ID: 1035339392

View in Genome Browser
Species Human (GRCh38)
Location 7:158150852-158150874
Sequence GTTGGGTTGGAAGAACAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 305}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035339392_1035339398 1 Left 1035339392 7:158150852-158150874 CCTTTCTGTTCTTCCAACCCAAC 0: 1
1: 1
2: 1
3: 26
4: 305
Right 1035339398 7:158150876-158150898 TGCTGGTGGAATTATCCTACTGG 0: 1
1: 0
2: 0
3: 7
4: 120
1035339392_1035339399 15 Left 1035339392 7:158150852-158150874 CCTTTCTGTTCTTCCAACCCAAC 0: 1
1: 1
2: 1
3: 26
4: 305
Right 1035339399 7:158150890-158150912 TCCTACTGGTTTGCAGCAAATGG No data
1035339392_1035339401 16 Left 1035339392 7:158150852-158150874 CCTTTCTGTTCTTCCAACCCAAC 0: 1
1: 1
2: 1
3: 26
4: 305
Right 1035339401 7:158150891-158150913 CCTACTGGTTTGCAGCAAATGGG 0: 1
1: 0
2: 0
3: 9
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035339392 Original CRISPR GTTGGGTTGGAAGAACAGAA AGG (reversed) Intronic
901137261 1:7005990-7006012 TTGGTGTTGGAAGAACAGAGAGG + Intronic
901880301 1:12189941-12189963 GGTGAGTTGGAGGAACAGCAGGG + Intronic
902126737 1:14220303-14220325 ATTTGGTTGGAAGAAGAAAATGG - Intergenic
902500072 1:16904908-16904930 GGTGGGGCGGAAGAACAGAAGGG + Intronic
904504066 1:30936309-30936331 GGTGGGATGAAAGAACAGAAGGG + Intronic
904509862 1:30995503-30995525 TTTGGGTAGGAAGAAAAAAAAGG - Intronic
904702052 1:32363550-32363572 GATGGGCTGGCAGATCAGAAAGG - Intronic
904939749 1:34157414-34157436 GTTGAGTTGGAACAAGAGACTGG - Intronic
905313440 1:37066184-37066206 GGTGGGTTCAAAGAACAGCAAGG - Intergenic
905538668 1:38743025-38743047 GTTGAGTTAGAAGAACACAATGG + Intergenic
905975621 1:42171659-42171681 GGTGGATTGGAAGCATAGAATGG + Intergenic
906040040 1:42781698-42781720 GGTGTGTGGGAAGAACAGCAAGG - Intronic
907643134 1:56212857-56212879 GTTGGGTGGAAAGAAGTGAATGG - Intergenic
907659069 1:56375203-56375225 TTTGAGTTAGATGAACAGAAAGG + Intergenic
909996178 1:82282392-82282414 GTTGGGTTGGAGGAAAACATGGG + Intergenic
910532439 1:88253398-88253420 GTTGGGTTGGAAGGACTGACTGG - Intergenic
910626314 1:89311875-89311897 GTTGAGTTGGGTGTACAGAAGGG + Intergenic
912506500 1:110160465-110160487 GTTGGGTAGGAAGCAGTGAAGGG + Intronic
914004541 1:143720913-143720935 GGTGGGGCGGAAGAACAGAAGGG - Intergenic
914096955 1:144552195-144552217 GTTGGGGTGGAAGAGCAGACGGG - Intergenic
915389613 1:155530000-155530022 GTTGTGTTTGAGAAACAGAAGGG - Intronic
915520325 1:156438326-156438348 GTGGGGTTGGACAGACAGAAAGG - Intergenic
916445793 1:164870718-164870740 GTTTGGCTAGAATAACAGAATGG - Intronic
917387157 1:174490411-174490433 GTTGGTTTGGAAGAAAGCAAGGG - Intronic
918824514 1:189306124-189306146 GATGGGGGGGAAGAAAAGAATGG - Intergenic
919471684 1:197987091-197987113 GTTGAGTTGGATAAACAGCAGGG + Intergenic
921506129 1:215972481-215972503 GAAGGGCTGGAAGAACAAAAGGG - Intronic
921588847 1:216980039-216980061 ATTGGGTAGAAAGAAAAGAAAGG - Intronic
921825859 1:219671178-219671200 GGTGGGTTGGAAGAAGAGCAGGG + Intergenic
923008300 1:230068530-230068552 GTTGGGTTGGAACAAGAGAGTGG + Intronic
