic
1162087841 19:8259347-8259369 GAAGAGCAAGGAGGCCTGTGTGG + Intronic
1162110348 19:8396670-8396692 GAACAGCATGGAGGCCTGTGTGG + Intronic
1162181617 19:8872967-8872989 GAACAGCAAAGAGGCCAGTGTGG - Intronic
1162324945 19:9993443-9993465 GAACAGAGGGGAGTTCAGAGTGG + Intronic
1162400717 19:10444993-10445015 GAACAGTGAGGAGGCCATTGTGG + Intronic
1162544673 19:11321611-11321633 TAGCAGCAAGTAGGCCAGAGTGG + Intronic
1162738770 19:12761862-12761884 GGACAGTAAGGGGACCAGAGTGG - Intergenic
1162772199 19:12955975-12955997 GAACAGCCAGGAAGCCAGTGTGG - Intronic
1162819367 19:13213195-13213217 TAACAGCAAAGAGGCCAGTGTGG - Intronic
1162820979 19:13223543-13223565 AGACCGAAAGGAGGCCAGTGTGG - Intronic
1162844747 19:13383571-13383593 GAACAGAAAGGAAGTCGGAGTGG - Intronic
1162972061 19:14186770-14186792 GAACAGGAGGGAGGACAGAATGG - Intronic
1163004358 19:14388417-14388439 GAAAGGAAAGGGGGTCAGAGGGG - Intronic
1163022263 19:14488838-14488860 GAACAGTGAGGAGGCCTGGGGGG + Intronic
1163057144 19:14728844-14728866 GAGAACAAAGGAGGCCAGGGGGG + Intronic
1163063105 19:14774317-14774339 GAAAGGAAAGGGGGTCAGAGGGG + Intronic
1163655285 19:18542290-18542312 GAACAGGAAACAGGCCAGAGGGG + Intronic
1164214818 19:23134774-23134796 GAATAGAAAGGCGGGAAGAGTGG + Intronic
1164696030 19:30245070-30245092 GACCTGAAAGGAGACCAGTGAGG - Intronic
1164697391 19:30256026-30256048 GAACAGCAAGGGAGCCACAGAGG - Intronic
1164746963 19:30623516-30623538 GCACAACAAGGAGGCCAGTGTGG - Intronic
1165374370 19:35431355-35431377 AAACCGAAAGGAGGCCAGTGTGG - Intergenic
1165476607 19:36034281-36034303 GAGAAGCAAGGAGGCCAGTGTGG - Intergenic
1165793910 19:38507519-38507541 GAACAGAGGTGGGGCCAGAGAGG + Intronic
1165905104 19:39188974-39188996 GAAGAGCACGGAGGCCAGTGTGG - Intergenic
1165940253 19:39411356-39411378 GAGCAGCTAGGAGGCCAGTGTGG - Intergenic
1166215668 19:41333071-41333093 GAACAGACAGGACGCCAGTGTGG - Intronic
1166257197 19:41615049-41615071 GAACAGCAAGGAGGCCACCCAGG + Intronic
1166346189 19:42167590-42167612 GAACAGCAAGAAGGCCAGAATGG + Intronic
1166348984 19:42185313-42185335 GACTAGAAAGGGGGCAAGAGGGG - Intronic
1166664665 19:44671872-44671894 GGACACTAAGGGGGCCAGAGGGG - Exonic
1166666785 19:44684909-44684931 GAGCAGCAAGGAGGCCAGTGTGG + Intergenic
1166864615 19:45828374-45828396 GAACAGACAGAAGGCCAATGTGG + Intronic
1166868854 19:45858334-45858356 GGACAGCGAGGAGGCCAGAGTGG - Intronic
1166875576 19:45895205-45895227 GATCAGCAAGGAGGCCACCGTGG - Intronic
1166879289 19:45917426-45917448 GAACAGCAAGGGGGCTGGAGTGG + Intergenic
1166929182 19:46291055-46291077 AATCAGCAAGGAGGCCAGTGTGG - Intergenic
1167081603 19:47279883-47279905 GAATAGCGAAGAGGCCAGAGTGG + Intergenic
1167090331 19:47339672-47339694 GAACAGCAAGGAGCCCAGTGTGG - Intronic
1167108068 19:47442446-47442468 GAATAGCAAGGAGGCCAGAAAGG - Intronic
1167242323 19:48351635-48351657 GAACAGCCAGGAGGCCTGCGGGG - Intronic
1167243448 19:48359299-48359321 GAACAGTGAGGAGGCCACTGTGG - Intronic
1167255229 19:48423650-48423672 GAACAGCAAGAAGGCCAGTGTGG + Intronic
1167273039 19:48517193-48517215 GAACAGGGAGGAGGCCAGCATGG - Intergenic
1167276274 19:48541924-48541946 GAATGTAAAGGAGGCCAGTGCGG - Intergenic
1167447171 19:49544414-49544436 CATCAGCAAGGAGGCTAGAGTGG + Intronic
1167472688 19:49684395-49684417 GAACAGCAGGGAGGCCCGTGTGG + Intronic
1167565301 19:50252359-50252381 GAACAGTGCGGAGGCCAGGGTGG + Intronic
1167603767 19:50469175-50469197 GAACAGCAGGGAGGCCAGTGTGG - Intronic
1167654778 19:50756414-50756436 GAACAGCAGGGAGGCCGGTGTGG - Intergenic
1167656459 19:50767493-50767515 GAACAGCAGGGAGGCCGGTGTGG - Intergenic
1167837448 19:52085711-52085733 GAACAGGAAAGAGGCCTGTGTGG + Intronic
1168333793 19:55585646-55585668 GGGCATAAAGGAGGCCAGTGTGG + Intergenic
1168410907 19:56139963-56139985 GAGCAGAAAGGAGGCATGACTGG + Intronic
1168473394 19:56659281-56659303 AAACAGCAAGGAGGCCAGTGTGG - Intergenic
1168644828 19:58053278-58053300 GGACAGAACGGAGGACACAGGGG + Intronic
925065079 2:923149-923171 GAACAGAAAGGAGGAGGAAGGGG - Intergenic
925084737 2:1099275-1099297 GAACAGGAAGCAAGACAGAGTGG + Intronic
925350987 2:3200631-3200653 GAACTGAAAGGTGGACACAGGGG + Intronic
925657925 2:6169208-6169230 GAAAAGAAAGAAAGACAGAGAGG - Intergenic
925974371 2:9131241-9131263 CAAAAAAAAGGAGGGCAGAGAGG + Intergenic
926195189 2:10759443-10759465 GAACAAAAAGGAGGCCTGCCCGG - Intronic
926566295 2:14478529-14478551 GAACACCAAAGAGGCCAGTGGGG + Intergenic
926649735 2:15329682-15329704 GAACATAAAAGGGGCCAGTGTGG - Intronic
926771581 2:16381730-16381752 GAATGGCAAGGAGGCCAGTGGGG + Intergenic
926842791 2:17101236-17101258 GAACAATAAGGAAGCCAGTGTGG + Intergenic
926995050 2:18725637-18725659 AAACATAAAGTAGGCCAGAATGG + Intergenic
927202748 2:20588719-20588741 GGCCAGAGAGGAGGGCAGAGGGG - Intronic
928002804 2:27539561-27539583 GAATAGAAAGGCGGGAAGAGTGG - Intronic
928125841 2:28615199-28615221 GAAGAGAAAGAAGGTCAGAGTGG + Intronic
928427956 2:31194141-31194163 GAGCAGAGAGGAAGCCAGAGAGG + Intronic
928510373 2:31997648-31997670 GAACAGCAAGGAGCCCAGAATGG + Intronic
928983058 2:37156219-37156241 GAACAGCAAGGAAGCCAGCGTGG + Intronic
929005237 2:37387270-37387292 GAAAAGCCAGGAGGCCAGTGTGG - Intergenic
929227680 2:39527253-39527275 GAAGTGAAAGAAGGCCACAGTGG - Intergenic
929446215 2:42003432-42003454 GCACAGCAAAGAGGCCAGAGTGG - Intergenic
929458050 2:42080143-42080165 CAATGGAAAGAAGGCCAGAGTGG - Intergenic
929642787 2:43598389-43598411 GAATAGCAAGGAGGCAAGAGTGG + Intergenic
929795532 2:45055774-45055796 GAACAGAGAGGTAGCCAGAGAGG - Intergenic
929852436 2:45604560-45604582 GAACAGCAAGAAGACCAGTGTGG - Intronic
929917933 2:46151646-46151668 GAACAGAGAGGAGGGGAGGGAGG + Intronic
930070687 2:47363614-47363636 GAACAGAAAGGAGGTCAATGGGG - Intronic
930090341 2:47527273-47527295 CAGTAGAAAGGAGGCCAGAGAGG - Intronic
930164784 2:48194383-48194405 AAATAGAAAGGAGGCCAGCATGG + Intergenic
930216371 2:48701401-48701423 GAACAGCAAGGAGGCCAATATGG - Intronic
930246969 2:48993732-48993754 GAACTGAAAGAAAGCCACAGGGG - Intronic
930771824 2:55137304-55137326 GGCTGGAAAGGAGGCCAGAGAGG + Intergenic
930891373 2:56392130-56392152 TTACAGAAAGGTGCCCAGAGGGG + Intergenic
931054172 2:58450026-58450048 GGACAAAAAAGAGGCCAGAGGGG - Intergenic
931075774 2:58710040-58710062 GAACAGCAAGGAGGTCAGGATGG - Intergenic
931117421 2:59179896-59179918 GACCACAAAGGAGGACAGGGAGG + Intergenic
931621229 2:64211698-64211720 GAACAGTCAGGAGACCAGTGTGG - Intergenic
931753805 2:65353972-65353994 GGAAAGAAAGGAGGCCAGACTGG - Intronic
932235666 2:70119295-70119317 GAACAGCAAGGAGGCCAGTGTGG + Intergenic
932254061 2:70268548-70268570 ACACAGAAAGGAGGCCAAGGCGG + Intronic
932377755 2:71253106-71253128 GAACAGCAAGAAGGCCAGTGGGG - Intergenic
932529398 2:72511766-72511788 GACCTGAAAGAAGTCCAGAGTGG - Intronic
932538304 2:72622996-72623018 GAACTGGAAGGGGGCAAGAGAGG + Intronic
933159560 2:79009037-79009059 GAACAAAAAGGTAGGCAGAGTGG + Intergenic
933165467 2:79070229-79070251 GAGCTGAAAGGGGGACAGAGTGG - Intergenic
933336425 2:80965361-80965383 GAGCAGACAGGTGGCCAGTGTGG + Intergenic
933352555 2:81173263-81173285 GAACACAGGAGAGGCCAGAGTGG + Intergenic
933787044 2:85851502-85851524 GAACAGAAACCATCCCAGAGTGG - Intronic
934051398 2:88214353-88214375 GAATAGAAAGGAGGCCAGGAAGG + Intergenic
934111730 2:88749761-88749783 GTACAGAAAGAAGGCCAAAGTGG + Intronic
934113442 2:88763910-88763932 GAACAGAACAGAGGCCTCAGAGG - Intergenic
934745399 2:96756397-96756419 GGACAGAAAGGAGGCGGGAGTGG - Intergenic
934746981 2:96765751-96765773 GAACAGCAAAAAGGCCAGTGGGG - Intronic
934769719 2:96900138-96900160 GCGCAGAGTGGAGGCCAGAGGGG - Intronic
935118712 2:100160950-100160972 GAAAAGAAAGCAGTCCAAAGTGG + Intergenic
935520176 2:104095037-104095059 GAAGAGCAAGGAGGCCTGAGTGG - Intergenic
935718694 2:105960732-105960754 GTACAGAAAGGAGGTCAGTGTGG - Intergenic
936042442 2:109160288-109160310 CAAGACAGAGGAGGCCAGAGAGG + Intronic
936073583 2:109387448-109387470 GAAAAGCAAGAAGGCCAGAGTGG - Intronic
936228012 2:110675438-110675460 GAACAGAAAGCAAGCCAGTGTGG + Intronic
936512499 2:113159460-113159482 GAACAGGGAGGAGGTCAGTGTGG + Intronic
936514140 2:113171128-113171150 GAATAGAAAGCAAGCCAGTGTGG - Intronic
936910629 2:117588947-117588969 CAACAGAAAGGTGGCCAGGTGGG - Intergenic
936917553 2:117655431-117655453 GAACAGCAAGATGGCCAGAGTGG + Intergenic
937171546 2:119876095-119876117 AAACAGAAAGGAGGCCATTATGG + Intronic
937190191 2:120088394-120088416 GAACACAAAGAAGGCAACAGCGG + Intronic
937207068 2:120243595-120243617 GCTGAGAGAGGAGGCCAGAGTGG - Intronic
937235563 2:120429917-120429939 GAACAGCAAGGAGCCCTGGGTGG - Intergenic
937293589 2:120796615-120796637 GAAAAGAAAGCAGGACAGAGAGG - Intronic
937347879 2:121138105-121138127 GAAAAGAGAAGAGGCAAGAGAGG + Intergenic
937701577 2:124868373-124868395 AAATAGCAAAGAGGCCAGAGTGG - Intronic
938082819 2:128379305-128379327 GGACAGGAGGGAGGCGAGAGGGG - Intergenic
