ID: 1035339391

View in Genome Browser
Species Human (GRCh38)
Location 7:158150849-158150871
Sequence GGGTTGGAAGAACAGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 799
Summary {0: 1, 1: 1, 2: 6, 3: 79, 4: 712}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035339391_1035339398 4 Left 1035339391 7:158150849-158150871 CCTCCTTTCTGTTCTTCCAACCC 0: 1
1: 1
2: 6
3: 79
4: 712
Right 1035339398 7:158150876-158150898 TGCTGGTGGAATTATCCTACTGG 0: 1
1: 0
2: 0
3: 7
4: 120
1035339391_1035339401 19 Left 1035339391 7:158150849-158150871 CCTCCTTTCTGTTCTTCCAACCC 0: 1
1: 1
2: 6
3: 79
4: 712
Right 1035339401 7:158150891-158150913 CCTACTGGTTTGCAGCAAATGGG 0: 1
1: 0
2: 0
3: 9
4: 74
1035339391_1035339399 18 Left 1035339391 7:158150849-158150871 CCTCCTTTCTGTTCTTCCAACCC 0: 1
1: 1
2: 6
3: 79
4: 712
Right 1035339399 7:158150890-158150912 TCCTACTGGTTTGCAGCAAATGG No data
1035339391_1035339394 -10 Left 1035339391 7:158150849-158150871 CCTCCTTTCTGTTCTTCCAACCC 0: 1
1: 1
2: 6
3: 79
4: 712
Right 1035339394 7:158150862-158150884 CTTCCAACCCAACGTGCTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035339391 Original CRISPR GGGTTGGAAGAACAGAAAGG AGG (reversed) Intronic
901246658 1:7737033-7737055 AGACTGGAAGAACAGCAAGGGGG - Intronic
901419728 1:9142911-9142933 GGGATGGAAGGAAGGAAAGGAGG - Intergenic
901419740 1:9142947-9142969 GGGATGGAAGGAAGGAAAGGAGG - Intergenic
901419746 1:9142968-9142990 AGGAAGGAAGAAAAGAAAGGAGG - Intergenic
901685640 1:10941994-10942016 GGGTTGGAAGGGCTGAAGGGAGG + Intergenic
902062763 1:13658601-13658623 GGTTTTGTAGAATAGAAAGGGGG + Intergenic
902571493 1:17349879-17349901 AAGTTTGAAGAACAGGAAGGAGG - Intronic
903181382 1:21606644-21606666 GGGAGGGAAGAAAAGAAAGAAGG - Intronic
903274056 1:22209593-22209615 GAGTTGGAGGAAGAGCAAGGAGG + Intergenic
903562124 1:24236162-24236184 GAGTGGGAAGAAAAGAAAAGAGG + Intergenic
903606108 1:24576263-24576285 GGGTGGGAAGAAAAGACAGGCGG + Intronic
903874359 1:26462999-26463021 GTCTTGGAAGAACAAAAAAGAGG + Intronic
903895071 1:26597038-26597060 GGTTTTGTGGAACAGAAAGGGGG + Intergenic
904448336 1:30594175-30594197 GGGAAGGAAGAAAAGAAAGAAGG + Intergenic
904504067 1:30936312-30936334 GGGATGAAAGAACAGAAGGGAGG + Intronic
904804774 1:33123042-33123064 GTGTTTGAAGAACAGAGGGGAGG - Intergenic
905111031 1:35594744-35594766 GGCCTGGAAGGACTGAAAGGTGG + Exonic
905684392 1:39898479-39898501 GGGATGGCAGAATAGAGAGGTGG - Intronic
905686521 1:39912929-39912951 GGTTTTGTAGAATAGAAAGGGGG - Intergenic
906437115 1:45805375-45805397 GAGGTGGAAGAACAAAAGGGGGG - Intronic
906767847 1:48451842-48451864 GGGTTGGAGGAACACCAAGAAGG - Intronic
906798270 1:48714562-48714584 AGTTAGGAAGAACAGAAACGAGG - Intronic
906988077 1:50708210-50708232 GGGTAGGGAGAGCAGACAGGAGG + Intronic
907902004 1:58749529-58749551 GGGTGACAAAAACAGAAAGGGGG - Intergenic
908085103 1:60623510-60623532 CCTTTGAAAGAACAGAAAGGTGG - Intergenic
908511029 1:64850181-64850203 GCGGTGGCAGAACAGAAAGTGGG + Intronic
909356010 1:74711097-74711119 GGGGTCAAAGAACAGAAAGAGGG + Intronic
910243138 1:85109920-85109942 GGGAAGGAAGAAAAAAAAGGAGG + Intronic
910573959 1:88737489-88737511 GGGTTGGAAGAAGAATAATGGGG + Intronic
910596115 1:88982786-88982808 GGGTTGGCAGACAAGAAAGAGGG - Exonic
911225903 1:95305408-95305430 GGGTTGCAAGAACAAAGAAGGGG - Intergenic
912302885 1:108535930-108535952 GGTTTTGTAGAATAGAAAGGGGG - Intergenic
912504458 1:110146626-110146648 GGGTAGGAAGAGCTGAAAGAAGG + Intergenic
912619829 1:111144054-111144076 GGGGTGGGAATACAGAAAGGAGG - Intronic
912975993 1:114330783-114330805 GGGCAGGAAGAACCAAAAGGAGG - Intergenic
913701930 1:121382633-121382655 GGCTTGGCAGAAAAGGAAGGTGG - Intronic
914042487 1:144063102-144063124 GGCTTGGCAGAAAAGGAAGGTGG - Intergenic
914135600 1:144897386-144897408 GGCTTGGCAGAAAAGGAAGGTGG + Intronic
914203263 1:145505341-145505363 GGGAAGGAAGCACAGAAAGGGGG - Intergenic
914237192 1:145823264-145823286 GGGAAGGAAGCACAGAAAGGGGG - Intronic
914482385 1:148078495-148078517 GGGAAGGAAGCACAGAAAGGGGG - Intergenic
914508310 1:148308349-148308371 AGGATGGAGGTACAGAAAGGAGG - Intergenic
914825375 1:151135367-151135389 TGAGTGGAAGAACAGAAAGCGGG + Intronic
914912586 1:151799741-151799763 GGCTTGGAGGAACAGGGAGGAGG - Intergenic
916225963 1:162489878-162489900 GTGTTTGAAGAACAGGAAGCTGG + Intergenic
917039945 1:170793933-170793955 GTGGTGGTGGAACAGAAAGGAGG - Intergenic
917475471 1:175365689-175365711 GGGTTGGAAGTAAAGAGGGGAGG - Intronic
917695728 1:177521238-177521260 GTGTTGGAGGAGCAGCAAGGAGG - Intergenic
917825131 1:178811990-178812012 TGGTTGGAGGGGCAGAAAGGGGG + Intronic
917922146 1:179759573-179759595 CTGTTTGAAGAACAGAAAGAGGG + Intronic
918254972 1:182741008-182741030 GGTTTTGTAGAATAGAAAGGGGG - Intergenic
918354866 1:183698117-183698139 GAGTTGGAAAAACATAAACGTGG - Intronic
918370509 1:183856744-183856766 TGGTTGGTAGAAGAGAAAAGAGG + Intronic
918708293 1:187696125-187696147 GGGTTAGCAGATCTGAAAGGGGG - Intergenic
919833478 1:201557935-201557957 GGCTTGGAGGGGCAGAAAGGAGG + Intergenic
919957520 1:202433774-202433796 GGGGTAGAAGAACAGTGAGGTGG - Intronic
920193797 1:204212880-204212902 GTGTTTGAAGAACAACAAGGAGG - Intronic
920278514 1:204826352-204826374 GGGTGGGAAGAAGAGGAAAGAGG - Intergenic
920489353 1:206401353-206401375 GGCTTGGCAGAAAAGGAAGGTGG - Intronic
920716753 1:208347310-208347332 GGGTTAGAATAAGAGAAAGTGGG - Intergenic
920912076 1:210228380-210228402 CTGTTAGAGGAACAGAAAGGAGG + Intergenic
921236482 1:213137050-213137072 GGGTGGAAACAACAGAAAGCAGG - Intronic
922152302 1:223016899-223016921 AGGTTGGAGGAAGAGAAATGGGG + Intergenic
922794445 1:228333179-228333201 CGGCTGGCAGAACAGAAAAGGGG - Exonic
923219108 1:231876851-231876873 GGGTGGGAAGCAAAGAAAGGTGG - Intronic
923230526 1:231982359-231982381 GGGAAGGAAGAAAAGAAAGAGGG - Intronic
923400189 1:233609258-233609280 GGGCTGGAAGAAGAGAGAAGGGG - Intergenic
923952410 1:238972239-238972261 GAGTTGGAAGAACAGGTTGGTGG + Intergenic
924054531 1:240112470-240112492 GGGTTTGAAGGACAGGAAGATGG + Intronic
924074911 1:240323761-240323783 GAGGAGGAAGAACAGGAAGGAGG - Intronic
924267770 1:242300510-242300532 GTGTTGGAAGAACATCAGGGAGG + Intronic
924559209 1:245143567-245143589 TGGATGGAGGAACAGACAGGTGG - Intergenic
924728937 1:246694699-246694721 GGGGTGTAAGAACAGAGAGTAGG - Intergenic
1063603710 10:7505359-7505381 GAGGTGGAGGAAGAGAAAGGTGG - Intergenic
1064229064 10:13513806-13513828 GGGCTGGAGCAACAGCAAGGAGG - Intronic
1064779024 10:18812748-18812770 GGGGTGTAAGAACAGAGAGTAGG + Intergenic
1064925412 10:20563889-20563911 GTGTTGGAAGAACACCAAGAAGG - Intergenic
1065172329 10:23043882-23043904 GGGTTGCCAGAAAAGAAAGTTGG - Intergenic
1065422174 10:25557250-25557272 TGCTTGGAAGCACAGAAGGGAGG + Intronic
1065493663 10:26307699-26307721 GGGCTGGAAGAACAGGGAGCTGG - Intergenic
1065983528 10:30927304-30927326 GAATTGCAAGAACAGAAAGAAGG + Intronic
1066036446 10:31492031-31492053 GGGTAGGAATAGCAGAAAGCTGG + Intronic
1066330133 10:34412435-34412457 GGGCTGGGAGAAAAGGAAGGTGG - Intronic
1066408533 10:35143310-35143332 GGGTGGGAAGTGAAGAAAGGGGG + Intronic
1066455050 10:35565385-35565407 GGCTTGTTAGAACAGACAGGGGG - Intronic