923669215 1:236025703-236025725 CTTTGGTTAGAAGAACAGACAGG + Intronic
924735071 1:246748495-246748517 GATGGCTTGGGAAAACAGAATGG - Intronic
924945850 1:248846577-248846599 CTTGGGCTGGAAGAACAAAGCGG - Intronic
1063112355 10:3047981-3048003 GGTGGGTTGGCAGAAGAGGATGG - Intergenic
1063900543 10:10728035-10728057 CTTGGGTTGGGAGAAGAGAGAGG + Intergenic
1065815850 10:29481742-29481764 GGGGGGTTGGGAGAACAGACAGG + Intronic
1067362487 10:45595016-45595038 GAAGGGGTGGAAGCACAGAAAGG - Intergenic
1067530585 10:47068823-47068845 GTTGAGTTGGGGGAAAAGAAGGG - Intergenic
1069247342 10:66222512-66222534 GTTGGGAAGGAAGGAAAGAAGGG + Intronic
1069605017 10:69733373-69733395 GGTGAGTTGGAGGAACTGAAAGG + Intergenic
1072005849 10:91246125-91246147 ATTGGGCTGGAAGGACAGAAAGG + Intronic
1072850833 10:98889896-98889918 CCTGGGTGGGCAGAACAGAATGG + Intronic
1073008306 10:100341177-100341199 GTTGGCTTAGAGGCACAGAATGG + Intergenic
1074594132 10:114844656-114844678 GCTGGGATGGAAGAAAAGAACGG - Intronic
1076307470 10:129475168-129475190 GGTGTGTTGGAAGCACAGATGGG + Intronic
1076795638 10:132796936-132796958 GGCGGGTGGAAAGAACAGAAAGG - Intergenic
1076837360 10:133027921-133027943 GGTGGGCTGGGAGAGCAGAAAGG - Intergenic
1077404138 11:2375276-2375298 GTGAGGTTGGAGGAACACAAGGG - Intergenic
1077837421 11:5937038-5937060 TTTGGGATGGAGTAACAGAACGG - Intronic
1079240314 11:18717871-18717893 GTCGGGTTGGAAGAGAGGAATGG - Intronic
1080438470 11:32268384-32268406 GATGGGTTGGTGGAAAAGAAGGG + Intergenic
1080968224 11:37239385-37239407 GTTTGGTGGGAAGAAAAGATAGG - Intergenic
1085300616 11:75456210-75456232 GATGGGTTGGGAGATCAGCAGGG + Intronic
1085320698 11:75572194-75572216 GTGGGGGTGGAAAAACAGACCGG + Exonic
1085415474 11:76316600-76316622 CTTGCCTTGGAAGAACAGGAGGG + Intergenic
1085634501 11:78147957-78147979 GTGTGGTTGGCAGAACAAAAAGG - Intergenic
1086272596 11:85085232-85085254 GTTGAGTTGGGATAACAGTATGG - Intronic
1086293885 11:85343198-85343220 GTTGGGTTAAAAGAACACAATGG - Intronic
1087625057 11:100586581-100586603 GGTGGGATGGAAGAACACAGAGG - Intergenic
1087625578 11:100592396-100592418 GGTGGTATGGAAGAACAGAGGGG + Intergenic
1087841860 11:102928610-102928632 GATAGGTGGGAAGAACAGAAAGG + Intergenic
1088672016 11:112151027-112151049 GCTGGGTTGATAGAAGAGAAAGG - Intronic
1089160127 11:116430833-116430855 GTTGGGTTTCAATAACTGAATGG + Intergenic
1089670696 11:120054882-120054904 GTTGGGTTGCAGGACAAGAATGG + Intergenic
1089970140 11:122686682-122686704 GTAGGGTAGGAAGAAGAGACAGG - Intronic
1091061588 11:132468081-132468103 GCTGGGTTGGAAGCCCAGATAGG - Intronic
1091301862 11:134513093-134513115 GTTGGGTTGGAAGAAGATTTTGG - Intergenic
1093618926 12:21264261-21264283 GTTTTGAAGGAAGAACAGAAGGG - Intergenic
1094042697 12:26134280-26134302 GTTGAGTAGGAGGAAGAGAAGGG - Intronic
1094771340 12:33663939-33663961 GGTGGCTTGGAAGAAAAGAAAGG + Intergenic
1095823701 12:46509054-46509076 TTTGGGTTGGAAGAGGAGGAAGG - Intergenic
1096496242 12:52040920-52040942 GAGGGGATGGAAGAAGAGAAGGG + Intronic
1097738717 12:63212845-63212867 GTAGTGTTGGAAGTAGAGAAAGG - Intergenic