938088576 2:128418022-128418044 GAATAGAAAGGCGGGAAGAGTGG - Intergenic
938203463 2:129397163-129397185 GAACAGTAGGGAGGCCTGAATGG + Intergenic
938263011 2:129908663-129908685 GGCCAGGGAGGAGGCCAGAGGGG + Intergenic
938276517 2:130030024-130030046 GGACAGCAAGGAGGCCAGTGTGG - Intergenic
938327476 2:130420784-130420806 GGACAGCAAGGAGGCCAGTATGG - Intergenic
938438856 2:131307335-131307357 GGACAGCAAGGAGGCCAGTATGG + Intronic
938622628 2:133072341-133072363 GAAATGAAGGGAGGGCAGAGAGG - Intronic
938644236 2:133314975-133314997 GAACAGCACAGAGGCCAGTGTGG + Intronic
938810355 2:134847017-134847039 GAACAGAAAGGAGGGCAATGTGG + Intronic
939028893 2:137046812-137046834 GAACCGAAAGGTGGCCAGTGTGG + Intronic
939076562 2:137609525-137609547 GAACAACACAGAGGCCAGAGTGG + Intronic
940012534 2:149070170-149070192 GAACATTAAGGAGGCCAGTGTGG - Intronic
940012844 2:149073006-149073028 GAACACCAAGGAGGCCAGAATGG + Intronic
940093965 2:149952642-149952664 GGACAGAAAGGTTTCCAGAGGGG - Intergenic
940210708 2:151253821-151253843 GAACAGCAAGGAGGCCTGTGTGG - Intronic
940719961 2:157271267-157271289 GAACTGAAAGAAGGCCAAGGTGG + Intronic
940819757 2:158339780-158339802 AAACAGAAAGAAGGCCAGCCTGG + Intronic
941032129 2:160524628-160524650 GAACTTCAAAGAGGCCAGAGTGG + Intergenic
941052121 2:160746855-160746877 GAACAGAAGGGAGGCCAGTGTGG - Intergenic
941374179 2:164707001-164707023 GAGCAGCAAAGAGGCCAGTGTGG - Intronic
942053526 2:172162578-172162600 GCACAGGAGGGAGGCCAAAGGGG - Intergenic
942053619 2:172162957-172162979 GCACAGAGAGGCGGGCAGAGAGG - Intergenic
942206989 2:173629082-173629104 GAACAGACAGGAGGTCAGTGTGG + Intergenic
942672924 2:178395731-178395753 AAACAGAAAGGATCCCAAAGTGG - Exonic
942741161 2:179179858-179179880 GAACATCAAGGAGGCTAGTGTGG - Intronic
942887201 2:180940044-180940066 GATCAGAAAGGAGGCCAATGTGG - Intergenic
943089636 2:183358381-183358403 GAAGAGAAAGGAAGCCAGGTGGG - Intergenic
943541229 2:189217377-189217399 TGACAAAAAGGAAGCCAGAGTGG - Intergenic
943631138 2:190253809-190253831 GAACTGAAAGAAGACCAGAGTGG - Intronic
943950529 2:194128912-194128934 GCACAGAAGGGAGGCCAATGGGG - Intergenic
944136641 2:196406695-196406717 GAACAGAGAGAGGGCCAGAGTGG - Intronic
944189216 2:196983382-196983404 GAACAGAAATGGGGCCAGTGTGG - Intronic
944487325 2:200220750-200220772 ACACATAGAGGAGGCCAGAGTGG - Intergenic
944490386 2:200252866-200252888 GAGGAGAAGTGAGGCCAGAGTGG + Intergenic
944649890 2:201819355-201819377 GAACAGCTAGGAGGCCAGTGAGG + Intronic
944860248 2:203809489-203809511 GAACAAAAGGAAGGCCAGTGTGG - Intergenic
944900149 2:204205684-204205706 GAACAGATGCGAGGCCACAGCGG + Intergenic
944902505 2:204230208-204230230 GAACAGAAAGCAAGCCAAAAAGG - Intergenic
945315666 2:208368436-208368458 GAACAGCATGGAGAACAGAGAGG - Intronic
945384029 2:209175443-209175465 CAACAGAAAGGAGACCAGTATGG + Intergenic
945538615 2:211053615-211053637 GAACTGACAGAAGGCCAGTGGGG - Intergenic
945557470 2:211297398-211297420 TAACTGAAAGAAGGCCAGTGTGG + Intergenic
945570701 2:211463902-211463924 GCACAGTAAGGAGGCCTGTGTGG - Intronic
945741110 2:213662362-213662384 GAACTAAAAGAAGGCCAGTGTGG + Intronic
945775988 2:214106813-214106835 GAACAACAAGGAAGCCAGTGTGG - Intronic
945929711 2:215842637-215842659 AAAGAGAAAGGAGTCAAGAGTGG - Intergenic
946033548 2:216724095-216724117 AAACAGCAAGGAGGCCAGGTGGG + Intergenic
946089532 2:217208350-217208372 GACCAGAAAGGAGACGAGAGAGG + Intergenic
946364678 2:219241603-219241625 GAACAGCAATGAGGCCACTGTGG + Intronic
946530416 2:220564312-220564334 GAGCAGCTAGGAGGCCAGTGTGG - Intergenic
946581319 2:221131009-221131031 GATCAGAAAGGAAGCCAGTGAGG - Intergenic
946882126 2:224186884-224186906 GCAAAGGAAGAAGGCCAGAGGGG + Intergenic
947105068 2:226660756-226660778 GACCTGAAAGGAGGCCAGAGAGG - Intergenic
947254241 2:228143968-228143990 GAACAGCAGAGAGGCCAGTGTGG - Intronic
947372476 2:229462817-229462839 AAACTGAATGGAGGCCAGTGGGG - Intronic
947396487 2:229692237-229692259 GAAAAAAATGGAAGCCAGAGAGG - Intronic
947880104 2:233501246-233501268 AAACAGCAAGAAGGCCAGTGTGG + Intronic
947978556 2:234388178-234388200 GAGGAGAAAGGGGGCGAGAGGGG + Intergenic
948658847 2:239494222-239494244 GAACAGAAAGGCAGCCAGCGGGG - Intergenic
948949425 2:241239420-241239442 TATCAGGAAGGAGGCCAGACAGG + Intronic
1168788693 20:561561-561583 AAACAGCAAGGAGGCCAGTGAGG + Intergenic
1168800276 20:640237-640259 AAGCAGCAAGGAGGCCAGTGTGG - Intergenic
1168811260 20:706247-706269 GAACAGAGAGAAGGCCAAGGTGG + Intergenic
1168820856 20:772966-772988 GGACAGCTAGGAGGCCAGTGTGG + Intergenic
1168954602 20:1826227-1826249 GAACAGCAAGGCGGCCGGTGTGG - Intergenic
1168962793 20:1880448-1880470 GGAGAGGAAGGAGGCCAGTGTGG + Intergenic
1169011940 20:2258243-2258265 GACGAGAAATGAGGCCAGAGGGG + Intergenic
1169224847 20:3849527-3849549 GAATAGAAAGCAGGTCAGTGTGG - Intronic
1169227796 20:3866828-3866850 GAAGAGAATGGAGACCAGAGGGG - Exonic
1169291286 20:4355276-4355298 GAACAGAAAGCAGGAGAGAAAGG - Intergenic
1169321323 20:4635408-4635430 GAATTGAAAGGAGGTCAGTGTGG - Intergenic
1169350910 20:4867210-4867232 GGTCAGCAAGGAGGCCAGTGCGG - Intronic
1169464353 20:5824153-5824175 GACCAGAAAGAAGGCCAGTGCGG - Intronic
1169477479 20:5945300-5945322 GAACAGAAAGAAGGCCATTGTGG - Intronic
1169649311 20:7849277-7849299 CAAATGAAAGGAGGGCAGAGCGG + Intergenic
1169709673 20:8547666-8547688 GAACAGTGAGGAGGCCACTGTGG - Intronic
1169758095 20:9064699-9064721 GGGATGAAAGGAGGCCAGAGTGG - Intergenic
1170201055 20:13744600-13744622 GAATAATAAGGAGGCCAGTGTGG - Intronic
1170272088 20:14538612-14538634 GAATAGAAAGAAGGCCGGTGTGG - Intronic
1170426747 20:16242746-16242768 GAACAGCAAAGAGGCCACAGTGG + Intergenic
1170846838 20:19969331-19969353 GAACAGCAAGGAGACCACTGCGG - Intronic
1170884455 20:20328104-20328126 GAATAAAAAGAAGGCCAGCGTGG + Intronic
1170895117 20:20405914-20405936 GAATAGAAAGGAGGACAGAAAGG - Intronic
1170914194 20:20606537-20606559 AAACAAAAAGGAGGAAAGAGAGG - Intronic
1170915247 20:20617130-20617152 GAACACAAAGGAGACCTAAGAGG - Intronic
1171220652 20:23393947-23393969 GAACAGCAAGGAGGCCAGGATGG + Intronic
1171961873 20:31500559-31500581 GAACAGAAAGGAGGTGTCAGAGG - Intergenic
1172008536 20:31833338-31833360 GAACAGGTAGGAGGCCAGTATGG + Intronic
1172026349 20:31951526-31951548 GAACCGAAAAGAAGCCTGAGGGG - Intronic
1172073070 20:32272847-32272869 AAAGAGGAAGGAGGCCAGTGGGG - Intergenic
1172089183 20:32415484-32415506 GGACAGGAAGGAGACCTGAGGGG + Intronic
1172115139 20:32569233-32569255 GAACAGCCAGGAGGCCAGTGTGG + Intronic
1172191177 20:33062837-33062859 GAAATGAGAGGAGACCAGAGGGG - Intronic
1172326085 20:34035968-34035990 GGAACGAAAGGAGGCCAGTGTGG + Intronic
1172582000 20:36055670-36055692 GAACAGCAAGGAGACTAGCGTGG - Intergenic
1172641188 20:36441249-36441271 GAGCAGAAAGGAGGCCGGCATGG - Intronic
1172845775 20:37929288-37929310 GAGCTGAAAGGAGGCCACTGTGG + Intronic
1172846218 20:37931293-37931315 GGACAGCAAGAAGGCCAGGGAGG - Intronic
1172872393 20:38143958-38143980 GGACAGAAACCAGGCAAGAGGGG - Intronic
1172884663 20:38223049-38223071 GAGTAGCAAGGAGGCCAGTGTGG - Intronic
1172890171 20:38258748-38258770 GCACAGAAGTGAGGCCAGGGAGG + Intronic
1172986544 20:38996005-38996027 GAACAGCAAGGAGACCAGTGAGG - Intronic
1172999737 20:39097131-39097153 GAAGAGAAACGAGGGCAGGGAGG + Intergenic
1173164603 20:40678149-40678171 AAACAGTAAGGTGGCCAGTGTGG + Intergenic
1173206900 20:41002352-41002374 GAAAAGAAAGAAGGCCAGTGTGG - Intergenic
1173529087 20:43754786-43754808 GAATAGCGCGGAGGCCAGAGAGG - Intergenic
1173671590 20:44802856-44802878 GAATAGAAAGCAGACCAGTGTGG - Intronic
1173841894 20:46162934-46162956 GGAGAGAAAGGAAGCCTGAGAGG + Intergenic
1173847741 20:46198724-46198746 GAACAGCAAAGAGGCCAGTGTGG - Intronic
1173902171 20:46598864-46598886 GAACAGCCAGGAAGCCAGTGTGG - Intronic
1173911650 20:46675104-46675126 GAACAGCAAGGAGCCCAGTGTGG + Intronic
1173953445 20:47011533-47011555 TAACAGCAAGGAGGCCAGTGAGG - Intronic
1173965290 20:47108027-47108049 GGACAGCAAGGAGGCCAGTGTGG + Intronic
1173985815 20:47260433-47260455 GATTAGCAAGGAGGCCAGGGTGG - Intronic
1173994114 20:47324676-47324698 GAGCTGAAAGGAGGCCATTGGGG - Intronic
1174056174 20:47800109-47800131 GAAAAGAAAGGAGGGAAGAGGGG - Intergenic
1174114797 20:48219550-48219572 GAACAGCAAGGAGGCCCCTGTGG + Intergenic
1174157498 20:48525299-48525321 AAACAGAGAGGAGGACAGACTGG - Intergenic
1174165889 20:48583378-48583400 GAATAGCAAGGAGGCCCGCGTGG - Intergenic
1174180710 20:48672618-48672640 GAGCAGAGAGGGGGCCAGGGTGG - Intronic
1174216238 20:48918776-48918798 GAACAAAAAGGAGCCCAGAGTGG + Intergenic
1174251859 20:49225926-49225948 GGCCAGCAAGGAGGCCAGTGTGG - Intronic
1174274231 20:49391996-49392018 GAGCAGACAGGTGGCCAGTGTGG - Intronic
1174276734 20:49409536-49409558 CACCAGAAAGGAGGCCAGTGTGG + Intronic
1174277312 20:49413447-49413469 GAACAGAAAGGAGTCGAGGAGGG - Intronic
1174277969 20:49417392-49417414 GAACAGCAAGAAGGCCACTGTGG - Intronic