1067221005 10:44344299-44344321 TGGCTGGGAGAACAGAAAGAAGG + Intergenic
1067327552 10:45284260-45284282 ACGTTGAAAAAACAGAAAGGGGG + Intergenic
1069032916 10:63617078-63617100 TGCTTGGAAGAACTGCAAGGAGG - Intronic
1069149491 10:64939943-64939965 GGGTTGGAGGAACACAAAGTTGG - Intergenic
1069596583 10:69675881-69675903 AAGTAGGAAGAAAAGAAAGGGGG + Intergenic
1069984854 10:72276123-72276145 GGGATGGAGGAACACACAGGTGG - Intergenic
1070432889 10:76359029-76359051 GGGCTGGGAGAACAGAGAAGAGG - Intronic
1071156673 10:82697732-82697754 TGGTAGGAAGCAGAGAAAGGAGG + Intronic
1071394477 10:85207802-85207824 GTGTGACAAGAACAGAAAGGAGG - Intergenic
1071965037 10:90843706-90843728 AAGGTGGAAGAAAAGAAAGGGGG + Intronic
1072048435 10:91680297-91680319 TTGTTTGAAGAACAGAAAGCTGG - Intergenic
1072235248 10:93448069-93448091 GGGTTGAAAGTGCAGGAAGGAGG - Intronic
1072297621 10:94026461-94026483 GGGTTTGAAGAAGAAAAAGATGG - Intronic
1072758553 10:98037307-98037329 GGGTGGGAAGAATATGAAGGCGG - Intergenic
1074197563 10:111202930-111202952 AGGATGGAGGAAAAGAAAGGAGG - Intergenic
1074830831 10:117247469-117247491 AGGTGGGAAGAACAGGAAGCGGG - Intronic
1075838600 10:125477649-125477671 GGAATGGAAGTACAGAATGGGGG + Intergenic
1075870738 10:125771365-125771387 GGGATGTGAGAACAGAAATGGGG + Intronic
1076307471 10:129475171-129475193 GTGTTGGAAGCACAGATGGGAGG + Intronic
1076880620 10:133237618-133237640 GGGTTGGGAGAGATGAAAGGAGG + Exonic
1077009156 11:372611-372633 GGGTTGGAAGGGCAGGGAGGAGG - Intronic
1077465997 11:2734031-2734053 GGGCTGGGAGAACCGCAAGGTGG - Intronic
1078973749 11:16446993-16447015 AGGATGGAAGAAAGGAAAGGAGG - Intronic
1078975858 11:16475510-16475532 GGGATGGAAGAACAGCCAGTTGG + Intronic
1079100014 11:17535270-17535292 CTGTGGGAAGAACTGAAAGGAGG - Intronic
1079125571 11:17716432-17716454 GTGTTAGAAGACAAGAAAGGAGG + Intergenic
1080148887 11:29024525-29024547 GGGGTGGAAGAAATGGAAGGTGG - Intergenic
1080469064 11:32527648-32527670 GGGAGGAAAGAAGAGAAAGGGGG + Intergenic
1080873857 11:36259516-36259538 GGGAAGGAAGAAAAGAAGGGAGG + Intergenic
1081164673 11:39792958-39792980 GTGTTCCAAGAACAGAAAGCAGG - Intergenic
1081197685 11:40181220-40181242 GGAGAGGAAGAAGAGAAAGGAGG - Intronic
1083251892 11:61473786-61473808 GGGATGGAAGAACCAAAAGATGG - Intronic
1083557918 11:63646976-63646998 GTATTTGAAGAACAGGAAGGAGG - Intronic
1083739802 11:64702341-64702363 GGTTTTGTAGAATAGAAAGGGGG + Intronic
1084164693 11:67370100-67370122 AGGTTAGGAGAAAAGAAAGGGGG + Intronic
1084745431 11:71167241-71167263 GGTTTTGTAGAATAGAAAGGGGG - Intronic
1085046461 11:73356514-73356536 GACGTGGAAGAACAGACAGGTGG - Intronic
1085111816 11:73896751-73896773 GGTTTTGTAGAATAGAAAGGGGG - Intronic
1085149947 11:74243122-74243144 GGGTGGGAGAAACAGAAAGTTGG - Intronic
1085205749 11:74731073-74731095 AGGTGGGAAGAAGAGAAAGGTGG + Exonic
1085313091 11:75527543-75527565 TGGTTGGAAGAACAAAGAAGAGG + Intergenic
1086032901 11:82382381-82382403 GGGGGGGAAGAAAAGAAAGAAGG + Intergenic
1086071680 11:82806362-82806384 GGGTTGGCAGATAAGAAAGAGGG + Intergenic
1086075458 11:82846264-82846286 GGGTTGGGAGAACACAGAGGGGG + Intronic
1086079328 11:82887040-82887062 GTGTTGGAGGAACTGAAAAGAGG - Intronic
1086493167 11:87376001-87376023 GGGTTTGAAGAGAAGAAAAGGGG - Intergenic
1086577441 11:88356022-88356044 TGGTGGGAAAAACAGAAAGTTGG + Intergenic
1086853023 11:91833522-91833544 GGTTTGGAAGAAGGGAGAGGAGG + Intergenic
1087324886 11:96709683-96709705 GGGAAAGAAGAAAAGAAAGGAGG - Intergenic
1087625579 11:100592399-100592421 GGTATGGAAGAACAGAGGGGAGG + Intergenic
1087680195 11:101211410-101211432 GGGGTGTAAGAACAGAGAGTAGG + Intergenic
1087934433 11:104016251-104016273 AGGATGGCAGAACAGAAAGGTGG - Intronic
1088560106 11:111106112-111106134 GGATTGGAAGAACATTAAGAGGG + Intergenic
1088614328 11:111609279-111609301 GGGTAGGAAAAACAGATTGGGGG - Intronic
1088701715 11:112419108-112419130 AGGTTGAAAGAACAAAAAGTAGG + Intergenic
1088783406 11:113158533-113158555 GGGAGAGAAGAAGAGAAAGGTGG - Intronic
1089323137 11:117639859-117639881 GGGGAGGAAGAACAGATGGGCGG - Intronic
1089746903 11:120623944-120623966 GGGGAGGAAGAAGAGTAAGGGGG - Intronic
1090037801 11:123263928-123263950 GGGCTGGAGGAACAGAGAGAAGG + Intergenic
1090118580 11:124000732-124000754 GGGAAGGAAGGAAAGAAAGGGGG + Intergenic
1090261047 11:125320436-125320458 GGCTTGGAGGAACAGGAGGGTGG + Intronic
1090296593 11:125593247-125593269 GGGTGGGAAGAAGAGGGAGGTGG + Intronic
1090932533 11:131311116-131311138 GGGTTGGAAGAATAGAGCGAAGG - Intergenic
1090987899 11:131788751-131788773 AAGTTGGAAGAAAAGAAAGTGGG - Intronic
1091399215 12:172400-172422 GGGCTGGCAGAACAGAACAGAGG - Intronic
1091665594 12:2416355-2416377 GTGGTGGAAGAAAAGGAAGGAGG + Intronic
1091769874 12:3144570-3144592 GGGCTGGAAGTGCAGAATGGAGG - Intronic
1093414093 12:18900357-18900379 TCGTTAGAAGAACAGAAAAGAGG + Intergenic
1093554028 12:20449361-20449383 TGGTTGGAAAAACAAAAATGTGG - Intronic
1093703768 12:22252583-22252605 GGGTTGAAAGAACTCAAAGAAGG - Intronic
1093775333 12:23067154-23067176 GAGAAGGAAGAAGAGAAAGGAGG - Intergenic
1093995978 12:25643358-25643380 GGGTTTGAAAAATAGAGAGGAGG + Intronic
1094017441 12:25880143-25880165 GGGTTTGAAGTATAAAAAGGAGG - Intergenic
1094520364 12:31180697-31180719 GGTTTTGTAGAATAGAAAGGGGG - Intergenic
1094674593 12:32607206-32607228 CTGGTGTAAGAACAGAAAGGAGG - Intronic
1094747301 12:33359746-33359768 GAGATGGAAGAAAAGAAAGGGGG - Intergenic
1094818451 12:34207732-34207754 GGGTGGGAAGAACAGAGGGAGGG - Intergenic
1095508912 12:42928082-42928104 GAGGTGGGAGAAGAGAAAGGAGG - Intergenic
1095585817 12:43848019-43848041 GGGGTGTAAGAACAGAGAGTAGG + Intronic
1096441296 12:51645496-51645518 GGTTTTGTAGAATAGAAAGGGGG + Intronic
1096811312 12:54172292-54172314 GTGTTGGAAGAACAGCAATGAGG - Intronic
1097026083 12:56056572-56056594 GGGTCTGAGGAACAGAAAGGAGG - Intergenic
1097414574 12:59298601-59298623 TGGTTGGAACAACAGAAGTGAGG - Intergenic
1097499666 12:60387400-60387422 GGGTTAAAAAAACAGAAAAGGGG + Intergenic
1097738716 12:63212842-63212864 GTGTTGGAAGTAGAGAAAGGAGG - Intergenic
1097965751 12:65579242-65579264 GGGTAGGAAGAATAGGAAGGAGG + Intergenic
1098242651 12:68484457-68484479 GGTTTTGTAGAATAGAAAGGGGG + Intergenic
1098551521 12:71767304-71767326 GGGATGGTAGAAAAGAAATGAGG + Intronic
1098741134 12:74174953-74174975 GGGGTGTAAGAACAGAGAGTAGG + Intergenic
1098893869 12:76035434-76035456 GGGTGGGAAGAAAAGGAAGGTGG + Intergenic
1099222607 12:79933836-79933858 GGGTTGGGAAAAAAGAAAGCTGG - Intronic
1099231151 12:80027165-80027187 GGGTGGGCAGAACTGAGAGGAGG + Intergenic
1099255170 12:80307261-80307283 GGTTTTGTAGAATAGAAAGGGGG - Intronic
1100087500 12:90929525-90929547 GGGGTGTAAGAACAGAGAGTAGG + Intronic
1100201268 12:92300123-92300145 ATATTGGAAGAAGAGAAAGGAGG + Intergenic
1100367720 12:93936858-93936880 GAGTGGGAGGAACAGAAAGGAGG + Intergenic
1100606836 12:96158442-96158464 GGTTTTGTAGAATAGAAAGGGGG + Intergenic
1100748032 12:97667185-97667207 GGGAAGGAAGAAAAGAAAGGAGG + Intergenic
1101189821 12:102321088-102321110 GGGAAGTAAGAACAGAAATGAGG + Intergenic
1101493933 12:105236039-105236061 GGGTTGGAAGGACAGAGGGCAGG + Exonic
1102052986 12:109876626-109876648 GGGAGGGAAGAAAAGAAAGAAGG + Intronic