1098284907 12:68897072-68897094 GTGGGGTTGCAAGAGGAGAAAGG - Intronic
1098535792 12:71592342-71592364 CTTGGGTTGCTATAACAGAATGG - Intergenic
1098544632 12:71698189-71698211 GATGGGTAGAAAGAAAAGAAGGG - Intronic
1100618711 12:96251084-96251106 GTGCTGTTGGAAGAACAGACTGG - Intronic
1101375074 12:104164538-104164560 GTTGGGTAAGCAGAACCGAAAGG - Intergenic
1101646451 12:106634917-106634939 GTTTGGTTGGGAAAAGAGAAAGG - Intronic
1102770530 12:115472134-115472156 ACTGGCTTTGAAGAACAGAAGGG + Intergenic
1103236774 12:119379462-119379484 GTTGGGTTACAGGAACAAAAAGG + Intronic
1105883775 13:24625105-24625127 GTTTGGTGGGGAGAACAGACAGG + Intergenic
1106041077 13:26094141-26094163 GTTGGATGGGAAAATCAGAATGG + Intergenic
1111830511 13:93323433-93323455 GTTTGGATGGCAGAAAAGAAAGG - Intronic
1112049653 13:95632774-95632796 GATGTGTTTGAGGAACAGAAGGG - Intronic
1115267994 14:31521366-31521388 GTGGGGTTGGATGAACAGAATGG + Intronic
1117057379 14:51926766-51926788 GTTGGGTGGAAAGAAAAAAAAGG - Intronic
1117705608 14:58464110-58464132 GCTGGGCTGGAAGAACTGGAAGG + Intronic
1118143899 14:63115485-63115507 CTTGGGTTGGTTGAACTGAATGG + Intergenic
1118475087 14:66109151-66109173 GTGGGGCAGGAAGGACAGAAGGG + Intergenic
1119101629 14:71885129-71885151 GGTGGGTTGGAAGAATGGACAGG - Intergenic
1121482194 14:94287739-94287761 GGTGGGTTTGAAGAACATCAAGG - Intronic
1124841915 15:33250142-33250164 GTTGTGTTGAAAGAAGAAAAGGG - Intergenic
1125153581 15:36561817-36561839 GTTGGGCTGCCAGAACAGACTGG - Intergenic
1126110753 15:45173494-45173516 GTTGGGTTGGAGGAGCTGAGAGG - Intronic
1126282076 15:46965200-46965222 GTTGTGTTTGAAAAACTGAAAGG + Intergenic
1127672972 15:61213197-61213219 GTGGAGTTGGAAGAACATGATGG - Intronic
1129143255 15:73622327-73622349 CTTGGTTTGGAAGAAGAAAAAGG - Intronic
1130698420 15:86154634-86154656 GTCTGGTTGGAAGAAAAGCATGG + Intronic
1131056632 15:89378872-89378894 GTTGGGTAGGCAGGAGAGAAGGG + Intergenic
1133298878 16:4769482-4769504 GGTGCGTTTGAGGAACAGAATGG + Intergenic
1133631435 16:7625775-7625797 GATGGGAAGGAAGAAAAGAAAGG - Intronic
1133713077 16:8420225-8420247 GTAGAGTTGGAAGCAAAGAAGGG + Intergenic
1135861554 16:26060315-26060337 GTAAGGTGGGAAGAACAGTAAGG + Intronic
1137223111 16:46474945-46474967 TCTGAGTAGGAAGAACAGAATGG + Intergenic
1137992219 16:53169942-53169964 GTTAGGATGGAACAACAGAAAGG - Intronic
1138544380 16:57706954-57706976 GTGGAGTTGGAAGAAGAGATGGG - Intronic
1140181995 16:72729386-72729408 GCTGGCTCGGAAGAACAGAGAGG + Intergenic
1140576083 16:76170435-76170457 GTGGGGTAGGAAGGAAAGAAAGG + Intergenic
1143069357 17:4277490-4277512 GTGGGGTAGGAAGAATAGAGAGG - Intronic
1143505979 17:7365589-7365611 GTTGGGGTGACAGAACAGGAAGG + Intergenic
1144839758 17:18178693-18178715 TTGGGGTGGGAAGTACAGAATGG - Intronic
1146909251 17:36637751-36637773 GGTGGGGTGGAAGAAAAAAATGG - Intergenic
1147331998 17:39704831-39704853 GTTGGGCTGGAGGGTCAGAACGG - Intronic
1148256716 17:46140050-46140072 GTTGGGATGGAGGAAGGGAAGGG - Intronic
1148475127 17:47923566-47923588 TTAAGGTTGGAAGAAAAGAAGGG + Intronic