1174278346 20:49419941-49419963 GAACAGAGGGGAGGCCAGCATGG - Intronic
1174285640 20:49471123-49471145 GAACAGCAAGGAGGCCACTGTGG + Intronic
1174306022 20:49614902-49614924 GAGCAGTGAGGAGGCCAGAGAGG + Intergenic
1174391237 20:50219555-50219577 GACCAGAAAGGGGGACAGGGAGG - Intergenic
1174396908 20:50252255-50252277 GAACAGTAGGGAGGCCACCGTGG + Intergenic
1174411614 20:50340267-50340289 GAACAAAGAGGAGCCCAGTGTGG - Intergenic
1174416967 20:50373859-50373881 GAGCAGGGAGGAGGCCAGTGTGG + Intergenic
1174417767 20:50378857-50378879 GAACAGAGAAGGGGCCAGTGTGG + Intergenic
1174450716 20:50618444-50618466 GCGCAGCAAGGAGGCCAGCGTGG - Intronic
1174468908 20:50740916-50740938 GAACAGGAAGGAAGCCAGTGTGG - Intronic
1174514835 20:51083690-51083712 GAACAGCAAGGGGGCCAGTGTGG + Intergenic
1174572088 20:51509051-51509073 GAACAGAGAGGAGGCCTGTGTGG - Intronic
1174578691 20:51555672-51555694 GAACAGCAAGGAGCCCAGTGGGG - Intronic
1174680260 20:52399726-52399748 GAGCAGAAAGAAAGCCAGTGAGG - Intergenic
1174727504 20:52878323-52878345 GGACAGAAAGGAGGCAAAGGAGG - Intergenic
1174806026 20:53605147-53605169 GAACAGCAAGGAGGCCAGCATGG + Intronic
1174828883 20:53794755-53794777 GAACAGCCAGAAGGCCAGCGTGG - Intergenic
1175319947 20:58078537-58078559 GAAGAGGAAAGAGTCCAGAGAGG + Intergenic
1175366333 20:58458828-58458850 AAACAGAGAGAAGGCCAGTGTGG + Intergenic
1175585718 20:60138266-60138288 GAACAGAAACGAGGACACTGGGG + Intergenic
1175959726 20:62629762-62629784 GAACAGAAATGTGTACAGAGGGG - Intergenic
1176665756 21:9685841-9685863 GAGCATCAAGGAGGCCAGTGTGG + Intergenic
1176732783 21:10517571-10517593 GAACAGCAAGGAGGCCAGCATGG - Intergenic
1177006738 21:15682585-15682607 AAACAGAAAGAGGGCCAGATGGG - Intergenic
1177079479 21:16620738-16620760 GCACAGGAAGGAGGGCAGAGTGG - Intergenic
1177421674 21:20867356-20867378 AAAAAGAAAGGGGGACAGAGAGG - Intergenic
1177861097 21:26455146-26455168 GAAGAGCAAGGAGGCCAATGTGG - Intergenic
1178140826 21:29681420-29681442 CAACAGCAAGGAGGCCAGGGTGG - Intronic
1178452329 21:32714190-32714212 GAACTGAAAGGCGGCCAATGAGG + Intronic
1178484515 21:33010101-33010123 TTAAAGAAAGGAGGCCAGGGGGG + Intergenic
1179089303 21:38249483-38249505 GAACAGAATGGATGACAGATAGG + Intronic
1179265456 21:39798759-39798781 TAACTGAAAGGATGCCAAAGGGG - Intronic
1179314766 21:40233575-40233597 GGACAGAAAGGTGGACATAGGGG - Intronic
1179336748 21:40463773-40463795 GAACAAGAAGGATGCCAAAGAGG - Intronic
1179815914 21:43906118-43906140 GAACAGAAAGAAGGGCAGGTTGG + Intronic
1180198189 21:46209629-46209651 GAAGAGACAGCAGGACAGAGAGG + Intronic
1180458860 22:15539875-15539897 GGACAGCAAGGAGGCCAGTATGG + Intergenic
1181316299 22:21972904-21972926 GAGCAGAAAGGAGGCTGGATGGG - Intronic
1181462082 22:23091883-23091905 GAACTGAAGGAAGGTCAGAGTGG - Intronic
1181600494 22:23949200-23949222 GCCCAGGACGGAGGCCAGAGAGG - Intergenic
1181608016 22:23992127-23992149 GCCCAGGACGGAGGCCAGAGAGG + Intergenic
1181969306 22:26678170-26678192 GAAGAGAAAGGAGGACTGGGAGG - Intergenic
1182247330 22:28969557-28969579 GAACAGCAGGGAGGCCAGTGTGG + Intronic
1182540294 22:31036462-31036484 GAACAGAATGAAGGCCACTGTGG - Intergenic
1182546698 22:31080969-31080991 GAACAAAGAGGAGGGCGGAGAGG + Intronic
1182677931 22:32054630-32054652 AAACTGAAAGGGGGCCAGTGTGG + Intronic
1182844410 22:33418681-33418703 CAACAGCCAGGGGGCCAGAGTGG + Intronic
1182844672 22:33420535-33420557 GAGCAGCAAGGAAGCCAGAGTGG + Intronic
1182920273 22:34072899-34072921 GAAAAGACAGGAGTCAAGAGTGG - Intergenic
1183232483 22:36591696-36591718 TAAAAGAAAGGAGGACAGAAGGG + Intronic
1183306653 22:37086426-37086448 GAACAGAAAGGTGGCAAGGCTGG + Intronic
1183513287 22:38248409-38248431 GAACAGCAAAGAGGCCAGCGTGG - Intronic
1183676311 22:39300704-39300726 GAACAGAGAGGAGACCTGTGTGG + Intergenic
1183676394 22:39301222-39301244 AACCAGGCAGGAGGCCAGAGGGG + Intergenic
1183691888 22:39394844-39394866 GAACAGCAAGGAGGCCAGCGTGG - Intergenic
1184099943 22:42336695-42336717 GGGCAGAAAGGAGGCCATTGTGG - Intronic
1184131829 22:42521105-42521127 GAACAGGAGCAAGGCCAGAGTGG - Intergenic
1184298253 22:43539886-43539908 GGATGGAAAGGAGGCAAGAGCGG - Intronic
1184374758 22:44104725-44104747 GAACAGCAAGGTGGTCAGGGTGG - Intronic
1184435804 22:44474642-44474664 GAAGAGACAGAAGGCAAGAGAGG - Intergenic
1184597518 22:45523209-45523231 GTACAGCAAGGCGGCCAGGGTGG + Intronic
1185137519 22:49081161-49081183 GAACTGAAAGGATGGCAGGGAGG + Intergenic
949529035 3:4935489-4935511 AAACAGAAAGGAGGCCAAAGTGG - Intergenic
949586935 3:5450111-5450133 GAACTGAAAGGAAGCCAGTGTGG + Intergenic
949891506 3:8736993-8737015 GAAAAGAAAGAAGGAGAGAGGGG + Intronic
949950961 3:9228513-9228535 GAAGAGGAGGGAAGCCAGAGAGG + Intronic
949985446 3:9537232-9537254 GAACAGAAAGGAGGGCAGTGTGG - Intronic
950155142 3:10716359-10716381 GAACAGGGAGGAGGCCAGTGTGG - Intergenic
950164415 3:10783075-10783097 GGGCAGAAATGAGGCAAGAGAGG + Intergenic
950169538 3:10828563-10828585 GAACAGAAAGAAGGCCAGTGTGG - Intronic
950467148 3:13162294-13162316 GATCCCAAAGGAGCCCAGAGAGG + Intergenic
950555752 3:13695030-13695052 GAACAGAGTGGAGACGAGAGTGG + Intergenic
950556887 3:13701368-13701390 GAACAGCGAGAAGGGCAGAGTGG - Intergenic
950585913 3:13892136-13892158 GAACAGAAAGTAGGACAATGAGG - Intergenic
950617944 3:14177530-14177552 GAAGAGAAAGGAGGCCAATAAGG + Intronic
950621234 3:14207142-14207164 GAATGGCAAGGAGGCCAGTGTGG - Intergenic
950647873 3:14388399-14388421 GAACTGAAAGGTCCCCAGAGTGG + Intergenic
950665139 3:14490688-14490710 GAAGAGAAAGAAGGCCTGGGAGG - Exonic
950721284 3:14884442-14884464 GAACAGAAAGAAGGCCAGTGTGG - Intronic
950850090 3:16053951-16053973 GAACACAAAGAAAGCCAGTGGGG + Intergenic
950850338 3:16056294-16056316 GACCAGAGATGTGGCCAGAGAGG - Intergenic
950859443 3:16134748-16134770 GAACTGAAAGGAAGCCAATGCGG + Intergenic
951054588 3:18132993-18133015 GAGCAGAAAAGAGGCAAGTGTGG + Intronic
951100149 3:18678053-18678075 TAACAGCAAGGAGGCCAGTGTGG - Intergenic
951223668 3:20096068-20096090 GTACAGCAAGGAGGGCAGCGTGG + Intronic
951867946 3:27328523-27328545 GAATAGCAAGGAAGCCAGTGGGG + Intronic
952121297 3:30247550-30247572 GAGGAGAAAGGAGGACATAGTGG + Intergenic
952171790 3:30815290-30815312 GAACAAAAAGGAAGGCAGGGAGG + Intronic
952235232 3:31472519-31472541 GGACAGCAAGGAGGCCATGGTGG - Intergenic
952410269 3:33042704-33042726 GACTAGCAAGGAGGCCAGTGTGG - Intronic
952461922 3:33536507-33536529 GAATAGCAAGGAGGCCAGTGTGG + Intronic
952478655 3:33737009-33737031 GAACACAAAGAAAGCCATAGTGG + Intergenic
952636786 3:35542695-35542717 TAAGAGCAAGGAGGCCAGAGTGG + Intergenic
952882135 3:37991629-37991651 GAAGAGAAAGGGGCCCTGAGTGG + Intronic
952975082 3:38687034-38687056 GAACAGCAAGGAGCACAGCGTGG + Intergenic
953383327 3:42490435-42490457 GAATAAAGAGGAGGCGAGAGAGG + Intronic
954088002 3:48261418-48261440 GAAAAGCAAGGAGGCCAAGGTGG + Intronic
954110864 3:48432052-48432074 GTTCAGAAAAGAGGACAGAGAGG + Intergenic
954756263 3:52841972-52841994 GAATAGATAGTAGGACAGAGGGG - Intronic
954826655 3:53379353-53379375 GAATAGCAAAGAGGCCAGCGTGG - Intergenic
954847591 3:53573337-53573359 GAACAGCAAGGAGACAAGTGTGG - Intronic
954950557 3:54468870-54468892 ACCCAGAAAGGAGGCAAGAGAGG - Intronic
955389742 3:58512632-58512654 GAACACAGAAGAGGCCACAGGGG - Intronic
955400981 3:58591412-58591434 GAGCAGCAAGGAGGTCAGGGTGG + Intronic
955509876 3:59668909-59668931 ATACAGGAAGGAGGCCAGTGTGG - Intergenic
955617421 3:60823940-60823962 GAACAGCAGGGAGGCCAGTATGG + Intronic
955790044 3:62579659-62579681 GAAAAGCAAGGAGGCCAGTGTGG + Intronic
956058136 3:65322264-65322286 GAACTGCAAGGAGGCCAGTGAGG + Intergenic
956084138 3:65591734-65591756 GAACAGCAAGGAGGCCGGAGTGG - Intronic
956125676 3:66008871-66008893 GAACAGAGAGAAGCCCTGAGAGG + Intronic
956404485 3:68913436-68913458 GAACAGAAAGGAGGGCATGGAGG + Intronic
956410586 3:68974290-68974312 GAAGAGCAAGGAAGCCAGTGTGG - Intergenic
956576689 3:70760027-70760049 GAACAGCAAGGAAGCCACAGTGG + Intergenic
956806743 3:72821698-72821720 AAAGAGGAAGAAGGCCAGAGAGG + Intronic
957703904 3:83755266-83755288 GAACAGTTAGGAGGCCTCAGAGG + Intergenic
957898380 3:86453165-86453187 AAACAGAATGGAGGCGACAGAGG + Intergenic
958753854 3:98226592-98226614 GACAAGAGAGGAGGCAAGAGAGG - Intergenic
958889839 3:99771093-99771115 GAACAGAGAGAAGGTCAGTGTGG + Intronic
959198664 3:103218352-103218374 AAACAGGAAGAAGGCCAGTGTGG + Intergenic
959329415 3:104983980-104984002 AAACAGTAAGAAGGCCAGTGTGG - Intergenic
959513907 3:107244501-107244523 GATCTGGAAGGAGGCCAGGGAGG - Intergenic
959593255 3:108102014-108102036 GAAGAAAAATGAGGCCAGATAGG - Intergenic
959838400 3:110947682-110947704 GAAAAGAAAGGAGAGGAGAGGGG + Intergenic
960023874 3:112987240-112987262 AAACAGCAAGGAAGCCAGTGTGG + Intergenic
960054130 3:113264650-113264672 GGACAGGAAGGGGGCCAGGGAGG - Intronic
960129736 3:114043264-114043286 AAACAGCAAGGAGGCCAGTGTGG + Intronic
960354956 3:116640261-116640283 GAACAGAAGGAAGGCCAGTTTGG - Intronic