1102247950 12:111367116-111367138 GTATTTGAGGAACAGAAAGGAGG - Intronic
1102474715 12:113181061-113181083 GGGAGGGAAGGACAGAGAGGTGG + Intronic
1102919040 12:116778113-116778135 AGGAGGGAAGAAAAGAAAGGGGG - Intronic
1102997504 12:117361388-117361410 GGGAGGGAAGAAGAGAAGGGAGG - Intronic
1103197389 12:119056601-119056623 GGGTTTGAAAAACTGAAAAGAGG - Intronic
1103972388 12:124680222-124680244 GGGGTGGCAGAAGAGAGAGGAGG - Intergenic
1104040583 12:125127742-125127764 TGGTTGGAAAAACAGAAATGTGG - Intronic
1104083572 12:125455173-125455195 GGGGTGGAGGAAATGAAAGGTGG + Intronic
1104134356 12:125923316-125923338 GGGAAGGAAGGAAAGAAAGGAGG + Intergenic
1104559642 12:129832206-129832228 GGGTTGGAAGAAGGAACAGGAGG + Intronic
1104766335 12:131332785-131332807 GCGTGGGGAGAACAGAGAGGAGG + Intergenic
1104813072 12:131629812-131629834 GCGTGGGGAGAACAGAGAGGAGG - Intergenic
1105263752 13:18798950-18798972 GGGTTGGAAGTAAAAACAGGTGG - Intergenic
1106802597 13:33271494-33271516 GGGCTGGAAGTAGAGGAAGGAGG + Intronic
1107786849 13:43966591-43966613 GGGGGGGAAGTACACAAAGGAGG - Intergenic
1107800276 13:44099979-44100001 GAGTTTGAAGAACTGGAAGGAGG - Intergenic
1108816155 13:54293106-54293128 GGGATGGGAGAGAAGAAAGGTGG - Intergenic
1109033472 13:57224275-57224297 GGGATGGAAGGAAAGAAGGGAGG + Intergenic
1109518496 13:63476642-63476664 AGGTGGGAAGAACAGAAGGAAGG - Intergenic
1109638863 13:65160574-65160596 GGGATGGAAGCAGAGTAAGGTGG - Intergenic
1109765917 13:66897224-66897246 GGGAGGGAAGAAAGGAAAGGAGG + Intronic
1109859161 13:68174224-68174246 GACTTGGAAGAACAGAAAGAAGG + Intergenic
1110628239 13:77676036-77676058 GGGTAGGAGAAAAAGAAAGGAGG - Intergenic
1111888187 13:94049517-94049539 GGGTTTGAGGAACAGTGAGGAGG - Intronic
1112671738 13:101647705-101647727 GGGTTGGAAGAAAATATAGAAGG + Intronic
1113214082 13:108017781-108017803 GGGGTGTAAGAACAGAGAGTAGG - Intergenic
1113728594 13:112623959-112623981 GGGATTGTAGGACAGAAAGGGGG + Intergenic
1113741231 13:112713924-112713946 GGGTGGGAAGAATGGAAGGGAGG - Intronic
1114231332 14:20785664-20785686 GGGGGGGAAGAACAGGAAGAAGG + Intergenic
1115557411 14:34554383-34554405 GGGTTTGGCGAACAGCAAGGAGG + Intergenic
1115734843 14:36314835-36314857 AGATAGGAAGAACAGAAATGGGG - Exonic
1116074812 14:40097850-40097872 GGGAAGGAAGAACAGAAAGAAGG - Intergenic
1116554692 14:46288170-46288192 GGGGTGCAAGAACAGGAAGTAGG + Intergenic
1116659602 14:47692181-47692203 GGGAAGGAAGAAGGGAAAGGTGG - Intergenic
1117313363 14:54550373-54550395 GTGTTAGAGGAACAGAAAAGAGG + Intergenic
1117815298 14:59591921-59591943 GGGTAGGAAGAGCAGGGAGGAGG - Intergenic
1118020825 14:61712286-61712308 GTGTTTTAAGAACAGTAAGGAGG + Intronic
1119199767 14:72743722-72743744 GAGCTGGCAGAAGAGAAAGGTGG - Intronic
1119780703 14:77275253-77275275 GGCATGGAGGAACAGAAAGTGGG + Exonic
1119965928 14:78915706-78915728 GGGGTTGGAGAAAAGAAAGGTGG + Intronic
1120142360 14:80942800-80942822 GGGATGGAAGGAGAGAAAGGGGG - Intronic
1120352534 14:83381231-83381253 GGGTTGGAAGGACAGGAAAGAGG + Intergenic
1120397129 14:83982207-83982229 GGGGTGTAAGAACAGAGAGTAGG - Intergenic
1121664482 14:95661449-95661471 GGCTTGGAAGAGAAGCAAGGGGG - Intergenic
1121774042 14:96578496-96578518 GGGTGGGAAGAGGAGAAATGAGG + Intergenic
1122795436 14:104203763-104203785 TGGATGGATGAACAGATAGGTGG - Intergenic
1122795456 14:104203879-104203901 AGGATGGATGAACAGACAGGTGG - Intergenic
1122795477 14:104203986-104204008 TGGATGGATGAACAGATAGGTGG - Intergenic
1122795518 14:104204221-104204243 TGGATGGATGAACAGATAGGTGG - Intergenic
1122795536 14:104204305-104204327 TGGATGGATGAACAGATAGGTGG - Intergenic
1122795551 14:104204397-104204419 AGGATGGATGAACAGACAGGTGG - Intergenic
1122795610 14:104204714-104204736 AGGATGGATGAACAGATAGGTGG - Intergenic
1122795621 14:104204782-104204804 AGGATGGATGAACAGATAGGTGG - Intergenic
1122795650 14:104204942-104204964 TGGATGGATGAACAGATAGGTGG - Intergenic
1202834687 14_GL000009v2_random:69067-69089 GGGTTGGAAGTAAAAACAGGTGG + Intergenic
1124334903 15:28849391-28849413 GGTTTTGTAGAATAGAAAGGGGG - Intergenic
1124612637 15:31218523-31218545 GGGTTGGAAGAAAAGGAACATGG - Intergenic
1124878791 15:33622281-33622303 GGATCAGATGAACAGAAAGGAGG - Intronic
1125343175 15:38694420-38694442 GTGTTGGAAGAACAGTGAGAAGG + Intergenic
1125500685 15:40238862-40238884 GGGTAGGAAGGACAGCAGGGAGG + Intronic
1126110752 15:45173491-45173513 GGGTTGGAGGAGCTGAGAGGTGG - Intronic
1126599741 15:50417097-50417119 GTGCTGGAGGAACAGCAAGGAGG - Intergenic
1127602859 15:60555694-60555716 AGGTGGGAAGAAAAGGAAGGTGG + Intronic
1127672971 15:61213194-61213216 GAGTTGGAAGAACATGATGGAGG - Intronic
1127764015 15:62166964-62166986 AGGATGGAAGAACAGAAAAAAGG - Intergenic
1128387738 15:67162678-67162700 AGGTCGGAAGAACAGAATGAAGG - Intronic
1128459137 15:67852928-67852950 GAGTGGGAAGAACAGGGAGGCGG - Intergenic
1128671647 15:69578327-69578349 TGGTGTGAAGACCAGAAAGGAGG + Intergenic
1128992198 15:72270510-72270532 GAGTTTGAAGAACAGTAATGAGG - Intronic
1130284636 15:82544705-82544727 GGGTTGGGGGAACAAAAAGGAGG + Intronic
1130824287 15:87527925-87527947 GCTTTGGAAGAGCAGGAAGGTGG + Intergenic
1131125710 15:89855067-89855089 GGCTTTGTGGAACAGAAAGGCGG + Intronic
1131127693 15:89869111-89869133 GGCTTTGTGGAACAGAAAGGCGG + Intronic
1131394936 15:92078625-92078647 GGGGAGGAAGAACAGGAAGAAGG - Intronic
1131798627 15:96046547-96046569 GAGTTTGAGTAACAGAAAGGTGG + Intergenic
1132072584 15:98791975-98791997 GGGTTTGAGGATCAGAATGGTGG + Intronic
1132808137 16:1785190-1785212 GGGCTGGAAGTGCAGGAAGGAGG - Intronic
1134041325 16:11070733-11070755 GTGTTTGAAGAAGAGCAAGGAGG - Intronic
1134894953 16:17877411-17877433 GAGGTGGAAGAAAAGAGAGGGGG - Intergenic
1135614009 16:23894150-23894172 GAGTTGCAAGAGCAGCAAGGAGG + Intronic
1136363219 16:29795076-29795098 GTTTTGGGAGAACAGAAAGATGG - Intronic
1136922065 16:34341381-34341403 CAGTTGCAAAAACAGAAAGGGGG + Intergenic
1136982508 16:35070425-35070447 CAGTTGCAAAAACAGAAAGGGGG - Intergenic
1137584408 16:49655629-49655651 GGGTTGGACTCACTGAAAGGTGG - Intronic
1137668437 16:50265654-50265676 GGGTTAGAAGACCAGAAGAGGGG + Intronic
1138381785 16:56607768-56607790 GGGCTGGGGGAACAGAGAGGAGG - Intergenic
1138803871 16:60069660-60069682 TGGATGGCAGAACAGAAAGATGG + Intergenic
1139734071 16:68972242-68972264 GGGTGGGGAGGGCAGAAAGGAGG + Intronic
1140056481 16:71530293-71530315 AGTTTGGAAGAACTGAAAGTCGG + Intronic
1141682882 16:85554582-85554604 GGGTGAGAGGAAAAGAAAGGAGG + Intergenic
1142153148 16:88521513-88521535 GGGTTGGGGGAACAGCACGGGGG - Intronic
1142851484 17:2706898-2706920 GGAATGGGAGGACAGAAAGGAGG + Intronic
1142989147 17:3717840-3717862 AGGGAGGAAGAACAGAAAGAGGG + Intronic
1143092953 17:4460114-4460136 GGGTTTGAATAACAACAAGGCGG + Intronic
1143182141 17:4989928-4989950 GGCTGTGAAGAACAAAAAGGGGG + Exonic
1143214337 17:5213237-5213259 GGGATGGAAAAGCAAAAAGGGGG - Intronic
1143303641 17:5929216-5929238 GGAGAGGAAGGACAGAAAGGAGG - Intronic
1143410859 17:6707554-6707576 GAGAAGGAAGAAAAGAAAGGAGG + Intronic
1143813436 17:9491263-9491285 GGGTTGTAGGGGCAGAAAGGGGG - Intronic
1144952426 17:19001451-19001473 GGGCTGGAAAAGCAGAAAGCAGG + Intronic
1145027150 17:19476242-19476264 GGTTTGGTGGAATAGAAAGGGGG + Intergenic