1148761979 17:50009182-50009204 GGTGAGTTTGAAGAACAGCAAGG + Intergenic
1149177900 17:53896501-53896523 GTTGGATTGGGAGAACATATTGG - Intergenic
1149206120 17:54250495-54250517 GCTGGGTTGGAACATGAGAATGG + Intergenic
1149265790 17:54926063-54926085 TGTGGGTTGGTGGAACAGAAAGG - Intronic
1150990277 17:70249681-70249703 GTTGGGTTGGGTCAACAGTATGG - Intergenic
1153551054 18:6262179-6262201 GTTGGGAGGGGAGAACAGAGTGG - Intronic
1154178426 18:12106857-12106879 GTGGGGCTTCAAGAACAGAAAGG - Intronic
1155516330 18:26626885-26626907 GGTGGATTACAAGAACAGAAAGG + Intronic
1156108314 18:33692381-33692403 CTTGGGTTTGAGGAACAGAAAGG - Intronic
1156301405 18:35839622-35839644 GATGGCTTGAAAAAACAGAATGG + Intergenic
1156798427 18:41077415-41077437 GATGGATTAGAAGAAAAGAATGG + Intergenic
1157311100 18:46553927-46553949 GTTGGGTTCAAGGAACAGCAAGG + Intronic
1161243045 19:3233623-3233645 GGTGTGTTGGAGGAACAGCAAGG + Intronic
1161301614 19:3545430-3545452 GTTGTGTTGGAAGAACAGGGAGG - Intronic
1161488316 19:4547847-4547869 GGTGTGTTGGAAGAACAGCAAGG - Intronic
1161643105 19:5436475-5436497 GAGGGGTGGGAAGAGCAGAAGGG - Intergenic
1161646210 19:5454954-5454976 GGTGTGTTGGAGGAACAGCAAGG + Intergenic
1161756416 19:6137415-6137437 GGTGAGTTGGAAGAACAGTGAGG + Intronic
1161760588 19:6168208-6168230 GGTGTGTTGGAGGAACAGCAAGG - Intronic
1161871937 19:6876990-6877012 GTGGGGGTGTAAGAACAGGAAGG - Intergenic
1165769678 19:38371961-38371983 GTTGGGTTGGAGGAATACATTGG + Intergenic
925766521 2:7241651-7241673 GTTGGGTAGAAAGAAGAAAAAGG - Intergenic
926763944 2:16305830-16305852 GTAGGGGTTGAAGAACAGAGGGG + Intergenic
927688661 2:25191604-25191626 GCTGGGTTGGAGGAACAGTGAGG + Intergenic
928674356 2:33635725-33635747 GGTGCCTTGGAAGAACAGGAGGG + Intergenic
930070691 2:47363626-47363648 GGTATGCTGGAAGAACAGAAAGG - Intronic
930149352 2:48042926-48042948 ATTGGGCTCAAAGAACAGAATGG - Intergenic
931835245 2:66092306-66092328 GTTGGGTTGAGAGAGCAGATTGG + Intergenic
932413177 2:71559126-71559148 GCTGGGCTGGAGGAACAGAGTGG - Intronic
934941818 2:98508256-98508278 GTTTGGGTGGAAGAAGAAAAGGG + Intronic
935785124 2:106541834-106541856 GTGGAGTTGGAAGGATAGAAGGG - Intergenic
938531805 2:132195061-132195083 GATGGGTTAGTAGAACAAAATGG + Intronic
939357969 2:141128511-141128533 GGTGCGTTGGAAGAACAGTAAGG - Intronic
939762913 2:146206707-146206729 GTAGAGTTGGATGAAGAGAAAGG - Intergenic
940399842 2:153235653-153235675 AAGGGGGTGGAAGAACAGAAGGG - Intergenic
940838775 2:158554891-158554913 GTTAGGTAGCAAGAACAGCAGGG + Intronic
942431770 2:175919550-175919572 CTGGAGTTGGAAGAAGAGAATGG - Intergenic
942886118 2:180926208-180926230 GTGGTGTTGGAGGAAAAGAAGGG + Intergenic
943548637 2:189311756-189311778 GCTGGCTTGGAAGAACCGAGAGG - Intergenic
944065291 2:195613165-195613187 GGTGGGGTGGGGGAACAGAAGGG - Intronic
946960454 2:224979566-224979588 GGAGTGTTAGAAGAACAGAAAGG - Intronic
947460371 2:230299049-230299071 GATGGGTTTGGAGAACAAAATGG + Intronic
948595365 2:239076187-239076209 GTTGGGTTGGAACAGCAGGCGGG + Intronic