961012274 3:123444414-123444436 GAAGAGAAAGGAAGTCAGAGAGG + Intronic
961237838 3:125383616-125383638 GAACAGCAAGGTGGCCAGTGTGG - Intergenic
961288819 3:125828777-125828799 AAAACAAAAGGAGGCCAGAGTGG + Intergenic
961486209 3:127218561-127218583 GAACAGCAGGGAGACCAGTGTGG - Intergenic
961523709 3:127483439-127483461 GAACAGCGAGGAGACCAGTGTGG - Intergenic
961611919 3:128146202-128146224 TAACAGCAAGGGGGCCAGTGTGG + Intronic
961659398 3:128460495-128460517 GAACAGCAAGAAGGCCAGGAAGG - Intergenic
961736559 3:129005387-129005409 AAACTAAAAGGAGGCCAGAGTGG + Intronic
961824494 3:129592009-129592031 GCACAGAAATGAGGCCAGTGTGG - Intronic
961847714 3:129781599-129781621 GAACAGCAAGGGGGCCAGTGTGG + Intronic
961898251 3:130187249-130187271 AAAACAAAAGGAGGCCAGAGTGG - Intergenic
961930492 3:130528232-130528254 GAACAAAAAGGTTGCCAGAGAGG + Intergenic
962026053 3:131548665-131548687 GAACAGCAAGAAGGTCAGTGTGG + Intronic
962159674 3:132985710-132985732 GAACAGCAAAGAGGCCAGTTTGG - Intergenic
962302366 3:134253614-134253636 GAACAGAAAGGAAGCCTTTGTGG - Intergenic
962314651 3:134351502-134351524 GAGCAGAAAGGAAGCTGGAGAGG + Intergenic
962338848 3:134563833-134563855 AAACAGAAAGGACGCCAGCATGG - Exonic
962494431 3:135924888-135924910 GAGGAGAAAGGAGACCAAAGGGG - Intergenic
962519210 3:136182728-136182750 AAAGAGAAAGAAGTCCAGAGTGG + Intronic
962649718 3:137476288-137476310 GAACAGTGAAGAGGCCAGTGTGG - Intergenic
963035887 3:141028497-141028519 GGACAGGGAGGGGGCCAGAGAGG - Intergenic
963084869 3:141427488-141427510 GAACAGAAGGGTGGCTAGTGTGG + Intronic
963275574 3:143326476-143326498 AAACAGAAAGAAGGCCAGTGTGG - Intronic
963287677 3:143450960-143450982 AGAGAGAAAGGAGGCCTGAGGGG + Intronic
963314620 3:143746014-143746036 GAAGAGAAAGAAGGCCAGTGTGG + Intronic
963322303 3:143822212-143822234 GAAGAGGAAGGAAGCCTGAGTGG - Intronic
963381061 3:144530880-144530902 TAAGAGGAAGGAGACCAGAGAGG + Intergenic
963492135 3:146015528-146015550 GAAGAGAAAGGAGGAGAGGGAGG - Intergenic
963728234 3:148945849-148945871 GAACAGCGAGGAGACCAGTGTGG - Intergenic
963905509 3:150770610-150770632 GTTCAGAAAGGAGGCCAGCAGGG - Intergenic
963924455 3:150936820-150936842 GAACCGAAAGAAGGCCAATGTGG - Intronic
964028155 3:152103358-152103380 TAAAAGAGAGGAGGCTAGAGGGG + Intergenic
964155622 3:153581664-153581686 GAATAGCAAGGAGGCCAGAGTGG - Intergenic
964231073 3:154468763-154468785 GAACAGCAAGGAGGCCAATGTGG - Intergenic
964263407 3:154867059-154867081 GATGAGAAAGGAGGCCAGGGAGG - Intergenic
964280205 3:155055714-155055736 GACTAGAAAGGAGCCCAAAGAGG + Intronic
964544845 3:157822544-157822566 GAACAGAAAGAAGGCCAGGATGG - Intergenic
964604150 3:158541113-158541135 GATCAGAAAAAAGGCCAGAGGGG - Intronic
964658241 3:159091846-159091868 AAAGAGAAAGGAGGAAAGAGTGG + Intronic
964746454 3:160017105-160017127 AAACTGAAAGGAGGCAAGAGAGG + Intronic
965129646 3:164680657-164680679 GTACAGAAAGGAGATAAGAGGGG + Intergenic
965163439 3:165165134-165165156 GAACAGAACAGAGGCCTCAGAGG - Intergenic
965569995 3:170162853-170162875 GAACAGAAAGGAGGACAGTGTGG - Intronic
966727889 3:183124263-183124285 GTCCAGAAAGCAGGCTAGAGGGG + Intronic
966748735 3:183302428-183302450 TAGCAGGAAGGAGGCCAGTGTGG + Intronic
966947829 3:184789806-184789828 GAATGGCAAGGAGGCCAGTGTGG + Intergenic
967037921 3:185661976-185661998 AAACAGAAAGGAGGGCAGTGTGG + Intronic
967281792 3:187830242-187830264 GAACAACAAGGAGGCCAGTGTGG - Intergenic
967375509 3:188796273-188796295 GAACTGAAAGAAGGCCAGTGTGG + Intronic
967799300 3:193638215-193638237 GCACAGCCAGGAGGCCAGTGTGG + Intronic
967804402 3:193702332-193702354 GTACAGGAATGAGGCCAGAAAGG - Intergenic
968808477 4:2789571-2789593 GAGGAGACAGGAGGCCAGTGTGG + Intergenic
968947901 4:3675131-3675153 GAAGAGAAAGGAAGACAGGGAGG - Intergenic
969180015 4:5433169-5433191 GGATAGAAAGGAGGATAGAGAGG + Intronic
969272515 4:6112579-6112601 GGACAGACAGCAGGGCAGAGAGG + Intronic
969293870 4:6257681-6257703 GGACAGGAAGGAGGCCGGTGTGG + Intergenic
969431555 4:7157893-7157915 GAACAGCAAGGAGGCCACCGTGG - Intergenic
969465862 4:7355996-7356018 GGACAGAAAGAGGGCCAGAGTGG - Intronic
969504164 4:7573885-7573907 GCACAGCGAGGAGGCCAGGGAGG - Intronic
969872002 4:10110470-10110492 CAACACACAGGAGGCCACAGTGG + Intronic
970072651 4:12178835-12178857 AAACAGAAAGTAGGTCATAGTGG + Intergenic
970284908 4:14501231-14501253 GGAAAGTAAGGAGGCCAGTGTGG + Intergenic
970404810 4:15752738-15752760 GAACGGCAAGGAGGCCAGGATGG + Intergenic
970548743 4:17157209-17157231 GAACAGCAAGGGGTCCTGAGAGG - Intergenic
970882302 4:20946385-20946407 AAACAGAGAGAAGGCCTGAGTGG + Intronic
970956632 4:21819266-21819288 GAACTGAAAGAAGGCCAGCATGG - Intronic
971256575 4:25019623-25019645 GAATAGCAAGGAGGCCAGTGTGG - Intronic
971270679 4:25141848-25141870 AAGCAGCAAGGAGGCCAGTGTGG - Intronic
971332639 4:25694832-25694854 AAACTGACAGGAGGCCAGAAAGG - Intergenic
971374661 4:26047282-26047304 GAAAGGCAAGGAGGCCAGTGTGG + Intergenic
971475688 4:27069580-27069602 AAACAGTAAAGAAGCCAGAGTGG + Intergenic
971479643 4:27102958-27102980 GGACAGAAAGGGGGCATGAGTGG - Intergenic
971482768 4:27128841-27128863 AAATAAAAAGGAAGCCAGAGGGG - Intergenic
972380939 4:38519788-38519810 GAACAGAGAGGAGGCCAAACTGG + Intergenic
972580221 4:40388549-40388571 GCACAGAGAGGAGGCCAGTGTGG + Intergenic
972604505 4:40601721-40601743 GCAGAGGAAGGAGGCCAGTGCGG - Intronic
972752846 4:42009909-42009931 AAACAGAGAGCAGGGCAGAGAGG - Intronic
973158019 4:46981947-46981969 GACTAGAAAGGAGGCCAGTGGGG + Intronic
973165453 4:47071460-47071482 GAACAGAAAGGAGGCAGGCATGG - Intronic
973570717 4:52236746-52236768 AAACAGAAAGAAGGCTTGAGAGG + Intergenic
973983138 4:56323513-56323535 GGAGAGAAAGCAAGCCAGAGAGG + Exonic
974617867 4:64313119-64313141 GACAAGAAAGGAGGTCAGTGTGG + Intronic
974840230 4:67290854-67290876 GAAAGGAAAGGAGGGAAGAGAGG + Intergenic
975197581 4:71543368-71543390 GAACAAAAAGAAGTCCAGTGTGG + Intronic
975319855 4:72997595-72997617 GAACAGCAAGGAGGTGAGTGTGG - Intergenic
975383762 4:73731554-73731576 GAACAGTAAGGAGGCCAGTGTGG - Intergenic
975617128 4:76257588-76257610 GAGCAGCCAGGAGGCCAGAGTGG - Intronic
975858504 4:78650595-78650617 GAACAGTAAGAAGGCCAGTGTGG - Intergenic
976005920 4:80430863-80430885 GAACAGCAAAGAGGCTAGAATGG - Intronic
976011500 4:80494576-80494598 GAACTGAAAGGAGGCTAGGGTGG - Intronic
976111572 4:81680300-81680322 GACCAGAAAGGAGGTCTGTGTGG + Intronic
976123756 4:81811069-81811091 GAAGAGTAAGGAGGCCAGTGTGG - Intronic
976214018 4:82698651-82698673 GAGCAGAAAGATGGCCAGCGTGG - Intronic
976250852 4:83050694-83050716 TAAGAGCAAGGAGGCCAGTGTGG + Intronic
976276946 4:83287768-83287790 TAAGAGCAAGGAGGCCAGTGTGG + Intergenic
976483035 4:85566978-85567000 GAACTGAAAGGAGACAAGAGTGG + Intronic
976514559 4:85950189-85950211 GAACATAAAGAAGGCCACTGGGG + Intronic
976604599 4:86970863-86970885 GAACAGCAAGGTAGCCAGTGAGG + Intronic
976718761 4:88150396-88150418 GAACAGCAAAGAGGCCAGTGAGG + Intronic
976879385 4:89900305-89900327 AAACAGAAAGGAAGCCAGTGTGG - Intronic
977366751 4:96079268-96079290 GAACAGCCTGGAGGCCAGTGTGG + Intergenic
977723869 4:100271411-100271433 GAACAGAGAGGAGGAAAGGGAGG + Intergenic
977724172 4:100275583-100275605 GAACTGAAAGGAGGCCTGTGTGG - Intergenic
977766160 4:100800017-100800039 ACACAGAAAGAAGGACAGAGAGG - Intronic
977796178 4:101167817-101167839 AAAGAGAAGGGAAGCCAGAGGGG + Intronic
977816284 4:101417042-101417064 GCACAGGAGGGAGGCCAGGGTGG - Intronic
977991824 4:103452266-103452288 GAACAGAAAGGAGGATGGTGTGG - Intergenic
978085378 4:104645548-104645570 GCACAGAAAGGAGGCCTTAAGGG - Intergenic
978144998 4:105362266-105362288 GAACAGCAAGGAGGCTTGTGTGG - Intergenic
978153829 4:105467370-105467392 AAACAGCAAGGAGGCCAGGATGG + Intronic
978159470 4:105528791-105528813 GAACAGCAAGTAGGCCAGTATGG + Intergenic
978194438 4:105954440-105954462 GAACAGGAAGAAGGTGAGAGTGG - Intronic
978409329 4:108410119-108410141 GAATAGAAAGGCGGGAAGAGTGG + Intergenic
978466701 4:109016314-109016336 GCAAAGAATGGAGGCCAGTGGGG + Intronic
978567085 4:110094610-110094632 GAACAGCAAGGAGGCAAGAGTGG + Intronic
978755118 4:112293458-112293480 GGATAGAAAGAAGGCCACAGAGG - Intronic
978876561 4:113646634-113646656 GAAATGCAAGGAGCCCAGAGGGG + Intronic
979057028 4:116008791-116008813 GAACAGAAAGGAATCCGGTGGGG + Intergenic
980094967 4:128480047-128480069 AAACAGAAAGGACGCCAGTGAGG - Intergenic
980469800 4:133236359-133236381 GAAAAGAAAGAAGGTCAGTGTGG + Intergenic
980652508 4:135737113-135737135 GGAAATAAAGGAGGCCAGAGCGG + Intergenic
980662197 4:135876508-135876530 AAACTGAAAGAAGACCAGAGTGG + Intergenic
980739762 4:136934817-136934839 GAAAAGAAAGGAGGTCCCAGGGG - Intergenic
981055266 4:140353779-140353801 TAACAGAAAGGCGGCAAGAGAGG - Intronic
981065967 4:140486117-140486139 GAACAGCAAGGAGGCCAGTGTGG - Intronic
981235164 4:142406921-142406943 GAAGAGAAATGAAGCCAGTGGGG - Intronic