1145184950 17:20785984-20786006 GGGTGGCAATAAGAGAAAGGAGG - Intergenic
1145769201 17:27480163-27480185 GGGATGTGAGAACAGGAAGGTGG - Intronic
1145802718 17:27699895-27699917 CAGTTGCAAAAACAGAAAGGAGG + Intergenic
1145902707 17:28498694-28498716 GGGTTGGAAGTGCAGTTAGGAGG + Intronic
1146173795 17:30651967-30651989 GAGTTTGGAGAACAGTAAGGAGG - Intergenic
1146347251 17:32067988-32068010 GAGTTTGGAGAACAGTAAGGAGG - Intergenic
1148761980 17:50009185-50009207 GAGTTTGAAGAACAGCAAGGAGG + Intergenic
1149339291 17:55669419-55669441 GGGGAGAAAGAAAAGAAAGGAGG - Intergenic
1149524287 17:57341885-57341907 GGAGAGGAAGAAAAGAAAGGGGG - Intronic
1150019404 17:61595617-61595639 GGGTAGGAAGAAGAGAAAACAGG - Intergenic
1150612086 17:66741516-66741538 GGGTTGGAAGAACACGATGCTGG + Intronic
1151078495 17:71301519-71301541 GGGAAGGGAGAAAAGAAAGGGGG - Intergenic
1151231866 17:72690721-72690743 GGGATGGAAGGAAAGAGAGGTGG + Intronic
1151246616 17:72799891-72799913 GGGGTGTAAGAACAGAGAGTAGG - Intronic
1151356134 17:73559722-73559744 GGTAGGGAAGAAAAGAAAGGGGG - Intronic
1152767454 17:82148901-82148923 TGGATGGATGAACAGATAGGTGG + Intronic
1152997000 18:416883-416905 GGGTTGGTAGAAAAGGAAGAAGG + Intronic
1153259142 18:3206011-3206033 AGGATGGAAGAACACAAAGAAGG + Intronic
1154089275 18:11342380-11342402 GGGGTGTAAGAACAGAGAGTAGG + Intergenic
1154370453 18:13756730-13756752 GGGTTGGAAGAGCAAGAAGCTGG + Intronic
1155482663 18:26306103-26306125 GTGTCCGAAGAACAGAAAGGAGG - Intronic
1156108313 18:33692378-33692400 GGGTTTGAGGAACAGAAAGGAGG - Intronic
1156270111 18:35522976-35522998 GAGTAGGAGGAAAAGAAAGGAGG - Intergenic
1156270551 18:35526573-35526595 GAGTAGGAGGAAAAGAAAGGAGG + Intergenic
1156988032 18:43372430-43372452 AGGCTTGAAGAACAGAAAAGAGG + Intergenic
1158131845 18:54160862-54160884 GGGTCAGCAGAACAGAAAAGGGG + Intronic
1158392978 18:57058647-57058669 GGGTTGGAAGTACAGATTTGGGG - Intergenic
1159152871 18:64542729-64542751 GTGTTGGAAGAGAAGAAAAGAGG - Intergenic
1160183282 18:76654636-76654658 GGGTAGAAAGAACAGGGAGGAGG + Intergenic
1160356185 18:78229801-78229823 GGGAATGAAGAAGAGAAAGGAGG - Intergenic
1160373582 18:78394104-78394126 GAGTAGGAACAGCAGAAAGGAGG + Intergenic
1160699553 19:499183-499205 GTGTTGGAGGAACAGCGAGGAGG - Intronic
1160988414 19:1850834-1850856 GTGTTGGAGGAACAGCGAGGAGG + Intergenic
1161207093 19:3046970-3046992 GGGAGGGAAGAATAGGAAGGTGG - Intronic
1161221865 19:3121608-3121630 GGGTTGGAAGGACAGCCACGGGG - Exonic
1161239330 19:3213315-3213337 GTGTTGGAGGAACAGTGAGGAGG + Intergenic
1161243046 19:3233626-3233648 GTGTTGGAGGAACAGCAAGGAGG + Intronic
1161245851 19:3251427-3251449 GTGTTGGAGGAACAGGGAGGAGG + Intronic
1161258904 19:3324768-3324790 ATGTTGGAGGAACAGCAAGGAGG - Intergenic
1161262489 19:3345556-3345578 GTGTTGGAGGAACAGCAAGGAGG - Intergenic
1161274897 19:3410480-3410502 GTGTTGGAGGAACAGCGAGGAGG + Intronic
1161289392 19:3484969-3484991 GTGTTGGAGGAACAGTGAGGAGG + Intergenic
1161291836 19:3498123-3498145 GTGTTGGAGGAACAGCGAGGAGG - Intronic
1161301613 19:3545427-3545449 GTGTTGGAAGAACAGGGAGGAGG - Intronic
1161414740 19:4139669-4139691 GTGTTGGAGGAGCAGTAAGGAGG + Intergenic
1161427291 19:4210505-4210527 GAGTTGGAGGAACAGCGAGGAGG - Intronic
1161442596 19:4300774-4300796 GTGTTGGAGGAACAGCGAGGAGG + Intronic
1161488315 19:4547844-4547866 GTGTTGGAAGAACAGCAAGGTGG - Intronic
1161492149 19:4567927-4567949 CTGTTGGAGGAACAGCAAGGAGG - Intergenic
1161518016 19:4707522-4707544 GGGTTGAAAGTAGAGCAAGGAGG - Intronic
1161522242 19:4731072-4731094 GTGTTGGAGGAACAGTGAGGAGG - Intergenic
1161534747 19:4812045-4812067 GTGTTGGAGGAACAGCGAGGAGG - Intergenic
1161569767 19:5024161-5024183 GGGATGGAAGAACTTGAAGGTGG - Intronic
1161624715 19:5319679-5319701 GTGTTGGAGGAACAGCGAGGAGG - Intronic
1161629360 19:5344519-5344541 GTGTTGGAGGCACAGCAAGGAGG - Intergenic
1161630799 19:5354470-5354492 GTGTTGGAGGATCAGCAAGGAGG + Intergenic
1161649891 19:5477987-5478009 GTGTTGGAGGAACAGCGAGGGGG - Intergenic
1161658838 19:5533481-5533503 GTGTTGGAGGAACAGTGAGGAGG + Intergenic
1161684796 19:5697459-5697481 GTGTTAGAAGAACAGTGAGGAGG + Intronic
1161705817 19:5820948-5820970 GTGTTGGAGGAACAGTGAGGAGG - Intergenic
1161756417 19:6137418-6137440 GAGTTGGAAGAACAGTGAGGAGG + Intronic
1161760587 19:6168205-6168227 GTGTTGGAGGAACAGCAAGGAGG - Intronic
1161790397 19:6356012-6356034 GGTTTGGTGGAATAGAAAGGGGG + Intergenic
1161791421 19:6362249-6362271 GGGTTTGGAGCACAGGAAGGGGG - Intronic
1161854956 19:6758998-6759020 GGGTTCGAACAACTGCAAGGAGG + Intronic
1161863708 19:6818452-6818474 ATGTTGGAGGAACAGCAAGGAGG - Intronic
1161905796 19:7155610-7155632 GGGTTAGAAAAAGATAAAGGGGG + Intronic
1161910235 19:7188012-7188034 GGGTGGGAGGTGCAGAAAGGAGG - Intronic
1161954372 19:7484827-7484849 GGCCTGGAAGATCAGGAAGGAGG + Intronic
1162180775 19:8867345-8867367 TGGTTGGAAGGACAGAAGGAAGG + Intronic
1162180789 19:8867420-8867442 TGGTTGGAAGGACAGAAAGAAGG + Intronic
1162252630 19:9459180-9459202 CAGTTGCAAAAACAGAAAGGGGG + Intergenic
1162622660 19:11856252-11856274 ATGTTGAAAAAACAGAAAGGGGG - Intronic
1162753087 19:12840743-12840765 AGGTGGGACGGACAGAAAGGAGG + Intronic
1162848524 19:13412942-13412964 TGGTTGGAAGTTCAGAAAGTGGG + Intronic
1162988621 19:14288073-14288095 GAGTTTGGAGAACAGTAAGGAGG + Intergenic
1164146641 19:22516836-22516858 AGGTGAGAAGAAGAGAAAGGTGG - Intronic
1164268843 19:23650217-23650239 GGGGTGTAAGAACAGAGAGTAGG - Intronic
1165477695 19:36040717-36040739 GGGCAGGAAGACCAGGAAGGAGG - Intronic
1165535456 19:36440605-36440627 GGGAGGGAAGAAAAGAAAGGCGG + Intergenic
1165991851 19:39819843-39819865 GGGTTGGAAGACTAGAGAGTGGG - Intergenic
1166156868 19:40920069-40920091 GGGGTGTAAGAACAGAGAGTAGG - Intergenic
1166257196 19:41615040-41615062 GGGGTACAAGAACAGCAAGGAGG + Intronic
1167273040 19:48517202-48517224 GTGTTGGAGGAACAGGGAGGAGG - Intergenic
1167330362 19:48852089-48852111 AGATTGAAAGGACAGAAAGGAGG + Intronic
1167607626 19:50489838-50489860 AGGATGGGAGAACAGAAAGAGGG + Exonic
1167739520 19:51316037-51316059 AGGTGGGACCAACAGAAAGGAGG + Intronic
1167834509 19:52056778-52056800 GGGGTGTAAGAACAGAGAGTAGG - Intronic
1167897395 19:52593233-52593255 GGTTTTGTAGAATAGAAAGGGGG - Intergenic
1168433872 19:56302560-56302582 GGGGAGGAAGAAAAGGAAGGGGG - Intronic
1202638012 1_KI270706v1_random:58626-58648 GGGTTGGAAGTAAAAACAGGTGG - Intergenic
924960239 2:28212-28234 GGGGTGCAAGAACAGAGAGCTGG + Intergenic
925021647 2:574200-574222 GGGTTGGAAAAACAGAAGATAGG + Intergenic
925101904 2:1254145-1254167 GGGATAGAAGAATGGAAAGGAGG + Intronic
925423062 2:3727166-3727188 GGGGAGGAGGGACAGAAAGGGGG - Intronic
926147877 2:10407724-10407746 GGGAAGGAAGAGCAGACAGGTGG + Intronic
927151400 2:20198497-20198519 AGCTTGGCAGAAGAGAAAGGAGG - Intergenic
927214467 2:20659816-20659838 GGGTGGGCAGAATAGAGAGGTGG - Intergenic
927688662 2:25191607-25191629 GGGTTGGAGGAACAGTGAGGAGG + Intergenic
928013206 2:27629817-27629839 GGGTTGGAAGGAGACAAAGAGGG - Intronic
928122386 2:28592367-28592389 GGGAAGGAAGAAGGGAAAGGTGG - Intronic
928541914 2:32293544-32293566 GGTTTTGTGGAACAGAAAGGGGG - Intronic
928674586 2:33637935-33637957 GAAATGGAAGAACAGAAAGATGG + Intergenic