1169038445 20:2472468-2472490 GCTGGGTTTGAGGAACAGCAAGG - Intronic
1169455310 20:5747508-5747530 GTTTGGTGGGAAAAGCAGAAAGG + Intergenic
1170464665 20:16611689-16611711 TTGGGGTTGGAACTACAGAATGG + Intergenic
1170894710 20:20402896-20402918 GGTGGGCAGGAAGAACAGGAAGG - Intronic
1174530522 20:51209226-51209248 TTTGAGTAGGAAGAACACAAGGG - Intergenic
1176035250 20:63033120-63033142 GTTGGGTACGAAGGACTGAAAGG - Intergenic
1176427639 21:6558649-6558671 CTTGGCTTGGAAGAAGGGAAGGG - Intergenic
1176907922 21:14526231-14526253 GGTTGTTTGGAAGTACAGAAAGG + Intronic
1178850874 21:36211045-36211067 GCTGGGCTTGAAGAACAGGAAGG - Intronic
1179010640 21:37553338-37553360 GTTGGGTTGGGGGAGAAGAATGG + Intergenic
1179703131 21:43166966-43166988 CTTGGCTTGGAAGAAGGGAAGGG - Intergenic
1181782473 22:25202989-25203011 CTGAGGTTGGAAGAACAGCAAGG + Intronic
1181878642 22:25959858-25959880 GTTGGGTTGAAAGGGCAGCAGGG - Intronic
1184448378 22:44567731-44567753 GCTGGCTTGGAAGAACGGAGAGG + Intergenic
949544403 3:5060303-5060325 GGAGGGTTGAAATAACAGAATGG + Intergenic
949761754 3:7478679-7478701 GTTGGGTATGTAGAACAGTAGGG + Intronic
949939497 3:9143903-9143925 GTTGGGCTGGTAGAACGGATAGG - Intronic
950114691 3:10443234-10443256 GCTGGGGAGGAAGATCAGAAAGG - Intronic
950890507 3:16400234-16400256 GTTTGGTTTGAGGAGCAGAAGGG - Intronic
952139987 3:30467209-30467231 GTTGGAGTGGCAGAACAAAATGG - Intergenic
952600170 3:35070497-35070519 CTTGGGAAGGAAGAAAAGAATGG - Intergenic
953975995 3:47381849-47381871 ACTGTGTTGGAAGAACAGACGGG + Intronic
953998319 3:47537116-47537138 GTGGGGTTGGGAGAAGAGGAAGG + Intergenic
954252669 3:49380230-49380252 GTGGGGCTGGAAGAACCAAAAGG + Intronic
955675530 3:61444338-61444360 GGAGGGAGGGAAGAACAGAAGGG - Intergenic
955713653 3:61805750-61805772 GTGTGATTGGAAGGACAGAAGGG + Intronic
955728410 3:61958017-61958039 GTTTGCTTGGAAGAATAAAAAGG - Intronic
956203619 3:66733261-66733283 GGAGGGTTGGGAGAAAAGAATGG + Intergenic
956547698 3:70423734-70423756 GGGGGTTAGGAAGAACAGAATGG + Intergenic
956853922 3:73257394-73257416 GACCTGTTGGAAGAACAGAAAGG - Intergenic
956929572 3:74027829-74027851 GTTGGGTTAGAACAAAAGAATGG + Intergenic
960659774 3:120044763-120044785 AATGGCTTGGAAAAACAGAATGG + Intronic
962302367 3:134253626-134253648 GGTTTGTTGGAAGAACAGAAAGG - Intergenic
963388828 3:144631913-144631935 GTTGGTTTTGAAGAACAAAGGGG + Intergenic
963619366 3:147586274-147586296 GTGGTGTGGTAAGAACAGAATGG + Intergenic
964317254 3:155457567-155457589 GTTAAATAGGAAGAACAGAAAGG - Intronic
968427716 4:534506-534528 TTTGGGTTGGAAAAACAGGGTGG + Intronic
968823879 4:2878398-2878420 GATGGGGTGGAAGAAGTGAAAGG + Intronic
969570025 4:8002777-8002799 CGTGGGTTGGAAGAACAGTGAGG - Intronic
969961771 4:10951996-10952018 GTGGGGCGGGAGGAACAGAAAGG - Intergenic
970950484 4:21749746-21749768 TTTGGGTAGAAAGAACAGCAGGG + Intronic
973079369 4:45970806-45970828 GTGGGGATGGAATACCAGAAAGG + Intergenic
975469262 4:74746442-74746464 GTTAGGTAGCAACAACAGAAGGG - Exonic
975556601 4:75672396-75672418 GTTGGGATGGGGGGACAGAAAGG - Intronic
976127354 4:81848297-81848319 GTTAGGGTGGAAGAAGTGAAGGG + Intronic