981464737 4:145055265-145055287 TAAAAAAAAGGAGGCCAGTGAGG + Intronic
981563541 4:146073788-146073810 GAATAGCAAGGAGGCCAGTGTGG - Intergenic
981689740 4:147494528-147494550 GAAGAGCAAGGAGGCCATCGTGG + Intronic
982000243 4:151015441-151015463 GGAGAGAAGGGAGGACAGAGAGG + Intronic
982040549 4:151391342-151391364 GAATAGAAAGGCGGGAAGAGTGG + Intergenic
982227024 4:153175592-153175614 GAAGAGTAAGGAGGTCAAAGTGG + Intronic
982270041 4:153577176-153577198 GAGCAGAAACGAGACCAGTGAGG + Intronic
982583413 4:157207573-157207595 TATCAGGAAGGAAGCCAGAGGGG - Intronic
982592068 4:157326081-157326103 GAACAGCAAGGAGGCCAATGTGG - Intronic
982786497 4:159543156-159543178 GAACAGTAAGGAGGGCAATGTGG + Intergenic
983439643 4:167764986-167765008 CAAAAGAAAGGAAACCAGAGGGG + Intergenic
983727513 4:170946580-170946602 GAACAGCCAGGTGGCCAGTGGGG - Intergenic
983984390 4:174040680-174040702 AAACATAAAGAAGGCCAGTGGGG + Intergenic
984826372 4:183928298-183928320 GCACAGAAAGGAGACCATGGGGG - Intronic
984846213 4:184110166-184110188 GAACAGAAAGAAGGGGTGAGGGG - Intronic
985166835 4:187105033-187105055 GAACAGAGAAGAGGAGAGAGTGG + Intergenic
985312371 4:188616382-188616404 GAACAACAAGGAGACCAGTGAGG - Intergenic
985411480 4:189690105-189690127 GAGCATCAAGGAGGCCAGCGTGG + Intergenic
985677030 5:1237508-1237530 GGACAGGAGGGAGGCCGGAGAGG + Intronic
985868919 5:2538469-2538491 AAACAGCAGGAAGGCCAGAGGGG + Intergenic
986119413 5:4817817-4817839 AAACAGCAAGGAGGCCAGTGTGG + Intergenic
986177584 5:5365127-5365149 GAACTGAAAGCAGGCCTGTGAGG + Intergenic
986192408 5:5509612-5509634 GAACAGAAGGGACATCAGAGTGG + Intergenic
986351657 5:6885705-6885727 AAACAGGAAGGAGGCCAGTGTGG + Intergenic
986814512 5:11393964-11393986 GAGCAGCAAGGATGCCAGAGTGG - Intronic
987266067 5:16256215-16256237 GAAAAGAAAAGATGCCAAAGGGG + Intergenic
987873855 5:23654640-23654662 GAAGAGCAAGGAGGCCAGTATGG - Intergenic
987878345 5:23710374-23710396 GATCATAAAGGAGGCCACACTGG + Intergenic
989180141 5:38568400-38568422 GAACTGCAAGGAGGTCAGTGTGG + Intronic
989655032 5:43737283-43737305 GAACAGCTGGGAGCCCAGAGAGG - Intergenic
989675884 5:43971787-43971809 GAAAAGAAAGGATGCAAGATTGG - Intergenic
990301273 5:54451601-54451623 GGACAGACAGGAGGCCAGTGTGG + Intergenic
990384456 5:55245969-55245991 GACCAGCAAGGCGGCCAGTGTGG + Intergenic
990409187 5:55523705-55523727 TCACAGAAAAGAGGCCAGTGTGG - Intronic
990420332 5:55625608-55625630 GAACAGAGAAGGGGCCAGGGAGG - Intergenic
990858969 5:60304267-60304289 GAGCAGAAAGTAGGGGAGAGAGG + Intronic
990900808 5:60746997-60747019 GACCAGCAAGGAGGCCAGTGTGG + Intergenic
990989316 5:61669755-61669777 GAATAGAAAGAAGGCCAGCGTGG - Intronic
991438613 5:66622300-66622322 GAATGGTAAGAAGGCCAGAGTGG + Intronic
991933621 5:71780896-71780918 GAGCAGCAAGGAGACCAGTGTGG - Intergenic
991979016 5:72212365-72212387 GAATAGCAAGGAGGCCAGTATGG - Intergenic
992367395 5:76106584-76106606 AAACAGGAAGGAGGCCAGTGTGG - Intronic
992753797 5:79885728-79885750 GAAGAGAGAAGAGGCCACAGAGG + Intergenic
992867816 5:80975248-80975270 GAGCAGCAAGGATGCCTGAGAGG - Intronic
993775619 5:91991759-91991781 GAAGAGCAAGAAGACCAGAGGGG + Intergenic
994027116 5:95097466-95097488 AGACAGAAAGAAGGCCAGTGTGG + Intronic
994054328 5:95398866-95398888 GAACAGAAAGGGGGCAAGGATGG + Intronic
994055886 5:95414624-95414646 GAACAGCTGGGAGGCCAGTGTGG - Intronic
994934678 5:106239055-106239077 GAAAAGAAAGAACGACAGAGGGG + Intergenic
995283932 5:110365388-110365410 GAACAGAAAGAAGCCCAGTGTGG + Intronic
996369884 5:122741882-122741904 GAATAGCAAGGAAGCCAGTGAGG - Intergenic
996412906 5:123178074-123178096 GAACAGAAATGACCACAGAGAGG - Intronic
996431315 5:123381311-123381333 AAACGGAATGGAGACCAGAGAGG + Intronic
996478473 5:123947839-123947861 GAACAGAAGGTAGGCCACAGGGG + Intergenic
996571916 5:124940795-124940817 GAAAAGCAAGGAGGCCACTGTGG + Intergenic
996750613 5:126884807-126884829 GGACAGCAGGGTGGCCAGAGTGG - Intronic
996952654 5:129146532-129146554 TGACAGAAAGCAGACCAGAGTGG - Intergenic
997039625 5:130236161-130236183 GTACAGAAAGAAGGCCAGGGTGG + Intergenic
997212107 5:132082952-132082974 GATAAGAAAACAGGCCAGAGAGG - Intergenic
997375102 5:133392143-133392165 GAATAGCTAGGAGGCCATAGAGG + Intronic
997581923 5:135023467-135023489 GGACACAAAGGAGTGCAGAGAGG + Intergenic
997675187 5:135707479-135707501 GAACAGCAAGGAAGCCAAAGTGG - Intergenic
997874236 5:137534288-137534310 GGACAGCAAGGAAGCCAGTGTGG - Intronic
997878672 5:137571000-137571022 GAACAGCAAGGGGGCCAGGGTGG + Intronic
997958904 5:138303500-138303522 GGACAGCAAGAAGGCCAGTGTGG - Intronic
998295551 5:140966452-140966474 AAACAGAAGGGAAGACAGAGGGG - Exonic
998314733 5:141172829-141172851 AAGAAGAATGGAGGCCAGAGTGG + Exonic
998599882 5:143574807-143574829 GAAAAGAAGGGAGACCAGGGAGG - Intergenic
998761345 5:145435412-145435434 GAACAGAAAGAAGGACCAAGTGG + Intergenic
998804709 5:145907050-145907072 GAGCAGCAAGGAGGCCGGGGTGG + Intergenic
998918611 5:147042938-147042960 GAACAGCAATGAGTCCAGTGTGG + Intronic
998923398 5:147095953-147095975 GAACATTAAGGAGGCTGGAGTGG + Intergenic
999115877 5:149162972-149162994 GAAAAGAAAGGAGGCCAGTGAGG + Intronic
999266167 5:150268307-150268329 GGGCAGAGAGGAGGCCAGTGTGG - Intronic
999295149 5:150454826-150454848 CAACAGCAAGGAGGCCAGGGTGG + Intergenic
999326503 5:150647543-150647565 GAAGAGAAAGCAAGCCAGTGTGG + Intronic
999441266 5:151602563-151602585 GAGCAGAATGGATGCCAGACAGG + Intergenic
999453652 5:151697146-151697168 GGACAGAAAGAAGGCCAAGGAGG + Intergenic
999482741 5:151964064-151964086 GAGCAGAATGGAGACCAGAAAGG - Intergenic
999563273 5:152828632-152828654 GATCTGAAAGAAGACCAGAGTGG + Intergenic
999681294 5:154062795-154062817 GAACAGCAAGGAGGCCAGGGTGG - Intronic
999784351 5:154878203-154878225 GAAAAGAAAGGAGGGGAGGGAGG - Intergenic
999806066 5:155082486-155082508 GAACAGAAAGGAGGCCATCATGG - Intergenic
1000027642 5:157373906-157373928 AAAAAGAAAAGAGGCTAGAGTGG + Intronic
1000235553 5:159356342-159356364 GAACAGTAAGGAGGCCAGTGTGG - Intergenic
1000277811 5:159754527-159754549 GAGCAGAAAGAAGGCCTGTGTGG + Intergenic
1000345270 5:160308978-160309000 GAACAGAAAGGAGGTCAGTGTGG + Intronic
1000364496 5:160478445-160478467 GAACAGCAAGGAGGCCAGGTGGG + Intergenic
1000674235 5:164101192-164101214 GATAAGAAAAGAGACCAGAGAGG + Intergenic
1000883012 5:166718785-166718807 GAGCAGAGAGGAGGCCAGAATGG + Intergenic
1001016872 5:168149826-168149848 GGACAGAGAGGAGGCCCGTGTGG - Intronic
1001434083 5:171685928-171685950 GGACAGAAAGGAGGCCAGTGTGG - Intergenic
1001531189 5:172463019-172463041 GAAGAAAAAGGAGGTCAGTGTGG + Intergenic
1001545452 5:172568124-172568146 GAACAGAATAAAGGCCAGTGTGG + Intergenic
1001637644 5:173223526-173223548 TAACAGTAAGGAAGTCAGAGAGG + Intergenic
1001696185 5:173671763-173671785 GAACAGTGAGGAAGCCAAAGTGG + Intergenic
1001853624 5:174991457-174991479 GAAGTGAAAGAAGACCAGAGAGG - Intergenic
1001923241 5:175617167-175617189 AAACAGAGAAGAGGCCAGTGTGG + Intergenic
1001966512 5:175913657-175913679 AAACAGCAAGCAGGCCAGTGTGG + Intergenic
1002100875 5:176856949-176856971 GGACAGCAGGGAGGCCAGTGTGG - Intronic
1002200982 5:177528073-177528095 AGACAGAAAGGACGTCAGAGGGG + Intronic
1002250435 5:177925547-177925569 AAACAGCAAGCAGGCCAGTGTGG - Intergenic
1002281367 5:178131810-178131832 GAACAGAAAGCAAGCTAGTGTGG + Intronic
1003123000 6:3333487-3333509 GAGCAGCAGGGAGGCCAGTGTGG - Intronic
1003517269 6:6827490-6827512 GCACAGAAGGGAAGACAGAGGGG + Intergenic
1003558499 6:7161769-7161791 GAACCAAAAGGAGGCCAGGCAGG - Intronic
1003653531 6:7985038-7985060 GAAAAGAAAGAAGTACAGAGAGG - Intronic
1003706421 6:8536295-8536317 CAACAGCAAGGAGGCGAGTGAGG + Intergenic
1004062252 6:12208988-12209010 GAACAGCGAGGAGGCCAGAGTGG - Intergenic
1004083843 6:12424189-12424211 GAACTGAAAGCAGGCCAAATGGG + Intergenic
1004087540 6:12465442-12465464 AAATAGAAAGGAGGCTAGTGTGG - Intergenic
1004267923 6:14165475-14165497 GGACAGCAAGGGGGCCAGAGTGG + Intergenic
1004288575 6:14345945-14345967 GAACAGAAAAGAGGAGAGAGGGG + Intergenic
1004490447 6:16110085-16110107 GGACAGCAAGGAGGCCAGTGTGG + Intergenic
1004585369 6:16994615-16994637 GAACAGAAACAAGACCAGTGGGG + Intergenic
1004736423 6:18410633-18410655 GCTCAGGCAGGAGGCCAGAGAGG + Intronic
1004917412 6:20344916-20344938 GAAAAGCAAGGAGGCCAGAGTGG - Intergenic
1005304179 6:24497677-24497699 GAACAGCAAGGAGGCCCGTGTGG + Intronic
1005808006 6:29493212-29493234 GAAAAGAAAGAAGGCCAGTGTGG + Intergenic
1005841175 6:29745463-29745485 GGCCAGAAAGGAGGTGAGAGTGG - Intergenic
1005942288 6:30569574-30569596 AAACAGGAAGGAGGCAAGAGGGG - Intergenic
1005959627 6:30686143-30686165 GGACACAAAGCAGGGCAGAGGGG + Exonic
1006042459 6:31267676-31267698 GAAGAGCAAGGAGGCCAGGAGGG - Intergenic
1006102974 6:31697644-31697666 AAGCAGAAAGGAGGCAGGAGAGG - Intronic
1006333067 6:33405892-33405914 GAACAGCCAGGAGGCCAGCATGG - Intronic
1006382816 6:33710463-33710485 GGACAGAAAGAAAGCCAGAATGG - Intronic