930070690 2:47363623-47363645 ATGCTGGAAGAACAGAAAGGAGG - Intronic
930183593 2:48388746-48388768 CAGTTGCAAAAACAGAAAGGGGG + Intergenic
930216372 2:48701410-48701432 GTATTTGAAGAACAGCAAGGAGG - Intronic
930300695 2:49612101-49612123 GGGGTGTAAGAACAGAGAGTAGG - Intergenic
930575486 2:53141923-53141945 AGGGTAGAAGAGCAGAAAGGAGG - Intergenic
931075776 2:58710049-58710071 AGGTTCAAAGAACAGCAAGGAGG - Intergenic
931367206 2:61629249-61629271 AGGATGGAAGAAAAGAAAGAAGG - Intergenic
931814253 2:65885175-65885197 GGGCTGGAAGAGCAAAAGGGAGG + Intergenic
932208753 2:69908977-69908999 GTTTTGAAAGAACAGCAAGGAGG - Intronic
932235665 2:70119286-70119308 GTGTTTTAAGAACAGCAAGGAGG + Intergenic
932634280 2:73374423-73374445 TGGCTTGAAAAACAGAAAGGAGG + Intergenic
932828690 2:74966702-74966724 GGATCGGAAATACAGAAAGGAGG - Intronic
932830593 2:74986062-74986084 GGGCAGGAAGAACAGGAAGCTGG + Intergenic
933900900 2:86849367-86849389 AGGTTGGGAGAACAAATAGGAGG - Intronic
934493430 2:94778083-94778105 GGGCTGGAAGTACAAAGAGGTGG - Intergenic
935486214 2:103657546-103657568 TGGTTGGAAGAAAAGAGATGTGG - Intergenic
935779642 2:106499864-106499886 AGGTTGGGAGAACAAATAGGAGG + Intergenic
935940009 2:108228439-108228461 AGGTTGGTAGAACAAAAAGAGGG + Intergenic
936863494 2:117050905-117050927 GGGGTGGAAGAACAGGGTGGTGG + Intergenic
938810353 2:134847008-134847030 GTGTTCAAGGAACAGAAAGGAGG + Intronic
939733805 2:145819141-145819163 GGGATGGAGGAAAGGAAAGGAGG - Intergenic
940210709 2:151253830-151253852 TGTGTGGAAGAACAGCAAGGAGG - Intronic
941113365 2:161443133-161443155 GGGCTGAAAGAAAAGAAATGGGG + Intronic
941236007 2:162974945-162974967 GGGTTGCCAGAAGAGACAGGTGG + Intergenic
942832523 2:180253763-180253785 GTGTTTGAAGAACTGAAAGAAGG - Intergenic
943039406 2:182786653-182786675 GGGTTTGAAGGACACAAGGGTGG - Exonic
943505943 2:188757731-188757753 GGGCTGGAAGAGTAGAAAGCTGG - Intronic
944255482 2:197619283-197619305 GGTTTTGTAGAATAGAAAGGGGG + Intronic
944262857 2:197695885-197695907 GGTTTTGTAGAATAGAAAGGGGG - Intronic
944560391 2:200930201-200930223 GAAATGGAAGAACAGAAAAGAGG + Intronic
944593387 2:201239221-201239243 GGTTTTGTGGAACAGAAAGGGGG - Intronic
944874540 2:203948872-203948894 GTGTTTGAGGAACAGAAAGAAGG + Intronic
945074015 2:206019076-206019098 CTGTTCCAAGAACAGAAAGGAGG + Intronic
945140729 2:206683694-206683716 GGATTCAAAGAACAGCAAGGGGG - Intronic
945455984 2:210052818-210052840 GGGAAGGAAGAAAAGAAAGAAGG + Intronic
946318348 2:218932141-218932163 GGTTTTGTAGAATAGAAAGGGGG + Intergenic
946321533 2:218957525-218957547 GGGTTGGAGGCAGAGCAAGGTGG + Intergenic
946364677 2:219241594-219241616 GGGTCTGAAGAACAGCAATGAGG + Intronic
946960453 2:224979563-224979585 GTGTTAGAAGAACAGAAAGGAGG - Intronic
947021549 2:225683015-225683037 TAGTAGGAAGAACAGAATGGGGG - Intergenic
948127696 2:235576827-235576849 GGGTGTGAAGGGCAGAAAGGTGG + Intronic
948728582 2:239949456-239949478 GTCTGGAAAGAACAGAAAGGTGG + Intronic
948899833 2:240950671-240950693 TGGCTGGATGAACAGATAGGTGG - Intronic
948944224 2:241211291-241211313 GGGAGGGAAGAACTGAGAGGTGG - Intronic
1169748108 20:8963787-8963809 GGGATGGAAGAATGGGAAGGAGG + Intronic
1170466289 20:16625447-16625469 GGGAAGGAAGAAAAGAAGGGAGG - Intergenic
1171884581 20:30642687-30642709 GGGTTGGAAGTAAAAACAGGTGG - Intergenic
1171956542 20:31468211-31468233 GGGTTTGAACAGCAGCAAGGAGG - Intronic
1171987097 20:31668095-31668117 ACGTTGGAGGAACAGCAAGGAGG - Intronic
1172180781 20:33002220-33002242 TGGGTGGATGAACAGAAAGAGGG + Intronic
1172951153 20:38724260-38724282 GGGCTAGGAGAAGAGAAAGGGGG - Intergenic
1173157373 20:40625485-40625507 GGGTTGCAAGAACAGGAATTTGG + Intergenic
1173519614 20:43689462-43689484 GGGTTCGAGGGACTGAAAGGAGG - Intronic
1174114796 20:48219541-48219563 GAGCTGGAAGAACAGCAAGGAGG + Intergenic
1174502385 20:50995214-50995236 AGGGTGGGAGAACAGAAAGATGG - Intergenic
1175211083 20:57355767-57355789 GGGTTAGGAGAACAGGAGGGAGG + Intronic
1177082436 21:16656911-16656933 TGGTTGGAAGAACAGAAAACAGG + Intergenic
1177202690 21:17975578-17975600 GGGTTTGAGGAACTGAAATGTGG - Intronic
1177927464 21:27235997-27236019 GGGGTGGAAGAGCTGAAAAGAGG - Intergenic
1178110443 21:29364617-29364639 GAGATGGAAGTAAAGAAAGGGGG + Intronic
1178117012 21:29427983-29428005 GGGTTTGAAGAAAATAAAAGCGG + Intronic
1178188631 21:30254792-30254814 GGGTTGGTGTAACAGAAAGCTGG + Intergenic
1178291879 21:31375490-31375512 AAGTTGAAAAAACAGAAAGGTGG - Intronic
1178301119 21:31453915-31453937 GAGTGGGAGCAACAGAAAGGTGG - Intronic
1178357900 21:31923717-31923739 GGGAGGGAAGAACAGAAGGAAGG - Intronic
1178838640 21:36120469-36120491 GGGTCTGAAGAACAGAAGGCAGG - Intergenic
1178961404 21:37069760-37069782 GAGCTAGAAGAACTGAAAGGAGG - Intronic
1179041143 21:37803164-37803186 TGGTTGGAAGAACAGGAATGCGG + Intronic
1179349290 21:40592560-40592582 GTATTGGAAGAACAGGAAGAAGG - Intronic
1180363957 22:11923253-11923275 GGGTTGGAAGTAAAAACAGGTGG + Intergenic
1181393814 22:22603829-22603851 GGGTGGGAGGTAGAGAAAGGAGG + Intergenic
1181885195 22:26016630-26016652 GGAATGGAGGAACAGAAAGATGG - Intronic
1182017860 22:27055919-27055941 ATGTTGGAGGAACATAAAGGAGG + Intergenic
1182052527 22:27324138-27324160 TGGGTGGATGAACAGAAAGATGG + Intergenic
1182058801 22:27382104-27382126 GGGTTTCAGGAACAGAAAAGTGG + Intergenic
1182306572 22:29373484-29373506 GGGTGGGAAGGACTGAAAGTGGG + Intronic
1183098926 22:35571349-35571371 GAGTTGGAGGCACAGCAAGGAGG - Intergenic
1183621041 22:38972888-38972910 GGGTTGTAAAAACAGACCGGAGG + Intronic
1183983714 22:41557747-41557769 GTGGCGGAGGAACAGAAAGGAGG - Intergenic
1184288621 22:43486385-43486407 GGGTGGGAAGAACAAACGGGTGG + Intronic
1184970062 22:48013121-48013143 GGGTTGGAAGAAGGCAAAAGTGG - Intergenic
1185241430 22:49749561-49749583 GGGTTGGACGCCCAGTAAGGGGG + Intergenic
949335112 3:2966137-2966159 GAGATGGAAGAAAGGAAAGGGGG + Intronic
950031527 3:9856995-9857017 GGCTGGGACAAACAGAAAGGAGG - Intergenic
950032212 3:9860649-9860671 GGGTGGGACAAATAGAAAGGAGG - Intergenic
950415357 3:12866172-12866194 GGCTGGGACAAACAGAAAGGAGG - Intronic
950416989 3:12874460-12874482 GGCTGGGACAAACAGAAAGGAGG - Intergenic
951259659 3:20492597-20492619 TGTCTGGAAGAACAGAAAGTAGG + Intergenic
952212899 3:31247231-31247253 GTCTTGGAAGAAGAGAAAAGGGG - Intergenic
952666273 3:35908411-35908433 GGAGAGGAAGATCAGAAAGGAGG - Intergenic
952894659 3:38070160-38070182 GGGGTGGCAGAAAAGAAAGTGGG + Intronic
953367787 3:42361409-42361431 GGGTAGGAAGGACAGAAGAGAGG + Intergenic
953531708 3:43745576-43745598 GGGTTGGTAGGAAAGACAGGAGG + Intergenic
953771738 3:45782751-45782773 TGGATGGACGAACAGACAGGTGG - Intronic
953922920 3:46964492-46964514 GGTTTTGAGGAACAGAAAAGGGG + Intronic
953998320 3:47537119-47537141 GGGTTGGGAGAAGAGGAAGGAGG + Intergenic
954355880 3:50084100-50084122 GGTTTTGTAGAATAGAAAGGGGG - Intronic
954383111 3:50230081-50230103 AGGGTGGATGACCAGAAAGGGGG + Intronic
955146441 3:56324834-56324856 ATGATGGAAGAACAGCAAGGAGG - Intronic
955560823 3:60188294-60188316 GAGGTGGAATAACAGAAAGCTGG - Intronic
956069786 3:65435894-65435916 TGGTTAAAAGAACTGAAAGGAGG + Intronic
956547699 3:70423737-70423759 GGTTAGGAAGAACAGAATGGAGG + Intergenic
956590019 3:70904819-70904841 GGGTTAGAGGAACTGCAAGGAGG + Intergenic