977018004 4:91718393-91718415 GTTGGTTTGGAAGAAAATAGAGG + Intergenic
979566790 4:122163211-122163233 GTGGGGAAGGAAGAAAAGAAAGG + Intronic
979690193 4:123551312-123551334 ATTGGGGTGGAAGAACACATAGG - Intergenic
982451928 4:155563227-155563249 GTGGGGCTGGAAGCAGAGAAAGG + Intergenic
984532354 4:180932482-180932504 GCAGGGTTGAAAGAACTGAAAGG - Intergenic
986017523 5:3770750-3770772 GGAGGGTTGGAAGAACACAAAGG + Intergenic
987391900 5:17384436-17384458 GCTGGGTTGGAAGAATTAAATGG + Intergenic
988561179 5:32282772-32282794 GGTGGGTAGGAAGGACGGAACGG + Intronic
988901850 5:35741419-35741441 GGTGTGTTTGAAGAACAGCAAGG + Intronic
989611695 5:43299938-43299960 GCTGGGCTGGAAGAACAAAGCGG + Intronic
990077309 5:51864973-51864995 GTAGGGTTTGAAGAGCAGAAAGG - Intergenic
990121732 5:52462843-52462865 GTTGAGTTTGAAGAAGGGAAAGG - Intergenic
991216395 5:64161067-64161089 GATGGCTTGGGAAAACAGAATGG + Intergenic
992079038 5:73216832-73216854 CTTCGGGTGGAATAACAGAAAGG - Intergenic
992248427 5:74852887-74852909 GATTGGTAGGAAGAACTGAAGGG + Intronic
992345315 5:75869822-75869844 GTTTGTTTGGGAGAACATAAGGG + Intergenic
992471595 5:77061745-77061767 GATGGGTTGGAAGAAAGGAGAGG + Exonic
993425812 5:87762963-87762985 GCTGTGTTGGAAGAATAGAAAGG - Intergenic
994714119 5:103301407-103301429 GTGGGGCTGGGAGAAGAGAAGGG + Intergenic
995007728 5:107221045-107221067 GTGAGGATGGAAGAACAGATGGG - Intergenic
999147102 5:149403671-149403693 GTTGGGAGGTGAGAACAGAAAGG + Intronic
1000981930 5:167825450-167825472 GTTTGCTTAGAAGAGCAGAAGGG + Intronic
1001434085 5:171685940-171685962 GGTGGTTTTGAAGGACAGAAAGG - Intergenic
1001563111 5:172683123-172683145 GGAGGGATGGAAGAAGAGAAAGG + Intronic
1001955389 5:175845238-175845260 GTAGGGTTGTAAGTACAGGAGGG - Intronic
1002173947 5:177391040-177391062 GCTCTGTGGGAAGAACAGAATGG - Intronic
1002789843 6:428880-428902 GTTGGGTTTCAAGAAAAGAAGGG - Intergenic
1003073050 6:2959641-2959663 CTTGGGGTGGAATTACAGAAGGG + Exonic
1003474732 6:6470890-6470912 GTTGATTTGGGAGAACACAAGGG - Intergenic
1003504061 6:6725429-6725451 GTGCGGTGGGAAGAAGAGAATGG - Intergenic
1003759078 6:9154394-9154416 GTAAGGGTGGAAGAACAGGAGGG + Intergenic
1003782195 6:9442038-9442060 CTTGAGGTGGTAGAACAGAAAGG + Intergenic
1003790972 6:9547150-9547172 ATTGGCTTTGAAGAGCAGAAGGG + Intergenic
1004395966 6:15246752-15246774 GTTTGGTTGAAAAAACAGACTGG + Intronic
1005758361 6:28945789-28945811 GTAGGGCTGGAAGAACAAAAAGG - Intergenic
1006297581 6:33176824-33176846 TTTGGGTTGGAAGAAGTGTAGGG - Intronic
1006698016 6:35948180-35948202 GTTGGTTTGGAAGAATAAATTGG + Intronic
1006765896 6:36506424-36506446 GTTAGGTTGGTAGGACCGAAAGG - Intronic
1007097401 6:39222009-39222031 GTGGAGTTGGAAACACAGAACGG - Intronic
1007440848 6:41858594-41858616 GGTGTGTTGGAAGAACAGTGAGG - Intronic
1007778965 6:44240721-44240743 TTTATGTTGGAAAAACAGAAAGG + Intergenic
1008024141 6:46615031-46615053 CTTGGGTTGGTAGATCTGAATGG + Intronic
1010784902 6:79989809-79989831 GTAGGGTAAGGAGAACAGAAGGG - Intergenic
1013396522 6:109746521-109746543 GGTGGGTTGGAGGAAGAAAAGGG + Intronic