1006488651 6:34366531-34366553 GGGCAGAGAGGAGGCCAGAATGG + Intronic
1006515521 6:34543688-34543710 GAACAGCAAACAGGCCAGTGTGG + Intronic
1006753319 6:36393308-36393330 GAATGGCAAGGAGGCCAGTGTGG - Intronic
1006948687 6:37803058-37803080 GAAAAGAAATGAGGCCAAATGGG - Intergenic
1006998133 6:38282665-38282687 GAGCAGCTAGGAGGCCAGTGTGG - Intronic
1007023330 6:38544601-38544623 GAACAGCAAGGAGGCCAATGCGG + Intronic
1007368005 6:41408085-41408107 GAGCAAAGAGGAGGCCTGAGAGG + Intergenic
1007374140 6:41444842-41444864 GAGGAGAGAAGAGGCCAGAGTGG + Intergenic
1007390067 6:41545871-41545893 GAGCAGGAGGGAGGCCAGACAGG + Intergenic
1007440846 6:41858582-41858604 GAACAGTGAGGAGGCCAATGTGG - Intronic
1007499912 6:42288790-42288812 GAACTAAAAGAAGGCCAGTGTGG + Intronic
1007597857 6:43062658-43062680 GGGCAGAAACGAGGCCAGTGAGG + Intronic
1007623880 6:43231458-43231480 GAACAGCCAGGAAGCCAGTGAGG - Intergenic
1007731957 6:43952819-43952841 GAATAGCAAGGAGACCAGTGTGG - Intergenic
1008007089 6:46422250-46422272 GGCTAGAAAGGAGGCCAGAGAGG - Intronic
1008052263 6:46912435-46912457 GAGCTGCAAGCAGGCCAGAGTGG + Intronic
1008351653 6:50499015-50499037 GATCAGCAAGGAGACCAAAGAGG + Intergenic
1008655271 6:53605724-53605746 GAACAGTAAGGAGGCTAGTATGG + Intronic
1008830070 6:55748016-55748038 ACACAGCAAGGAGGCCAGTGTGG - Intergenic
1009195527 6:60679840-60679862 GAACAGAAACAAGGTCAGGGTGG - Intergenic
1009321630 6:62297775-62297797 GAAATGAAAGGAGGCCAAAGAGG - Intergenic
1010082510 6:71880708-71880730 GAACAGAAAGTAGGCCAATGAGG - Intergenic
1010550565 6:77217337-77217359 GAATAGCAAGGTGGCCAGAGTGG + Intergenic
1011026499 6:82875104-82875126 GAACTGAAAGGAGGCAGGTGTGG + Intergenic
1011664809 6:89623553-89623575 ACACAGAAAGCAGCCCAGAGGGG + Intronic
1012114773 6:95282327-95282349 GAACAGAACGAAGGTCAGTGTGG - Intergenic
1012603692 6:101131079-101131101 GATCAGCAGGGAGGCCAGTGTGG + Intergenic
1012792948 6:103723501-103723523 AAACAGCAAGGCAGCCAGAGTGG + Intergenic
1012819440 6:104066686-104066708 TAAAAGAAATGAGGACAGAGGGG - Intergenic
1012930236 6:105309052-105309074 GCAAAGCAAGGAGGCCAGAGCGG + Intronic
1012936876 6:105377649-105377671 GAAGAGTAAGGAGGTGAGAGAGG - Intronic
1012984965 6:105865957-105865979 GGACAGAAAGAGGGCCAGGGAGG - Intergenic
1013422937 6:109982646-109982668 GAACAGCAAGGAGGTCAACGTGG + Intergenic
1013566181 6:111366140-111366162 AAACTGAAAGAAGGCCAGATGGG + Intronic
1013620709 6:111885844-111885866 AAACAGAAAGGAGGCCTGGGTGG + Intergenic
1013815736 6:114095271-114095293 GGACAGGAAGAAGGCCAGAATGG - Intronic
1013953765 6:115817187-115817209 GAACAGAGAGAAGGCCAACGTGG + Intergenic
1013974992 6:116066697-116066719 GAACAGAAAGGTGGCCACTGTGG - Intergenic
1014213256 6:118728947-118728969 GAGCAGCAAGGAGGTCAGTGAGG - Intergenic
1014592780 6:123293692-123293714 AAACAAAAATGAGCCCAGAGGGG - Intronic
1014857527 6:126420222-126420244 GAAAATAAAGAGGGCCAGAGTGG + Intergenic
1015107376 6:129552683-129552705 GAACAGTAAAAAGGCCAGTGTGG - Intergenic
1015185768 6:130413813-130413835 GAACAGAAAGAGGGCCAAAGTGG - Intronic
1015311393 6:131770895-131770917 GACCAGCAAGGAGGCCAGGATGG + Intergenic
1015336326 6:132043494-132043516 GATCAGAAAGAAAGCCAGAAAGG + Intergenic
1015528189 6:134193764-134193786 GAAAAGAAAGGAGAGGAGAGGGG + Intronic
1015549198 6:134394517-134394539 GCAGAGAAAGAAGTCCAGAGAGG - Intergenic
1016154298 6:140784441-140784463 GCACAGAGAAGAGGCCAGAGAGG - Intergenic
1016301713 6:142638905-142638927 GAACAAAAAGGAAGGAAGAGAGG + Intergenic
1016373722 6:143399411-143399433 GAACAGAGGGAAGGCCAGTGTGG + Intergenic
1016404046 6:143711258-143711280 GAACTGGAAGCAGGCCAGAAGGG - Intronic
1016757122 6:147698955-147698977 CAACAGAAAGGAGGCTGGTGTGG + Intronic
1016769375 6:147831503-147831525 TGACAGAAAGGACCCCAGAGAGG - Intergenic
1016808597 6:148237866-148237888 GAACAGCAAGGAGGCCTGGAAGG - Intergenic
1017321048 6:153093676-153093698 GAACAGAAAGGCACCCAGAATGG + Intronic
1017414436 6:154204934-154204956 GGACAGAAAGAAGGCCAGTGTGG - Intronic
1017426732 6:154329935-154329957 GGACAGCACGGAGGCCAGAGTGG - Intronic
1017577585 6:155822305-155822327 GGACAGACAGGAGGCCAGAAAGG - Intergenic
1017809993 6:157977656-157977678 GAACAGAATGGGGGGCAGACGGG - Intergenic
1018653707 6:166012011-166012033 AAACAGCAAGGAGGCCAGAGCGG + Intergenic
1018690506 6:166340492-166340514 GGCCAGTAAGGAGGCCAGAGGGG - Intronic
1018796566 6:167190066-167190088 GAAGAGCAAGGAGGCCGGTGTGG + Intronic
1018819753 6:167365051-167365073 GAAGAGCAAGGAGGCCGGTGTGG - Intronic
1018998839 6:168730081-168730103 GAGAAGAAAGGAGGCCGGGGAGG - Intergenic
1019026505 6:168969563-168969585 AAACAGAAAGAAAGCCAAAGGGG - Intergenic
1019733178 7:2638474-2638496 GGCCTGGAAGGAGGCCAGAGAGG - Intronic
1019851288 7:3560793-3560815 GAACAGGAAAGAGGCCAGAGAGG - Intronic
1019949897 7:4362916-4362938 GAACAGCAAGGAGATCAGTGTGG - Intergenic
1019959193 7:4444245-4444267 GAACAGTAAGGTGGCCAGCATGG + Intergenic
1020477555 7:8616197-8616219 GAACAGCAAGGAGGCCAGTGTGG - Intronic
1020623397 7:10546119-10546141 GAAAAGAAATGAGGCATGAGTGG - Intergenic
1021150696 7:17147520-17147542 GAACAGCAAGGAGGCTCAAGAGG - Intergenic
1021177615 7:17468267-17468289 GTTCAGAAAGAAGGCCAGTGTGG - Intergenic
1021218184 7:17942378-17942400 TAGCAGAAATGAGGTCAGAGGGG - Intergenic
1021396125 7:20150754-20150776 GAAAGGAAGTGAGGCCAGAGTGG + Intronic
1021466055 7:20944681-20944703 GAACAGCCAGGAGGCCAGTGCGG + Intergenic
1021533527 7:21676047-21676069 GAACAGAGAGAAGGCCAGCATGG + Intronic
1021623037 7:22566317-22566339 GAACAGCCAGGTGGCCAGCGTGG - Intronic
1021851611 7:24814197-24814219 AAAGAGAAAGAAGGCCAGTGTGG + Intronic
1021973262 7:25985343-25985365 GAACAGAAAGAAGGCCAGTGTGG - Intergenic
1021975813 7:26010113-26010135 GCACAGCAAGGAGGTCAGTGTGG + Intergenic
1022117362 7:27273887-27273909 AAACTGAAAGAAGGCCAGTGTGG + Intergenic
1022199659 7:28104023-28104045 GAACTGCAGGGAGGCCAGTGGGG - Intronic
1022222339 7:28325630-28325652 GAACAAAGAAAAGGCCAGAGTGG - Intronic
1022315153 7:29238854-29238876 GAACAGCAAGAGAGCCAGAGTGG + Intronic
1022383985 7:29884808-29884830 GAATAGAAGGGAGAACAGAGAGG - Intronic
1022751419 7:33230611-33230633 GAACACAAAGGTGTACAGAGTGG - Intronic
1022967092 7:35483827-35483849 GAGCAGAAAGGTGGCCATTGTGG + Intergenic
1023149239 7:37184400-37184422 GAACACAAAGGTAGCCAGAGAGG - Intronic
1023500374 7:40843661-40843683 GAACAGCAAGGAGGCCAGTGTGG + Intronic
1023737530 7:43248153-43248175 AAAGAGAGAGGAGCCCAGAGAGG + Intronic
1023832356 7:44046915-44046937 GAAGAGAAAGACGGCCAGAGTGG - Intronic
1023867880 7:44247398-44247420 GAACAGATATGGGCCCAGAGGGG - Intronic
1023986346 7:45099375-45099397 GAACAGAGAGTAGGACAGTGGGG - Intergenic
1024309297 7:47954469-47954491 AGACAGAAAGGAGGCAAGAGGGG - Intronic
1024324636 7:48099494-48099516 GAACAGAGGGGAGGCAAGTGCGG + Intronic
1024615875 7:51111391-51111413 GAACAGATGGGAGGCCAGTATGG + Intronic
1024658704 7:51473520-51473542 GAAGGGAAAGGAGGCCAGTCAGG + Intergenic
1025013568 7:55419690-55419712 GAATAAAAGAGAGGCCAGAGTGG - Intronic
1025026859 7:55523467-55523489 TAACAGAGTCGAGGCCAGAGGGG + Intronic
1025236823 7:57240045-57240067 GAAAAGAAAGGAGGGAGGAGGGG + Intergenic
1025252882 7:57363697-57363719 GAACAGAGAAGGGGCCAGTGTGG - Intergenic
1026582714 7:71631612-71631634 GAAGAGCAAGGAGGCCACTGTGG + Intronic
1026607434 7:71827857-71827879 GAACATAGAGGAGGCAAGGGTGG + Intronic
1027374713 7:77537820-77537842 GAGAAGAAAGGAGGCCACGGGGG - Intronic
1027530373 7:79323537-79323559 GGAAAGAAAGGAGACAAGAGTGG + Intronic
1027862967 7:83608258-83608280 GAAAAGAAAGGGAGCAAGAGTGG + Intronic
1027875463 7:83762745-83762767 GAATAGAAAGGAGACCTGTGGGG + Intergenic
1027962944 7:84970054-84970076 GACCAGAAAGAAGGCCAAATGGG - Intergenic
1028259992 7:88651974-88651996 GAACAGAATGGAGAACACAGAGG + Intergenic
1028480723 7:91301665-91301687 GAACAACAAGGAGGCCAATGTGG - Intergenic
1028525679 7:91783222-91783244 GAATAGAAAGGAGGGCAGTGTGG - Intronic
1028615842 7:92765985-92766007 GAACAGAAAGAAGGCCACTGTGG + Intronic
1028667365 7:93362402-93362424 GAACAGCAAGGAGGGCAGTGTGG + Intergenic
1028745937 7:94326907-94326929 GAACAGAAAGGAGGCCAGTATGG + Intergenic
1029018348 7:97338107-97338129 GAACAACAAAGAGGCCTGAGTGG - Intergenic
1029115424 7:98234029-98234051 GAAGAGACAGGAGTTCAGAGAGG - Intronic
1029210719 7:98906033-98906055 GGACAGAGAGGAGACCAGAAAGG - Intronic
1029256608 7:99273732-99273754 GAAAAGAAAGGAAGAGAGAGAGG + Intergenic
1029434623 7:100555746-100555768 GAAGAGAAAGGAAGCCAGTGGGG - Intronic
1029796095 7:102896067-102896089 GAATAGAAAAGAAGCCAGAGTGG + Intronic
1030118234 7:106080282-106080304 GAACAGAAAAGGGGCCAGTGTGG - Intergenic
1030138222 7:106279911-106279933 GAACAGAAGGCAGGCCAATGTGG + Intronic
1030235334 7:107253762-107253784 GAACAGCCAGGAGGCCCGAGTGG - Intronic
1030318498 7:108140676-108140698 GAAAAGAAAGGGGGCCAATGTGG + Intergenic
1030642725 7:112024494-112024516 TAAGAGAAAGGAGGCAAGAAAGG - Intronic