956853920 3:73257391-73257413 CTGTTGGAAGAACAGAAAGGAGG - Intergenic
956968244 3:74489426-74489448 GGGAAGGAAGAAAAGAAAGAAGG - Intronic
957064657 3:75511682-75511704 GGGGTGTAAGAACAGGAAGTAGG - Intergenic
957595729 3:82263366-82263388 GGGATGGAAGAATAGAAAGTAGG + Intergenic
959087575 3:101868006-101868028 GGGTTGGAAGAAAGGAAAAAAGG - Intergenic
959240098 3:103780554-103780576 GTGTCAGAAGAACAGATAGGAGG + Intergenic
959576199 3:107936952-107936974 GGCTGAGTAGAACAGAAAGGAGG - Intergenic
960036443 3:113107329-113107351 GGGTTGGAAGAAAGGAAATTTGG + Intergenic
960129735 3:114043255-114043277 GTGTTGGAAAAACAGCAAGGAGG + Intronic
960622573 3:119651158-119651180 GTGTTTGATGCACAGAAAGGAGG - Intronic
960949003 3:122986955-122986977 GGGGAAGAAGAACAGAGAGGTGG + Intronic
961110282 3:124277690-124277712 GGGTGTGGAGAACAGAATGGAGG + Intronic
961232746 3:125333500-125333522 GGAGTGGAAGAGAAGAAAGGGGG - Intronic
961237839 3:125383625-125383647 GGGTTTGGGGAACAGCAAGGTGG - Intergenic
961540354 3:127595226-127595248 GGGTAGGAGAGACAGAAAGGTGG - Intronic
961783677 3:129336626-129336648 GGCTGGGACAAACAGAAAGGAGG - Intergenic
962023250 3:131522146-131522168 GGGTTCAAGGACCAGAAAGGAGG + Intergenic
962500227 3:135984036-135984058 GGATAGGATGAACAAAAAGGTGG - Intronic
962960052 3:140302800-140302822 GGGTTGGAGACAGAGAAAGGTGG + Intronic
963235796 3:142954270-142954292 GCTTTTGAAAAACAGAAAGGTGG + Intronic
963746405 3:149129229-149129251 GGGTTGCAAAAACTGAAATGGGG - Intergenic
963759154 3:149268852-149268874 AGGTAGGAAGGAAAGAAAGGAGG - Intergenic
965828416 3:172753651-172753673 GGGTTGGAAGACAAGATAGGTGG + Intronic
966117830 3:176486089-176486111 GGTTTGGAAAAACAGATAAGTGG + Intergenic
966458964 3:180153654-180153676 GGATGGGAAGTACAGAAAGTGGG - Intergenic
966904968 3:184515395-184515417 GGGTTTGAAGAACAGCAAGAAGG - Intronic
967168408 3:186804923-186804945 GGGCTACAAGAACAGAAAAGTGG + Intronic
967439769 3:189492937-189492959 GGGATGGAAGAATAGAAATTGGG + Intergenic
967924289 3:194633775-194633797 GGGGTGCAAGACCAGGAAGGAGG + Intergenic
968283403 3:197493959-197493981 AGGTTGGAAGAAAGGAAGGGTGG - Intergenic
968427719 4:534509-534531 GGGTTGGAAAAACAGGGTGGGGG + Intronic
968538430 4:1149855-1149877 GAGTGGGAAGAACAGAGAGTAGG + Intergenic
968763001 4:2451941-2451963 TGGGTGGACGCACAGAAAGGGGG + Intronic
968895344 4:3397610-3397632 GGGTGGGAGGAGCAGATAGGGGG + Intronic
970760140 4:19475828-19475850 GTGTTTGAAAAACAGCAAGGAGG + Intergenic
970919016 4:21370766-21370788 ATGTTGGAGGAACAGACAGGAGG + Intronic
971507882 4:27386286-27386308 ATTTTGGAAGAACAGCAAGGAGG - Intergenic
971552555 4:27975589-27975611 GGGTTGGTAGAAAAGGAAAGAGG - Intergenic
972415761 4:38838964-38838986 GGGGAGGAAGGAAAGAAAGGAGG + Intronic
972771899 4:42205059-42205081 GGGTTTGAAAGACATAAAGGAGG - Intergenic
972987422 4:44781073-44781095 GGGAAGGAAGGAAAGAAAGGAGG - Intergenic
973368233 4:49224973-49224995 GGGTTGGAAGTAAAAACAGGTGG - Intergenic
973392813 4:49570452-49570474 GGGTTGGAAGTAAAAACAGGTGG + Intergenic
975897932 4:79117498-79117520 GGGGTGGAAGAACAGGGAGTAGG - Intergenic
976011503 4:80494585-80494607 GGGTATGAAGAACTGAAAGGAGG - Intronic
976026915 4:80698981-80699003 GGGTTAGAAAAACAGCAAGAAGG + Intronic
976143265 4:82015333-82015355 GAGGAGGAAGAACAAAAAGGAGG + Intronic
976360600 4:84173961-84173983 TGGTTGGAAGAAAACAAAGTAGG - Intergenic
976380495 4:84393125-84393147 GGGTGGGAAGAAGAGAAGGAGGG + Intergenic
976452769 4:85210755-85210777 GGGTAGAAAGAGCAGAGAGGAGG - Intergenic
977257204 4:94754485-94754507 GGGGGAGAAGAATAGAAAGGAGG - Intergenic
977286385 4:95112598-95112620 TAGTTGGAAGACAAGAAAGGAGG - Intronic
978400971 4:108330355-108330377 GAGTGGGAAGAGCAGGAAGGAGG - Intergenic
978494673 4:109346448-109346470 GGGTTGGCAGACAAGAAAGACGG - Intergenic
979344187 4:119566833-119566855 GGCTTGGCAGCACAGCAAGGAGG + Intronic
979615271 4:122735131-122735153 GCGTTGGGAGCACAGAAAGGAGG + Intronic
980297798 4:130944817-130944839 CAGTTGCAAAAACAGAAAGGGGG + Intergenic
980889022 4:138794350-138794372 GAGTTGGGAGAAGAGAGAGGTGG + Intergenic
981434661 4:144706396-144706418 GGCAAGGAAGAAAAGAAAGGAGG + Intronic
982513636 4:156317133-156317155 GGGGTGTAAGAACAGAGAGTAGG + Intergenic
983501341 4:168503347-168503369 GAGTTTGAAAAACAGAAAGAGGG + Intronic
983709542 4:170696337-170696359 GGGTTGAAAGATCATAAACGAGG + Intergenic
984464945 4:180086584-180086606 TGCTTTTAAGAACAGAAAGGAGG + Intergenic
984532353 4:180932479-180932501 GGGTTGAAAGAACTGAAAGGAGG - Intergenic
984538260 4:181003646-181003668 GTGTTCGAAGAACAGAATGAAGG - Intergenic
1202765336 4_GL000008v2_random:144483-144505 GGGTTGGAAGTAAAAACAGGTGG - Intergenic
985549514 5:525863-525885 TGGATGGAAGGACAGATAGGTGG + Intergenic
985941863 5:3142637-3142659 GGGTTTTAAGGAGAGAAAGGAGG - Intergenic
987270902 5:16307975-16307997 GTGTTAGAAGAACAGAAAGCAGG - Intergenic
988524159 5:31971893-31971915 GTGTTGGAGAAACAGCAAGGAGG - Intronic
988555024 5:32229104-32229126 GGGCTGGCAGCACAGAAAAGAGG + Exonic
988656396 5:33216605-33216627 GGGGCTGAAGAACAAAAAGGGGG - Intergenic
988901851 5:35741422-35741444 GTGTTTGAAGAACAGCAAGGAGG + Intronic
990384455 5:55245960-55245982 GGTGTGGAAGACCAGCAAGGCGG + Intergenic
990494932 5:56337996-56338018 GGGGAGGAGGAACAGAAAGGAGG - Intergenic
990618933 5:57539043-57539065 GGAATGAAAGAAGAGAAAGGAGG + Intergenic
991136424 5:63187140-63187162 AGGGTGGAAAAAGAGAAAGGAGG - Intergenic
992015744 5:72573637-72573659 GGGTGAGAAAGACAGAAAGGAGG - Intergenic
992409717 5:76493337-76493359 GGGTGAGAGGAACAGCAAGGAGG - Intronic
992580395 5:78169380-78169402 TGTTGTGAAGAACAGAAAGGTGG - Intronic
993422535 5:87720200-87720222 GGGTTTGATTAACAGAAAGAAGG - Intergenic
993560271 5:89398284-89398306 GACTTGGAGGAACAGAAATGGGG - Intergenic
994008810 5:94875566-94875588 GGGTAGGAAGAAGAGTTAGGAGG + Intronic
994054326 5:95398857-95398879 GTGTAGCAGGAACAGAAAGGGGG + Intronic
994417986 5:99498987-99499009 GGGATTAAAGAACAGAAATGGGG + Intergenic
994461979 5:100076166-100076188 GGGATTAAAGAACAGAAATGGGG - Intergenic
994729127 5:103471272-103471294 GGGTTGTAAGATCAGTCAGGAGG - Intergenic
994846634 5:104996642-104996664 GGGTTACAAGAACAGATATGTGG - Intergenic
995161696 5:108992329-108992351 GGTTTTGTAGAATAGAAAGGGGG - Intronic
995682095 5:114731529-114731551 AGGTTGCAAGAACAGAATGGTGG + Intergenic
996024407 5:118628977-118628999 GGGAAGGAAGCAAAGAAAGGAGG + Intergenic
996101624 5:119450690-119450712 GGGGTGTAAGAACAGAGAGTAGG + Intergenic
996507491 5:124284737-124284759 TTGTTGGAAGAACAGCAAGTGGG + Intergenic
996849453 5:127936329-127936351 GGGTATGAAGAACAGGAAGCTGG + Intergenic
997115745 5:131124111-131124133 GGGATGAAAGAACAGGAAGTAGG - Intergenic
997702983 5:135917861-135917883 AGGTTTGAGGAACAGCAAGGAGG + Intergenic
998011824 5:138701489-138701511 GGGTTTGAGGAGCAGAAAGGAGG + Intronic
998176685 5:139905588-139905610 GGGGTGGGAACACAGAAAGGGGG + Intronic
998369563 5:141652001-141652023 GGGCTGGAAGATCCTAAAGGTGG - Intergenic
998435765 5:142107877-142107899 CTTGTGGAAGAACAGAAAGGAGG - Intergenic
998725487 5:145008455-145008477 GAGTTAGAGGAACAGAAGGGAGG - Intergenic
999527178 5:152419818-152419840 GAGGAGGAAAAACAGAAAGGAGG + Intronic