1014783008 6:125586513-125586535 TTTGTTTTGGCAGAACAGAAAGG + Intergenic
1015188120 6:130441685-130441707 GTTGGATCGGAACAACAGCAAGG + Exonic
1016244411 6:141965726-141965748 TTTTGGTTGGAACAACAGGAAGG - Intergenic
1016574689 6:145555770-145555792 GTTAGGTTAGAGGAACAGATTGG - Intronic
1017270558 6:152499212-152499234 GTTGCAATGGAAGAACAGATGGG + Intronic
1018180144 6:161216221-161216243 GTTGGGTGGGAATAACTCAATGG + Intronic
1018273649 6:162107066-162107088 GTAGGGTTAGAAGAAAAAAATGG + Intronic
1019005655 6:168794437-168794459 GTTGTTTTAGAAGAACAGAGTGG + Intergenic
1020430851 7:8114660-8114682 GTTTAGGTGGAAGAGCAGAAGGG - Intronic
1020745573 7:12074423-12074445 GATGGCCTGGAAGAATAGAATGG + Intergenic
1021830979 7:24609437-24609459 CTTTGAGTGGAAGAACAGAAGGG + Intronic
1024081152 7:45856248-45856270 GTAGGGAAGGAAGGACAGAAGGG - Intergenic
1024335003 7:48197879-48197901 TGTGGGTAGGAAGAATAGAAAGG - Intronic
1026546068 7:71323371-71323393 CTTGGGTTGGAAGAAAGGAGAGG - Intronic
1026641225 7:72127269-72127291 GATGTGTTGGAGGAACAGCAAGG + Intronic
1027761087 7:82279632-82279654 GTTAGGTTAGAAGAAGAGACTGG - Intronic
1027883054 7:83867372-83867394 TTTGAGTTGGAAGAACAAAGAGG - Intergenic
1028308060 7:89290946-89290968 GTTTTTTTGGAAGAACATAATGG + Intronic
1031106799 7:117553941-117553963 GTCTGGTTTGAAGAACAGTAAGG + Intronic
1031148613 7:118026578-118026600 GTTTGTATGGAAGAAGAGAAAGG - Intergenic
1031360307 7:120841779-120841801 GTTAGGTGGGAAGTAGAGAAGGG + Intronic
1031990425 7:128194567-128194589 GGTGAGTTTGAAGAACAGCAAGG + Intergenic
1031998008 7:128245546-128245568 GGTGGGAGGGAAGAACAGGAGGG + Intronic
1033636669 7:143218339-143218361 ATTGGATGGGAAGCACAGAATGG + Intergenic
1034338758 7:150339456-150339478 GTTGGGTGGGAAGAACCCATCGG - Intronic
1034390265 7:150781692-150781714 TGTGGGTTGTAAGAAAAGAAGGG - Intergenic
1034987064 7:155522827-155522849 GTTGTCTTGGAAAAAGAGAAGGG - Intronic
1035339392 7:158150852-158150874 GTTGGGTTGGAAGAACAGAAAGG - Intronic
1035339708 7:158152433-158152455 GTTGGGTTGGAAGAACAGACAGG + Intronic
1035600599 8:894820-894842 GTGGGGTGGGGAGAACAGAGTGG + Intergenic
1037716156 8:21402526-21402548 GCTGGGTTGTCAGAACACAATGG - Intergenic
1038338711 8:26666033-26666055 CTTGGTTTGGAATAACTGAATGG - Intergenic
1039682703 8:39759660-39759682 GAAGAGTTGGAACAACAGAAGGG + Intronic
1039794922 8:40904546-40904568 GTTGGGGTAGAAAAACTGAAGGG + Intergenic
1039872951 8:41562266-41562288 CTTGAGTTGGAAGAACATATTGG - Intergenic
1041629888 8:60075378-60075400 AGTGTATTGGAAGAACAGAATGG - Intergenic
1044546390 8:93465077-93465099 GTAGGGTTGGAAGTACCAAATGG - Intergenic
1044965803 8:97572579-97572601 CCTGGGTTAGAAGAAAAGAACGG + Intergenic
1045876594 8:106989024-106989046 ATTGAGATGGAAGAACAGTAAGG + Intergenic
1046619288 8:116511422-116511444 TTTGGGTTGTAAGAGAAGAAAGG - Intergenic
1047189230 8:122662705-122662727 GATGGGGTGGAAGAAAAAAATGG - Intergenic
1047424344 8:124731618-124731640 GCGGGGTTGGAAGATCCGAAAGG - Intergenic
1048403756 8:134097256-134097278 GTTTTGTTGGAAGAAGAAAAAGG + Intergenic