1030678689 7:112411267-112411289 GAACAGATAGAAGCCCAGAAAGG + Intergenic
1031106801 7:117553953-117553975 GAACAGTAAGGAGGTCACTGAGG + Intronic
1031206498 7:118764787-118764809 GAACACCAAGGAGGGCACAGAGG + Intergenic
1031454713 7:121964878-121964900 GGACAGAATGGAAGCCAGTGTGG + Intronic
1031667398 7:124501735-124501757 GAACAGCAAGGATGCCAGAATGG + Intergenic
1031990427 7:128194579-128194601 GAACAGCAAGGAGGCCAATGTGG + Intergenic
1032282503 7:130515782-130515804 GCACAGTAAGCAGGCCAGTGAGG + Intronic
1032351326 7:131166538-131166560 GAACAGCAAGAAGGCCAGGGTGG - Intronic
1032605797 7:133350496-133350518 GAACAGAAAAGAGACCCTAGGGG - Intronic
1032653420 7:133903112-133903134 GAACAGCAAGGAGGCCAGCATGG + Intronic
1032848205 7:135769855-135769877 GACCTGAGAGGAGGCCATAGTGG + Intergenic
1033166718 7:139045290-139045312 AAACTGAAAGGAAGCCAGAGTGG + Exonic
1033302193 7:140196472-140196494 GAACAGCAAAGAGGCCAGAGTGG + Intergenic
1033922093 7:146406634-146406656 GAACAGCCAGGAGGACAAAGGGG + Intronic
1034288474 7:149907458-149907480 GAAGAGAAGAGAGGCAAGAGAGG - Intergenic
1034721955 7:153301573-153301595 GAAAAGATAAGAGGTCAGAGAGG - Intergenic
1034776422 7:153831454-153831476 GGACAGAGAGGAGGTCAGTGAGG + Intergenic
1035339390 7:158150840-158150862 GAACAGAAAGGAGGCCAGAGTGG - Intronic
1035493925 7:159305343-159305365 GACTAGAAAGGAGCCCACAGAGG + Intergenic
1035578579 8:725220-725242 GAGCAGACAGGAAGCCGGAGAGG - Intronic
1035728901 8:1841381-1841403 AAGCAGAAAGGGGGTCAGAGAGG + Intronic
1035848520 8:2890786-2890808 GAAGAGCAAGGAGGCAGGAGTGG + Intergenic
1036007083 8:4677810-4677832 GAACAAAAAGGAGGCAAGGATGG + Intronic
1036697556 8:10987807-10987829 GACCAGAAAGGAGGCCATTTGGG - Intronic
1036981898 8:13478762-13478784 GAAAACAAAGAAAGCCAGAGAGG - Intronic
1037510746 8:19579291-19579313 GAACTGAAAAGATGCCAGTGAGG - Intronic
1037523980 8:19706920-19706942 GATCAGATACGAGGCCAAAGAGG - Intronic
1037929428 8:22869044-22869066 GAACTGCAAGGAGGCCAGTGTGG - Intronic
1037950491 8:23016164-23016186 GAAGAGACAGGAGGCCTCAGAGG - Intronic
1038149781 8:24932192-24932214 GAGCAGAAAGGAAGCATGAGTGG - Intergenic
1038258539 8:25972621-25972643 CAACAAAAGGGAGTCCAGAGAGG + Intronic
1038272211 8:26084468-26084490 AAACAGAAAGGAGGGCAGATTGG + Intergenic
1038541268 8:28392014-28392036 GAAGAGTAAGGGGGCCAGTGTGG - Intronic
1038660100 8:29489904-29489926 CAATAGCAAGGGGGCCAGAGTGG - Intergenic
1038755997 8:30341079-30341101 GAAAAGAAAAGAGGCAAAAGTGG - Intergenic
1038806223 8:30794579-30794601 GAAAAGAAAGGAGGGAAGTGGGG - Intronic
1038895524 8:31777746-31777768 AAACAGGAAGGAAGACAGAGCGG + Intronic
1038897629 8:31803841-31803863 GAAAAGAAAGGAGGCCAAAGTGG - Intronic
1039044078 8:33434428-33434450 GAACAGAAAGGAAGTCCCAGAGG + Intronic
1039173259 8:34773411-34773433 GAACAGCCAGGAGGCGAGTGTGG - Intergenic
1039561016 8:38512603-38512625 GACAAGAAAGGAGTCCAGTGTGG + Exonic
1039821167 8:41136856-41136878 AAAGAGAAAGAAGACCAGAGTGG - Intergenic
1040643306 8:49367310-49367332 GAATAGAAATAAGGCCAGTGTGG - Intergenic
1041121545 8:54591326-54591348 GGACGGAAAGAAGGCCAGTGTGG - Intergenic
1041191706 8:55361756-55361778 GAACAGAGAGGAGCGCAGCGTGG - Intronic
1041932225 8:63299389-63299411 AAACAGATAGAAAGCCAGAGAGG + Intergenic
1042095565 8:65212431-65212453 GAACAGAAATCAGGCAACAGGGG - Intergenic
1042379805 8:68100613-68100635 AAGCAGAAAGAAGGCCAGGGTGG + Intronic
1042517448 8:69674355-69674377 AGACAGAAAGGAAGGCAGAGAGG + Intronic
1042621122 8:70705568-70705590 AAACAGCAAGGAGGCCATACTGG + Intronic
1042678350 8:71348737-71348759 GATCAGCAAGGAGTCCAGTGTGG - Intronic
1042828295 8:73000314-73000336 GAATAGCAAGAAGGCCAGAATGG + Intergenic
1042893072 8:73634682-73634704 GAGCAGAAAGGAGACTAGTGTGG - Intronic
1042944896 8:74144967-74144989 GAAGAGAAAGGAACCCAGGGAGG - Intergenic
1043820942 8:84863356-84863378 GAACAATAAGGAAGCCAGTGTGG + Intronic
1043883859 8:85575632-85575654 GAAGACCAAGGAGGCCAGTGGGG + Intergenic
1044391527 8:91657878-91657900 GTAGAGAAAGAAGGCCAGTGTGG - Intergenic
1044892224 8:96849614-96849636 TGACAGAAAGGAAGTCAGAGTGG + Intronic
1044966105 8:97575468-97575490 GAACAGAAAGAAGGCCAGTGGGG + Intergenic
1045004954 8:97909621-97909643 GTACAGCAGGGAGGCCAGTGTGG + Intronic
1045013377 8:97977762-97977784 GATCAGCAAAGAGGCCAGGGTGG - Intronic
1045121633 8:99044023-99044045 GAAAAGAAAAGAAGCTAGAGAGG - Intronic
1045128665 8:99123347-99123369 AAACAGCAAGGAAGCCAGTGGGG + Intronic
1045175679 8:99722132-99722154 GGAGAAAAAGGAGGCCAGAGTGG - Intronic
1045426234 8:102068379-102068401 AAACAGGAGAGAGGCCAGAGTGG - Intronic
1045574992 8:103410783-103410805 GTACAGAAAGGAGCCAAGACAGG + Intronic
1045685394 8:104706179-104706201 GAATAGCAAGGAGGCCAGCATGG - Intronic
1045831743 8:106470034-106470056 GAGCAGCAAAGAAGCCAGAGTGG + Intronic
1046092027 8:109514104-109514126 GAACAGCAAGGAGCTCAGTGGGG - Intronic
1046112114 8:109737865-109737887 AAATAGCAAGGAGGCCAGAGTGG + Intergenic
1046196343 8:110867485-110867507 ACATAGAAAGGAGGCCAGTGTGG - Intergenic
1046612090 8:116437281-116437303 TAACAACAAGGAGGCAAGAGTGG + Intergenic
1046629378 8:116608175-116608197 GAACCGAAAGGAGACCAATGTGG - Intergenic
1046636950 8:116680376-116680398 GAATAGAAAGGCGGGAAGAGTGG + Intronic
1046937946 8:119903760-119903782 GAGCAGAAAGGAGCCCAGGACGG - Intronic
1046970973 8:120223097-120223119 GACCTGAAAGGAGGCCAGTGTGG + Intronic
1047051515 8:121118079-121118101 TAACAGAAAGGAGGAAAGAAAGG - Intergenic
1047226645 8:122960679-122960701 GAACTGAAAGGTGGCCATGGTGG + Intronic
1047230486 8:122994163-122994185 GAACAGAAGGTAGCCCACAGAGG - Intergenic
1047694322 8:127387959-127387981 GAACAGAAAAAATGCCAGAGAGG - Intergenic
1047777401 8:128084277-128084299 CCACAGCAAGGAGGCCAGTGTGG - Intergenic
1048339717 8:133529289-133529311 AGACAGAAAGCGGGCCAGAGAGG + Intronic
1048407753 8:134140368-134140390 AAACAGCAAGGAAGCCAGGGTGG - Intergenic
1048451096 8:134534666-134534688 GAAGAGAGAGGAGGAGAGAGAGG + Intronic
1048538010 8:135315740-135315762 GAAGAGAAATGAGGCCAGGTAGG + Intergenic
1048757903 8:137758423-137758445 GAACAGAAATGAGACCAAAGAGG + Intergenic
1048765070 8:137834812-137834834 GAATAGAAATTAAGCCAGAGTGG + Intergenic
1048832667 8:138491894-138491916 GATCAGCCAGGAGGCCAGGGTGG + Intronic
1048941872 8:139406848-139406870 GAATATAAAGGAGGCCAGGCAGG + Intergenic
1049392728 8:142380444-142380466 GAACTGCATGGAGGGCAGAGGGG + Intronic
1049741906 8:144244956-144244978 GACCAGACTGGAGGACAGAGTGG + Intronic
1050471293 9:5993705-5993727 GGACTGACAGGAGGACAGAGAGG - Intronic
1050697225 9:8292826-8292848 GCCCAGAAATGATGCCAGAGAGG + Intergenic
1050741585 9:8826475-8826497 GAACGGAAGGGAGGCCAGCAGGG - Intronic
1050760605 9:9065430-9065452 GAACACCAAGGAGGTCAGTGTGG + Intronic
1051260095 9:15255415-15255437 AAAAAGAAAGGAGACCAGAGAGG + Intronic
1051355408 9:16235596-16235618 AGACAGAAAGGGGGCCAGTGTGG - Intronic
1051679252 9:19590617-19590639 GAACAGAAGTAAGGACAGAGAGG - Intronic
1051908438 9:22124420-22124442 GAACTGAACTGAGGCCAGACAGG + Intergenic
1052023106 9:23546869-23546891 GAACAGCAAGGAGGCCAGGGTGG + Intergenic
1052335466 9:27315068-27315090 GGCCAGCCAGGAGGCCAGAGGGG + Intergenic
1052584160 9:30403176-30403198 GAAAAGAAAGGAAGGAAGAGAGG - Intergenic
1052745634 9:32437945-32437967 GAACAGAAAAAATGCAAGAGAGG + Intronic
1053021766 9:34700109-34700131 GAATAGCAAGGAGGCCAAAAGGG + Intergenic
1053276372 9:36786645-36786667 GAACAGCAAGGAGGCCAGTGTGG + Intergenic
1053288493 9:36864856-36864878 TCACAGAGACGAGGCCAGAGAGG + Intronic
1054728483 9:68676723-68676745 GATCAGAAGGGGGGCAAGAGAGG - Intergenic
1054738323 9:68779424-68779446 TTACAGAAAAAAGGCCAGAGAGG - Intronic
1054759700 9:68993265-68993287 GAACACCAAGGAGGCCAGTGTGG - Intronic
1054812863 9:69448453-69448475 GAAATTAAAGGAGGCCAAAGAGG + Intronic
1054974074 9:71121736-71121758 GAACAAAAATGAAGCCAGAACGG + Intronic
1055434254 9:76276533-76276555 GAACATCAAGAAGGCCAGTGGGG - Intronic
1055673267 9:78628815-78628837 GAAAAGAAAGGAAGCCAATGTGG - Intergenic
1055837621 9:80462856-80462878 GAACAGAATAGTGGTCAGAGGGG + Intergenic
1056208510 9:84342830-84342852 GAACAGAAAGGCAGCCAGTCAGG + Intergenic
1056733475 9:89185065-89185087 TGACAGAGAGGAGGCCAGAGAGG + Intergenic
1056944168 9:90979428-90979450 CAGCACAAAGGAGGACAGAGAGG - Intergenic
1056990789 9:91408114-91408136 GAATAGAAAAGAGGTCAGTGTGG + Intergenic
1057053248 9:91941764-91941786 GAAGAGAAAGGAGGGCAGGGCGG - Intronic
1057075135 9:92134637-92134659 GACCAGAAAGGTGGGCAGGGAGG + Intergenic
1057423468 9:94929922-94929944 GGACAGAAAGAAGGGCAGTGTGG + Intronic
1057553636 9:96070463-96070485 GCAGAGACAGGAGGGCAGAGAGG + Intergenic
1057802514 9:98198749-98198771 GAGCAGAAAGGAGGGCACAGGGG + Intergenic
1057862898 9:98656096-98656118 GAACAGAGAGGAGGTCAAAGTGG + Intronic
1058007653 9:99935884-99935906 GAACAGTAAGGAGGTCAGTGTGG + Intronic
1058028342 9:100167365-100167387 GAACAGCACTGAGGTCAGAGTGG - Intronic