999657948 5:153828933-153828955 GGCTTGGAGGAAGAGAGAGGAGG - Intergenic
999681297 5:154062804-154062826 GTGTTAGAGGAACAGCAAGGAGG - Intronic
1000169711 5:158690145-158690167 GCAGTGGAAGAACAGAAAGAAGG - Intergenic
1000234189 5:159342393-159342415 GGGTTGGAGGAATGGAAAGGAGG + Intergenic
1000379412 5:160615363-160615385 GGGATGGAAGCACAAAAAGTAGG - Intronic
1001016873 5:168149835-168149857 GTGTTGGAAGGACAGAGAGGAGG - Intronic
1001434084 5:171685937-171685959 GGTTTTGAAGGACAGAAAGGAGG - Intergenic
1001563112 5:172683126-172683148 GGGATGGAAGAAGAGAAAGGAGG + Intronic
1001660748 5:173390904-173390926 GGCTTGGAGGAAAAGCAAGGTGG + Intergenic
1002177191 5:177407807-177407829 GGGATGGACGGACAGAGAGGAGG + Intronic
1002193454 5:177490440-177490462 GGGCAGGAGGAACAGAAAGAGGG + Intronic
1002313841 5:178330773-178330795 GGGGTGAAAGAGCAGAGAGGAGG - Intronic
1002375055 5:178782769-178782791 CGGTTGGAAAAACAGAAACGTGG + Intergenic
1003425398 6:5995386-5995408 GGGTTAGAAGGGAAGAAAGGTGG - Intergenic
1003510967 6:6780026-6780048 GACTGGGAAGAAGAGAAAGGAGG + Intergenic
1003533538 6:6956769-6956791 GAGTTGGAAGGACAGAGAAGTGG - Intergenic
1003598447 6:7495953-7495975 TGGTTTAAAGAACAGCAAGGAGG - Intergenic
1003653664 6:7986139-7986161 GGGTAGGGAGGACAGAGAGGCGG + Intronic
1003923329 6:10854254-10854276 GGGGTGTAAGAACAGAGAGTAGG - Intronic
1004111153 6:12720304-12720326 CTGTTGGCAAAACAGAAAGGGGG + Intronic
1004329798 6:14710947-14710969 GGGCTGGCAGAAGAAAAAGGGGG + Intergenic
1004460799 6:15834126-15834148 AGGTTGGCAGAGCAGAAAGGTGG - Intergenic
1004601638 6:17156084-17156106 GGGATGAAAGAAAAGGAAGGAGG - Intergenic
1005000507 6:21235521-21235543 GGGAGGGAAGAGAAGAAAGGAGG + Intergenic
1005374091 6:25164592-25164614 GGGGTGTAAGAACAGAGAGTAGG - Intergenic
1005418943 6:25629525-25629547 GGATGGGAAGGAAAGAAAGGAGG - Intergenic
1005559764 6:27026514-27026536 GTGTTAGAAAAACAGAAAGAAGG - Intergenic
1006297580 6:33176821-33176843 GGGTTGGAAGAAGTGTAGGGAGG - Intronic
1006337110 6:33426601-33426623 GGGTTGGGGGGGCAGAAAGGGGG - Intronic
1006516882 6:34550213-34550235 GGGTTGGAGGAGCAGAGAAGGGG - Intronic
1006765146 6:36498459-36498481 GGGGTCTCAGAACAGAAAGGTGG + Exonic
1007111590 6:39316123-39316145 GGGTTGGGAGAGGAGAAAGCAGG + Intronic
1007214983 6:40229856-40229878 GGTTTGCAATAAGAGAAAGGTGG + Intergenic
1007440847 6:41858591-41858613 GTGTTGGAAGAACAGTGAGGAGG - Intronic
1007589597 6:43013387-43013409 GGGCTGCAAGAACAGGGAGGCGG + Exonic
1008167219 6:48153099-48153121 GGGGTGCAAGAACAGAGAGTAGG - Intergenic
1008309508 6:49949480-49949502 GTGTTTGAATAAGAGAAAGGTGG + Intergenic
1008485507 6:52030681-52030703 GGGTGGGAAGATGAGAGAGGGGG + Intronic
1008573485 6:52837099-52837121 GGCTTTGAAGAGCAGAAAAGGGG - Intronic
1010473012 6:76252065-76252087 GTGTTCGAGGAACAGCAAGGAGG + Intergenic
1010704385 6:79090081-79090103 GGGAAGGAAGAAAGGAAAGGAGG - Intergenic
1010938443 6:81887957-81887979 TGGTGGAAAGAACAGAAAGTTGG - Intergenic
1011608574 6:89128625-89128647 GGGGTGTAAGAACAGAGAGTAGG - Intergenic
1012801475 6:103834571-103834593 GGCTAGGAAGTAGAGAAAGGAGG - Intergenic
1012848028 6:104414088-104414110 GGTATGGAGCAACAGAAAGGAGG + Intergenic
1012853761 6:104476799-104476821 AGGATGGAAGTACAGACAGGAGG - Intergenic
1013895912 6:115087765-115087787 GGGATAGAATACCAGAAAGGAGG - Intergenic
1014783009 6:125586516-125586538 GTTTTGGCAGAACAGAAAGGTGG + Intergenic
1015643450 6:135363502-135363524 GGTTTTGTAGAATAGAAAGGGGG - Intronic
1016371742 6:143381916-143381938 GGGATGGAGGAAGAGAAAGATGG + Intergenic
1017465305 6:154687793-154687815 GGTTTTGTAGAATAGAAAGGGGG + Intergenic
1017506393 6:155072533-155072555 GGTTTGGATGCACAGAAAGGGGG + Intronic
1017850754 6:158303422-158303444 GGGTTGTAAGAACAGGGAGTAGG + Intronic
1018205760 6:161436030-161436052 GGGATGGGAGGACAGAGAGGAGG + Intronic
1018580210 6:165301837-165301859 GGGAAGGAAGAAAAGAAAGGAGG - Exonic
1018653706 6:166012002-166012024 GTGTTGGAGAAACAGCAAGGAGG + Intergenic
1018691963 6:166353655-166353677 GGGATGGAAGGAAAGGAAGGAGG - Intergenic
1019288319 7:234686-234708 ACTTAGGAAGAACAGAAAGGCGG + Intronic
1019851289 7:3560802-3560824 AGGTTGGAGGAACAGGAAAGAGG - Intronic
1021404968 7:20254619-20254641 AGAATGGAAGAAAAGAAAGGAGG + Intergenic
1021466054 7:20944672-20944694 GTGTTGGAGGAACAGCCAGGAGG + Intergenic
1021488089 7:21188920-21188942 CCCTAGGAAGAACAGAAAGGAGG - Intergenic
1022967091 7:35483818-35483840 AGGTTTGAGGAGCAGAAAGGTGG + Intergenic
1023160791 7:37293259-37293281 GGTTTTGTAGAATAGAAAGGGGG + Intronic
1023603843 7:41909140-41909162 GGGGTGTAAGAACAGAGAGTAGG + Intergenic
1023996687 7:45162868-45162890 GGGATGGAAGAGCAGCAAGCAGG - Intronic
1024539043 7:50460590-50460612 GGTTTTGTGGAACAGAAAGGGGG + Intronic
1024598130 7:50956885-50956907 AGGTTGGGAGAGCAGAAAGGAGG - Intergenic
1025064109 7:55838488-55838510 GGGAAGGAAGAAAAGAAAGAAGG - Intronic
1025090925 7:56063986-56064008 CCATTGCAAGAACAGAAAGGAGG - Exonic
1025911483 7:65832286-65832308 GGGAGGGAAGAAAAGAAAGAAGG + Intergenic
1026862000 7:73797043-73797065 GGTTTTGTAGAATAGAAAGGGGG - Intergenic
1027821653 7:83053464-83053486 ATGTTGGAAGAAAAGAATGGAGG + Intronic
1028073109 7:86476990-86477012 GTGTTGAAAGAACATTAAGGAGG - Intergenic
1028568543 7:92260258-92260280 GTGTTCGAGGAACAAAAAGGAGG - Intronic
1028664608 7:93326594-93326616 GCTTTGGAAACACAGAAAGGAGG - Intronic
1028856227 7:95596749-95596771 GGGTGGGAAGAACAGGGAAGAGG + Intergenic
1029045573 7:97624501-97624523 GGGATGGAAAAACAGAGAGAGGG + Intergenic
1029354252 7:100039348-100039370 GGGATAGGAGAACAGCAAGGTGG + Exonic
1029444117 7:100603411-100603433 GGGTCTGGAGAACAGAAAAGGGG - Exonic
1029895163 7:103976016-103976038 GTGTTTGAAGAACAAAAAAGAGG + Intronic
1031106800 7:117553944-117553966 TGGTTTGAAGAACAGTAAGGAGG + Intronic
1031440428 7:121788061-121788083 GGGTTGGTACAACAGGAAAGTGG + Intergenic
1031990426 7:128194570-128194592 GAGTTTGAAGAACAGCAAGGAGG + Intergenic
1032756281 7:134893628-134893650 GGCCTTGCAGAACAGAAAGGAGG - Intronic
1033142292 7:138838330-138838352 GGCTGGGGAGAACAGAAGGGAGG + Intronic
1034297211 7:149984770-149984792 GGGTAGGAAGCTGAGAAAGGTGG - Intergenic
1034580746 7:152039987-152040009 CAGTTGCAAAAACAGAAAGGGGG - Intronic
1034808817 7:154112074-154112096 GGGTAGGAAGCTGAGAAAGGTGG + Intronic
1034822298 7:154227393-154227415 GGGTTGGGAGAAGGGAAAGTGGG + Intronic
1035339391 7:158150849-158150871 GGGTTGGAAGAACAGAAAGGAGG - Intronic
1035339709 7:158152436-158152458 GGGTTGGAAGAACAGACAGGAGG + Intronic
1035600600 8:894823-894845 GGGTGGGGAGAACAGAGTGGAGG + Intergenic
1035998982 8:4580572-4580594 GAGATGGAAGAGGAGAAAGGAGG - Intronic
1036416677 8:8555803-8555825 GGGTTTGAAAAACAGAAACATGG + Intergenic
1036524530 8:9522305-9522327 GGCTTAGAAAAACAGAAATGTGG - Intergenic
1036748845 8:11430312-11430334 GGCTTGGAAGAAGGGAAGGGCGG + Intronic
1037483350 8:19325488-19325510 GAGTTGGGGGAACAGAAAAGTGG - Intronic
1037774368 8:21823237-21823259 GGGGAGGAAGAACAGAAGGCAGG - Intergenic
1038223884 8:25636647-25636669 GGGTTTGAGGAGCAGCAAGGAGG - Intergenic
1038670400 8:29578382-29578404 GTGTGGAAAGAAAAGAAAGGAGG - Intergenic
1038681195 8:29670112-29670134 GGCTTAGAAGAACAGAAATGTGG + Intergenic