1048685032 8:136895210-136895232 GTTGGGGTTGATGAAGAGAAAGG - Intergenic
1048821742 8:138386493-138386515 GGAGGGCTGGAAGAAAAGAATGG + Intronic
1049696064 8:143984878-143984900 GTGGGGTTGCAGGAACAGGAGGG - Exonic
1051227103 9:14910799-14910821 AATGTGTTGGAAGAAAAGAAGGG - Exonic
1052284774 9:26772603-26772625 TTTGGGCTCGAGGAACAGAATGG + Intergenic
1052353652 9:27482674-27482696 GTTTGGTGGGAAGTACAGATGGG - Intronic
1053010856 9:34632316-34632338 GATGTGTTGGAAGAAAAGCAAGG + Intergenic
1053227773 9:36375983-36376005 GTTGGCTTGGTCGAACTGAAGGG + Exonic
1053663638 9:40301951-40301973 GTGGGGTTGGAAGTACAAAGAGG + Intronic
1053914152 9:42932493-42932515 GTGGGGTTGGAAGTACAAAGAGG + Intergenic
1054375762 9:64448184-64448206 GTGGGGTTGGAAGTACAAAGAGG + Intergenic
1054520977 9:66074334-66074356 GTGGGGTTGGAAGTACAAAGAGG - Intergenic
1054858494 9:69926278-69926300 GATGGTTTGGGAAAACAGAATGG - Intergenic
1055573265 9:77638567-77638589 GTTGTGTTTGAAAAACACAAAGG + Intronic
1055708823 9:79036905-79036927 GCTGGCTTGGAAGAACTGAGAGG - Intergenic
1055839227 9:80482635-80482657 ATTGGGTAGAAAGAACAGGAAGG - Intergenic
1056599866 9:88038368-88038390 GATGGCTTGGGAAAACAGAATGG - Intergenic
1059551354 9:115232178-115232200 GGAGGGATGGAAGAAGAGAAAGG - Intronic
1060128976 9:121076714-121076736 GGTGGGTGGGCAGCACAGAATGG + Intronic
1060845185 9:126831281-126831303 GTGAGGGTGGGAGAACAGAATGG - Intronic
1061052932 9:128206691-128206713 GGTGCCTTTGAAGAACAGAAAGG + Intronic
1062011201 9:134267759-134267781 GTTGCTTTGGAAGAACAGGATGG + Intergenic
1203557470 Un_KI270744v1:12856-12878 GCGGGGTTAGAAGAATAGAAAGG - Intergenic
1185476226 X:417149-417171 GTTGGGTTTGGAGAACAAGAGGG + Intergenic
1187452852 X:19413816-19413838 GGTGGGGAGAAAGAACAGAAGGG + Intronic
1187940609 X:24377298-24377320 GTTAGGTTGGTAGAACAGTCTGG - Intergenic
1188163396 X:26830524-26830546 GAAGGGTATGAAGAACAGAAAGG - Intergenic
1188597776 X:31922283-31922305 GTTGGGGTGGAGGGACGGAAAGG - Intronic
1189690447 X:43612450-43612472 GTTTGTTTGGAAGAGCATAAGGG - Intergenic
1190125570 X:47702183-47702205 GTTAGGCAAGAAGAACAGAAGGG - Intergenic
1190384972 X:49876575-49876597 ATTCTGTTGGAAAAACAGAATGG + Intergenic
1191100859 X:56726768-56726790 GTTAGGTTGGAGGAACATAGAGG - Intergenic
1192044546 X:67658320-67658342 GTTTAGATGAAAGAACAGAAAGG + Intronic
1193526226 X:82592737-82592759 ATTGGGTTTGAAGAATAAAAGGG - Intergenic
1196190608 X:112790548-112790570 CATGAGTGGGAAGAACAGAAAGG - Intronic
1198112469 X:133513921-133513943 GTTGGGATGGAGGAAGACAAAGG - Intergenic
1198122123 X:133604391-133604413 ATTGGGTGGGAGGACCAGAAGGG + Intronic
1198253167 X:134901682-134901704 GTGGTCTTGGAAGAAAAGAAGGG + Intronic
1198326962 X:135583663-135583685 GTTTGGCTGGAAGCCCAGAATGG + Intergenic
1199294971 X:146146724-146146746 GTGGAGTTGGAGGAAAAGAAGGG + Intergenic
1200085846 X:153604555-153604577 GCTGGCTTGGAAGAAAAGAGAGG - Intergenic
1200268194 X:154657984-154658006 GTTGGGTTGGAAGTACCTACAGG - Intergenic
1201126916 Y:10923970-10923992 GTCCTGTTGGAAGAAAAGAATGG - Intergenic