1058059750 9:100482486-100482508 GAAGAGAATGCAGGCCAGAGTGG - Intronic
1058077611 9:100667165-100667187 GCACAGGAGGGAGGCCAAAGTGG + Intergenic
1058479778 9:105380041-105380063 GAAAAGAAAGGAAGGGAGAGAGG + Intronic
1058702096 9:107609663-107609685 GATGAGAAAGGAAGCCAGTGTGG - Intergenic
1059108735 9:111534661-111534683 GAACAGGAAGGAGGGCAGATTGG + Intronic
1059154736 9:111979697-111979719 GAATGGCAAGGAGGCCAGAGTGG - Intergenic
1059305853 9:113352569-113352591 GAACAGAAAGAAGGCCAGCATGG + Intronic
1059424016 9:114209644-114209666 GAGAAGAAAGGGGGTCAGAGCGG - Intronic
1059678147 9:116560192-116560214 GAATTGCAAGGAGGCAAGAGAGG - Intronic
1059906374 9:118991299-118991321 GAAAAGAATGTAGGTCAGAGGGG + Intergenic
1059973129 9:119687841-119687863 GAACATCAAGGAGGTCAGTGTGG - Intergenic
1060072067 9:120558619-120558641 GACTGGAAAGGAGGCCAGTGAGG - Intronic
1060089008 9:120726717-120726739 AAACAGAAAGGAAACCAGAATGG + Intergenic
1060183883 9:121552193-121552215 GCACAGGGAGGAGGCCAGACAGG - Intergenic
1060275533 9:122179548-122179570 GAAGAGAAAGGGGCCCAGAGAGG - Intronic
1060409437 9:123390360-123390382 GAACAGATGGGAGCCCAGAGGGG - Intronic
1060418237 9:123448211-123448233 GAACAGAAAGGGAGAGAGAGTGG + Intronic
1060474086 9:123974186-123974208 GATAGGAAATGAGGCCAGAGAGG + Intergenic
1060496687 9:124124696-124124718 CAGGAGAAAGGAGGCCAGAGGGG - Intergenic
1060612852 9:124984208-124984230 GAACAGCAAGGGGGTCAGTGTGG + Intronic
1060624639 9:125100403-125100425 GAAGAGTAAGCAGGCCAGATAGG + Intronic
1060698368 9:125729542-125729564 GAAGAGAAAGGGGGTAAGAGAGG - Intergenic
1061547438 9:131312969-131312991 GATCAGAAACCAGGCCTGAGTGG + Intergenic
1061635563 9:131906442-131906464 GAACAGAAAGGAGGTCGGACAGG + Intronic
1061680789 9:132241631-132241653 GAACAGCACCGAGGCCAGTGGGG + Intronic
1061761862 9:132857038-132857060 GAGGAAAAAGGAGACCAGAGAGG + Intronic
1061901739 9:133676329-133676351 GAGCAGAATGGAGGGCACAGGGG + Intronic
1062132767 9:134908894-134908916 GAACCAAAGGAAGGCCAGAGGGG - Intronic
1062327373 9:136018624-136018646 CAACAGAACAGAGGCCAGAAAGG + Intronic
1062385315 9:136307031-136307053 GGGGAGAAAGGAGGCCAGGGAGG + Intergenic
1203660345 Un_KI270753v1:35920-35942 GAGCATCAAGGAGGCCAGTGTGG - Intergenic
1203671115 Un_KI270755v1:12877-12899 GAGCATCAAGGAGGCCAGTGTGG - Intergenic
1185623898 X:1469170-1469192 GAAAAGAAAAGAGGGGAGAGGGG - Intronic
1185648002 X:1628736-1628758 GAAGAGAGAGGAGACAAGAGAGG - Intronic
1185757877 X:2666446-2666468 TAACAGGAAGGAGACCAGTGGGG - Intergenic
1186652673 X:11577886-11577908 GACCAGAAAGGAGGCAATATAGG - Intronic
1187038453 X:15567055-15567077 GAACAGCAAGGAGGCCAGTGTGG - Intronic
1187106301 X:16245934-16245956 GGACAGAGAGAAGGCCAGTGTGG + Intergenic
1187513788 X:19946720-19946742 GAATAGAAAGGGGGACAGTGGGG - Intronic
1187577018 X:20567883-20567905 GAACAGAAAGAAGGCTAGTGTGG + Intergenic
1187647533 X:21364630-21364652 GAACAGAAAGGAAATCAGTGTGG - Intergenic
1187671628 X:21672252-21672274 GAACACACAGGAGGGCAAAGAGG - Intergenic
1187724937 X:22192572-22192594 AAACACGAAGGAGGCCAGTGTGG - Intronic
1187737433 X:22319318-22319340 AAACAGCAAGAAGGCCAGTGTGG - Intergenic
1187811644 X:23185276-23185298 AACCAGCAAGGAGGCCAGTGTGG + Intergenic
1187968790 X:24639259-24639281 GGACAGAATGGAATCCAGAGAGG + Intronic
1188137973 X:26512919-26512941 GCAGAGGAAGGGGGCCAGAGTGG - Intergenic
1188412063 X:29885091-29885113 GAACAGCAAGAAGGCCAGTGGGG - Intronic
1188496175 X:30785243-30785265 GAACAGAATGGGGGCCAGTGAGG - Intergenic
1189129296 X:38481600-38481622 GACCTGAAAGAAGACCAGAGTGG - Intronic
1189200396 X:39190641-39190663 GAACAGCAAAGAGGCCAATGTGG - Intergenic
1189518048 X:41735672-41735694 GAACAGCAAGGAGGCCGGTGTGG - Intronic
1189550455 X:42087272-42087294 GAACAGAGAGAAGGTCTGAGCGG - Intergenic
1189560969 X:42191241-42191263 GAATAGCAAGGAGGCCAGTGTGG + Intergenic
1189619975 X:42825603-42825625 GATCAGAAAGAAAGCCAGTGTGG - Intergenic
1189698255 X:43688203-43688225 AAATAGCAAGGAGGCCAAAGTGG - Intronic
1189863180 X:45294365-45294387 GAATAGGAAGAAGGCCAGTGAGG - Intergenic
1190119217 X:47646871-47646893 GAACATCAAGGCGGCCAGTGTGG - Intronic
1190221486 X:48515077-48515099 GAACAGCAAGAAGGCCAGCAGGG + Intronic
1190232134 X:48590440-48590462 GAACAGCAAGAAAGCCAGCGGGG + Intronic
1190257556 X:48774907-48774929 GAACAGCAAGGACGCCAGTTGGG + Intergenic
1190411764 X:50143583-50143605 GGACAGTGAGGAGGCCAGTGTGG - Intergenic
1190759704 X:53429260-53429282 GAACAGCAAGGAGCTCAGTGTGG + Intronic
1190760695 X:53435558-53435580 GAACACAAAGGAGGCCACTGTGG - Intergenic
1190813756 X:53909710-53909732 GAACAGCAAGGAGGCCAATATGG + Intergenic
1190869412 X:54412753-54412775 AAACAGAAACAAGGCCAGTGTGG + Intergenic
1191031627 X:55980074-55980096 GGCCAGAAAGGAGGCAAGTGAGG + Intergenic
1191976985 X:66883871-66883893 GAACAGCAAGTAGGCCAATGTGG - Intergenic
1192174141 X:68875372-68875394 GAACAGCAAGGAGGCCTGCCTGG + Intergenic
1192176391 X:68888582-68888604 GACCAGAAAAGATGCCAGTGTGG + Intergenic
1192220357 X:69193687-69193709 GGACAGCAAGGAGGCCAGATTGG - Intergenic
1192226613 X:69232644-69232666 GGACTGAAAGGAGGCCAGGGAGG - Intergenic
1192257281 X:69472612-69472634 GAATACAAAGGAGGCCAGTGTGG - Intergenic
1192259732 X:69498062-69498084 GAACTCAAAGGTGGCCAGTGTGG + Intergenic
1192421807 X:71039142-71039164 GAACAGAAGGAAGCCCAAAGGGG + Intergenic
1192543659 X:71995503-71995525 GATCAGTGAGGAGGCCAGTGTGG - Intergenic
1192545038 X:72006155-72006177 AAGCAGAAAGGAGGCCAGTAAGG - Intergenic
1192579332 X:72267901-72267923 AAACATCAAGGAGGCCAGTGTGG + Intronic
1193478270 X:81994644-81994666 GAACATAAAGATGGCCACAGTGG - Intergenic
1194580169 X:95662051-95662073 GTACCCTAAGGAGGCCAGAGAGG - Intergenic
1194812513 X:98403281-98403303 GAACAGCTAGGAGGCCTGTGTGG - Intergenic
1194812561 X:98403910-98403932 GAACAGCAAGGAGGCCAGTATGG - Intergenic
1194934552 X:99932462-99932484 GAACAGAAACAAGGGTAGAGGGG + Intergenic
1194959976 X:100223926-100223948 GAAAGGAAAGGAGGCCCAAGGGG - Intergenic
1195168730 X:102245845-102245867 CAACAAAAAGGAGGCTAGTGTGG + Intergenic
1195190127 X:102441242-102441264 CAACAAAAAGGAGGCTAGTGTGG - Intronic
1195384684 X:104303018-104303040 GGACTGAAGGGAGGCAAGAGTGG - Intergenic
1195731530 X:107973218-107973240 GAACTGAAAGTAGGCCAGTGTGG + Intergenic
1195737906 X:108032733-108032755 GAATAAAAAGGAGGTCAGAGTGG + Intergenic
1196003781 X:110813844-110813866 GAACAGCAAGGAGACCAGTGTGG + Intergenic
1196008864 X:110865204-110865226 GAACAGAAAGGAGACCACTGTGG + Intergenic
1196130483 X:112150072-112150094 GAACAGTGAGGAGGCCAGTGTGG + Intergenic
1196387120 X:115168983-115169005 CAACTGAAAGGAGACCAGCGTGG - Intronic
1196495060 X:116314991-116315013 AAGCAGAAAGGAGCCCAGATCGG + Intergenic
1196666639 X:118324196-118324218 GAATAGAAAGGAGGCCAGTGAGG - Intergenic
1196830615 X:119772806-119772828 GATCAGCAAGGAGGACTGAGTGG - Intergenic
1196847198 X:119905629-119905651 GAACGGCAAGGAGGCAAGTGTGG - Intronic
1197154580 X:123256562-123256584 GAACTGAAAGAAGTCCAGTGTGG + Intronic
1197194278 X:123682432-123682454 GAACAGTAAGGAGGTCAGTGTGG - Intronic
1197631792 X:128869381-128869403 GAACAGCAAGGGGGCCAATGTGG + Intergenic
1197704465 X:129623769-129623791 GAATAACAAGGAGGCCAGTGTGG + Intergenic
1197788183 X:130222010-130222032 GAAGAGCAAGGAGACCAGTGTGG - Intronic
1197805906 X:130398383-130398405 AAACAGAAAGGAGGCCAGTGTGG - Intergenic
1197865504 X:131012474-131012496 GAATAGTAAGGAGGCCAGTGTGG + Intergenic
1198163958 X:134034970-134034992 GAACAGCAAGGAGGTCAGCATGG - Intergenic
1198229835 X:134678320-134678342 AAAAAGCAAGGAGGCCAGAGTGG - Intronic
1198393094 X:136196165-136196187 GGACAGTGAGGAGGCCAGTGAGG + Intronic
1198464314 X:136890846-136890868 GAACAGTAAGGAGGTCAGTATGG + Intergenic
1198552193 X:137756847-137756869 GAGTTAAAAGGAGGCCAGAGTGG + Intergenic
1198728486 X:139701945-139701967 GAACACCAAGAAGGCCAGCGCGG - Intronic
1198951586 X:142078233-142078255 GGACAGTAAGGAGTCCAGTGTGG - Intergenic
1199213372 X:145240083-145240105 GAACATCAGGGAGGCCAGTGTGG + Intergenic
1199438156 X:147837448-147837470 GAACAGTAAGAAGGCCAAGGTGG + Intergenic
1199606995 X:149585754-149585776 GAACAAGACGGAGGACAGAGGGG - Intronic
1199632128 X:149783614-149783636 GAACAAGACGGAGGACAGAGGGG + Intronic
1199783059 X:151081224-151081246 GAACAGCAAAGAGGCCTGTGTGG + Intergenic
1199823994 X:151479267-151479289 GAACAGCAAGGATACCAGTGTGG + Intergenic
1199844719 X:151682578-151682600 GTCCAGAAAGGGGGCCAGTGTGG - Intergenic
1199941307 X:152630530-152630552 GAATAATAAGGAGGCCAGTGAGG - Intergenic
1200084373 X:153596192-153596214 GGAGAGAAAGCAGGCAAGAGAGG + Intronic
1200704028 Y:6426250-6426272 GACCAGAGAGGTGGCCAGAAAGG - Intergenic
1201030083 Y:9738458-9738480 GACCAGAGAGGTGGCCAGAAAGG + Intergenic
1202175852 Y:22098258-22098280 GAGCAGAAATGAGGTCAGATGGG - Intergenic
1202215509 Y:22488125-22488147 GAGCAGAAATGAGGTCAGATGGG + Intergenic