1039151360 8:34510155-34510177 AGGTTTGAAGAGCAGAAATGAGG - Intergenic
1040480372 8:47820530-47820552 TTATTGGAAGAACAGAAAGAAGG + Intronic
1040997560 8:53417492-53417514 AGGATGGAAGGACAGAAAGATGG + Intergenic
1041144798 8:54862635-54862657 GTGATGGAAGAATAGCAAGGTGG - Intergenic
1041206223 8:55500578-55500600 GGGTTGGAAGAGGACAGAGGAGG - Intronic
1041237670 8:55820838-55820860 GGGTAGGAAGGACAGAGAGAGGG - Intronic
1041814811 8:61958259-61958281 GGGTTGAGAGAGGAGAAAGGTGG - Intergenic
1042067965 8:64899727-64899749 TGGTGGGAAGAACATAAAGATGG + Intergenic
1042416554 8:68527177-68527199 GTGTTCAAAGAACACAAAGGGGG - Intronic
1042747472 8:72122806-72122828 GAGTTGCAGGAACAAAAAGGAGG - Intergenic
1042805287 8:72764421-72764443 GGGTTGGAAGAGCTGAAAGAGGG + Intronic
1043777257 8:84285719-84285741 ATGTTGGAGGAATAGAAAGGAGG + Intronic
1044149035 8:88751315-88751337 GTCCTGGAAGAGCAGAAAGGAGG - Intergenic
1044646458 8:94448741-94448763 TGGTTACTAGAACAGAAAGGTGG + Intronic
1044744457 8:95358496-95358518 TGTTTGGGAGAAGAGAAAGGGGG + Intergenic
1045047867 8:98296172-98296194 GGGATAGCAGAGCAGAAAGGTGG - Intergenic
1045434542 8:102148682-102148704 GGATAGGAGGAACAGGAAGGAGG + Intergenic
1045623175 8:104006577-104006599 GGGGTAGCAGAACAGAAAGAAGG - Intronic
1045906721 8:107354827-107354849 GGCTTGGATGAACAGATAGGTGG - Intronic
1046271121 8:111899003-111899025 GGGGTGGGAGTACAGAATGGAGG - Intergenic
1046830656 8:118742304-118742326 GAGTTGGAAGAACAGAGAGAAGG + Intergenic
1046960696 8:120110138-120110160 GGGATGTCAGAACAGCAAGGAGG - Intronic
1047311557 8:123696719-123696741 GGGTTGGAAGGAGAAAAGGGAGG - Intronic
1048235774 8:132688687-132688709 GGGAGAGAAGAACAAAAAGGTGG + Intronic
1048239169 8:132724032-132724054 GGGGTGCAAGAACAGCAAGTAGG + Intronic
1049049782 8:140185503-140185525 GGGTAGGTAGAACAGCAAGGTGG - Intronic
1049989947 9:981364-981386 GGCTAGGAAGAAAAGAAAAGCGG + Intronic
1050089805 9:2006196-2006218 GTGTTGGAAGGAAGGAAAGGAGG - Intergenic
1050212036 9:3271464-3271486 GGGAAGGAAGGAAAGAAAGGAGG - Intronic
1050416331 9:5421182-5421204 GAGTTGGAAGAACAGCAAAGAGG - Intronic
1050418590 9:5439139-5439161 GAGCTGGGAGAACAGAGAGGTGG - Intergenic
1051990854 9:23151156-23151178 AGGTAGGAAGAAAAGAAAGATGG - Intergenic
1052284775 9:26772606-26772628 GGGCTCGAGGAACAGAATGGAGG + Intergenic
1052517356 9:29500569-29500591 GAGTTCGAAGAACAGAGAGAGGG - Intergenic
1052520470 9:29541520-29541542 AGGCAGGAAGAGCAGAAAGGAGG - Intergenic
1052605224 9:30690126-30690148 GGGTTGGCAGACAAGAAAGAGGG + Intergenic
1052673767 9:31592975-31592997 AGGGTGGGAGAACAGAAGGGTGG - Intergenic
1052972576 9:34385973-34385995 GCCTTGGATGAAAAGAAAGGAGG - Intronic
1053010857 9:34632319-34632341 GTGTTGGAAGAAAAGCAAGGAGG + Intergenic
1053663639 9:40301954-40301976 GGGTTGGAAGTACAAAGAGGTGG + Intronic
1053891601 9:42698535-42698557 CTGTTGTAAGCACAGAAAGGAGG - Intergenic
1053914153 9:42932496-42932518 GGGTTGGAAGTACAAAGAGGTGG + Intergenic
1054375763 9:64448187-64448209 GGGTTGGAAGTACAAAGAGGTGG + Intergenic
1054520976 9:66074331-66074353 GGGTTGGAAGTACAAAGAGGTGG - Intergenic
1054762002 9:69012467-69012489 GGGGTGGAAGTAGAGGAAGGAGG + Intergenic
1054773402 9:69104063-69104085 GGTTTTGTAGAATAGAAAGGGGG - Intergenic
1055138505 9:72850877-72850899 GGTTTTGTAGAATAGAAAGGCGG - Intergenic
1055839226 9:80482632-80482654 GGGTAGAAAGAACAGGAAGGAGG - Intergenic
1056817310 9:89811397-89811419 GGGCTGGAAGTACAGACATGGGG + Intergenic
1056980640 9:91307884-91307906 AGGGTGGGAGAAGAGAAAGGTGG + Intronic
1057891723 9:98874793-98874815 GAGCTGGAAGAGGAGAAAGGAGG - Intergenic
1059181777 9:112221736-112221758 TAGTTGGTAGAATAGAAAGGAGG - Exonic
1060128979 9:121076717-121076739 GGGTGGGCAGCACAGAATGGGGG + Intronic
1060845184 9:126831278-126831300 AGGGTGGGAGAACAGAATGGTGG - Intronic
1061265108 9:129500327-129500349 GGGCTGGTGGAACACAAAGGGGG + Intergenic
1061643238 9:131976906-131976928 GGTTTGGGAGAGCAGAAAGGGGG - Intronic
1062506964 9:136882529-136882551 GGGTTGCAGGAGCAGGAAGGAGG - Intronic
1203546085 Un_KI270743v1:129372-129394 GGGTTGGAAGTAAAAACAGGTGG - Intergenic
1185762706 X:2700837-2700859 TGGATGGATGAACAGATAGGTGG - Intronic
1186728756 X:12385172-12385194 GGTATGGAAGCACAGTAAGGTGG + Intronic
1187005143 X:15225381-15225403 AGGTTGGAAGAACAGATATTGGG - Intergenic
1187154540 X:16711596-16711618 GGGGTGGATTGACAGAAAGGAGG + Exonic
1187183355 X:16964483-16964505 GGTTTTGTAGAATAGAAAGGGGG - Intronic
1187261755 X:17691195-17691217 GGTTAGGAAGAAGTGAAAGGAGG - Intronic
1187506393 X:19881778-19881800 GGGGTGGAAGAAAAGAAGGGAGG + Intronic
1188330920 X:28870745-28870767 GGGTTAGTAGAACACATAGGTGG - Intronic
1188785457 X:34340300-34340322 GGATGGGAAAATCAGAAAGGAGG + Intergenic
1189136581 X:38556875-38556897 TTGTTTGAAGAACAGAAAGAAGG + Intronic
1189532011 X:41894638-41894660 GGGTGGGAGGTAGAGAAAGGAGG + Intronic
1189549986 X:42083053-42083075 GGGAGGGAAGAGCAGAGAGGTGG + Intergenic
1190065715 X:47240562-47240584 GGGTTGGAGAAAGAGAAAGAAGG - Intronic
1190154107 X:47973727-47973749 GGATTGGAGGAAGAGAGAGGAGG - Intronic
1190736441 X:53258504-53258526 GGGTTGGAAGAGGAGATCGGAGG - Intronic
1191175648 X:57498459-57498481 GGGGGGGAAGGACGGAAAGGGGG - Intergenic
1191609904 X:63101550-63101572 GGGCTGAAGGAACAGAAAGCTGG + Intergenic
1192326242 X:70134503-70134525 CGGCTGGAAGAGCAAAAAGGAGG - Exonic
1193308506 X:79977174-79977196 GGGTTGGAAAAAAAAAAATGTGG + Intergenic
1193380090 X:80808603-80808625 GGGCCGGACGAAAAGAAAGGGGG + Intronic
1194087561 X:89547688-89547710 GGGTTAGGAGAAAAGAAAGAAGG + Intergenic
1194562200 X:95436409-95436431 GTGAGGGATGAACAGAAAGGTGG + Intergenic
1195804416 X:108747501-108747523 ATGTTGGAGGAACAGAAAGAAGG + Intergenic
1196021635 X:110997109-110997131 ATGTTTGAAGAACAGCAAGGGGG + Intronic
1196045251 X:111249877-111249899 AGGTAGGAAGAAAAGAAGGGAGG + Intronic
1196073703 X:111551635-111551657 GTGTTGGAAGAACAGCAGGAAGG - Intergenic
1196635545 X:117998418-117998440 GGGTTGGAATAACAGGAAATTGG + Intronic
1197005980 X:121498931-121498953 GGGAAGGAAGAACTGAAATGAGG + Intergenic
1197079177 X:122391883-122391905 GGGCTGGAACAGCAGAAAGTAGG - Intergenic
1197719961 X:129738538-129738560 GGGGAGGAAGAGCAAAAAGGAGG + Intergenic
1197784749 X:130188475-130188497 GTGTTTGAGGGACAGAAAGGGGG + Intergenic
1198368405 X:135967024-135967046 GGGATGGAAGGAGTGAAAGGGGG + Intronic
1198462177 X:136874274-136874296 GGGTTGGCAGACAAGAAAGAGGG - Exonic
1198532441 X:137559789-137559811 GGGTTGGAGGGACAGAGAGATGG - Intergenic
1198810781 X:140534175-140534197 GAGGTGGAAGAAGAGGAAGGAGG + Intergenic
1198824314 X:140683275-140683297 GGGGTGTAAGAACAGGAAGTAGG - Intergenic
1199577247 X:149324243-149324265 GGGTTGAATGAATAGAATGGAGG - Intergenic
1199941049 X:152628209-152628231 GGGTGGGAATGACAGGAAGGAGG + Intergenic
1199981212 X:152921451-152921473 GTGTTGGAAGACCAGGAAGTTGG + Intronic
1200440206 Y:3203558-3203580 GGGTTAGGAGAAAAGAAAGAAGG + Intergenic
1200838244 Y:7753977-7753999 GGGTTGTAAGAACAGAGAGTAGG - Intergenic
1201330996 Y:12821183-12821205 GGGTAGGAAGAAGAGAAAAGTGG - Intronic
1201637614 Y:16142770-16142792 GAGGAGGAAGAACATAAAGGCGG - Intergenic
1202211316 Y:22454369-22454391 GGGTTGGGAGACAAGAAAGAAGG - Intergenic