ID: 1035339395

View in Genome Browser
Species Human (GRCh38)
Location 7:158150865-158150887
Sequence ATTCCACCAGCACGTTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035339395_1035339404 27 Left 1035339395 7:158150865-158150887 CCAACCCAACGTGCTGGTGGAAT 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1035339404 7:158150915-158150937 CCCACACAACACCGAGAAGCTGG No data
1035339395_1035339401 3 Left 1035339395 7:158150865-158150887 CCAACCCAACGTGCTGGTGGAAT 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1035339401 7:158150891-158150913 CCTACTGGTTTGCAGCAAATGGG 0: 1
1: 0
2: 0
3: 9
4: 74
1035339395_1035339406 28 Left 1035339395 7:158150865-158150887 CCAACCCAACGTGCTGGTGGAAT 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1035339406 7:158150916-158150938 CCACACAACACCGAGAAGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1035339395_1035339399 2 Left 1035339395 7:158150865-158150887 CCAACCCAACGTGCTGGTGGAAT 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1035339399 7:158150890-158150912 TCCTACTGGTTTGCAGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035339395 Original CRISPR ATTCCACCAGCACGTTGGGT TGG (reversed) Intronic
902616474 1:17626158-17626180 AGTCCCACAGCAGGTTGGGTGGG - Intronic
904432755 1:30475685-30475707 ATCCCACCTGCACCTTGGGCAGG - Intergenic
905530563 1:38675428-38675450 ATTCCATCAGCCCATTGGGCAGG + Intergenic
917089310 1:171336855-171336877 ATAACCCCAGCACGTTGGGAGGG - Intronic
917090796 1:171351290-171351312 ATTTCTCCAGCACAGTGGGTAGG + Intergenic
918182696 1:182098223-182098245 GGTCCACAGGCACGTTGGGTAGG - Intergenic
918270276 1:182891656-182891678 ATTCAACCATCCCGTGGGGTGGG + Intergenic
922673375 1:227532279-227532301 ATTCCACTACCAGGGTGGGTAGG + Intergenic
924350824 1:243112972-243112994 ATACTCCCAGCACTTTGGGTGGG - Intergenic
1066125544 10:32338270-32338292 AATCCACCAGCAAGTTCTGTTGG + Intronic
1078509268 11:11973543-11973565 ATTCCCCCAGCAGGATGGGAGGG - Intronic
1081924450 11:46812901-46812923 ATTGTCCCAGCACTTTGGGTTGG - Intronic
1083404148 11:62445028-62445050 ATTTATCCAGCACGTGGGGTAGG - Intronic
1083553321 11:63607079-63607101 ATTCCATCAGCACAGTCGGTGGG - Intronic
1085718302 11:78891960-78891982 ATTCTGTCAGCAGGTTGGGTGGG + Intronic
1086807463 11:91262645-91262667 ATTCTACCATCACGTTGTGGGGG - Intergenic
1087562697 11:99811720-99811742 ATTCCAGCTGGAGGTTGGGTAGG - Intronic
1091149152 11:133310696-133310718 ATTCCACCTGAACCCTGGGTGGG - Intronic
1103344104 12:120237943-120237965 ATCCCACCAGCGCCCTGGGTTGG - Intronic
1104745685 12:131208756-131208778 ATTCCACGAGCACAGTGGGCTGG - Intergenic
1106245649 13:27947626-27947648 CTTCCACCACCACTTTCGGTTGG - Intergenic
1108648126 13:52450460-52450482 CTTCCGCCAGCCCGTTGGGAAGG + Intronic
1111739170 13:92180690-92180712 ATTCCATCATCACTTTGGATAGG - Intronic
1118200170 14:63663930-63663952 ATTGCAACAGCACCTTGGCTTGG + Intergenic
1128714749 15:69900083-69900105 ATTCCAACAGCCCTATGGGTAGG + Intergenic
1130724807 15:86428161-86428183 ATTCCACCTTCATGTTGGCTTGG - Intronic
1131776829 15:95811596-95811618 ATTTTAGCAGCACGTTGGCTAGG + Intergenic
1132104024 15:99049975-99049997 ATTCTTCCAGCATGTTGGCTGGG + Intergenic
1132163750 15:99565705-99565727 ATTCCACAAGGACGTGGGGGCGG - Exonic
1141158280 16:81611892-81611914 AATCTACCAGCAGGTTGAGTTGG + Intronic
1141184941 16:81780081-81780103 ATTCCAGCAGGACGGTGGGGCGG + Intronic
1145232836 17:21187198-21187220 ATCCCACCAGCACTTTGGGAGGG + Intronic
1145817799 17:27808038-27808060 ATTCCTCCAGCAATTTGAGTGGG + Intronic
1149678777 17:58488974-58488996 ATGCCACCAGCTAGTTGGGCAGG - Intergenic
1150195763 17:63297180-63297202 ATTCCAACAGCCTGTTGGGCAGG + Intronic
1160676224 19:392760-392782 ATTACACCAGCACATGGGGCAGG - Intergenic
1163015995 19:14455032-14455054 ATCCCACCAGCTATTTGGGTTGG - Intronic
928200031 2:29241933-29241955 ATCCCAGCAGCACATTGGGGAGG - Intronic
928445544 2:31330758-31330780 ATTTTCCCAGCACGTTGGGCTGG - Intergenic
932770571 2:74498702-74498724 TTACCACCACCACGCTGGGTCGG - Intronic
935930017 2:108113852-108113874 ATGCCACCAGGGCCTTGGGTTGG - Intergenic
944926908 2:204474727-204474749 ATTCCACCAGTAAGTGGGGAAGG - Intergenic
945355847 2:208838533-208838555 ACTCCCCCAGCACCTTGGGTAGG - Intronic
1179450496 21:41465446-41465468 TCTCCACCTGCACATTGGGTGGG - Exonic
1179496778 21:41776789-41776811 ATTTCACCAACTCCTTGGGTGGG + Intergenic
953920210 3:46946588-46946610 ATTCCTCCAGCACCGTGGGAGGG + Intronic
960027346 3:113024265-113024287 ATTCCACCAGCCTGTAGGGGTGG + Intergenic
962328308 3:134454448-134454470 ATTGCACCAGGACGTGGGGAAGG - Intergenic
962884441 3:139611112-139611134 ATGCCACAAGCACGTGGGGCAGG + Intronic
967971833 3:195004998-195005020 ATTCCACCTGCACTGTGGGTGGG - Intergenic
968711891 4:2125563-2125585 CTTCCGCCAGCACCTGGGGTGGG + Intronic
984560112 4:181258145-181258167 CTTCCTCCAGCAGGTTGGCTGGG + Intergenic
990676468 5:58191841-58191863 ATTTCACCAGCAATTGGGGTTGG + Intergenic
1001731573 5:173964422-173964444 ATTCCAACAGCGTGCTGGGTGGG + Intergenic
1002813867 6:660201-660223 CTTCCACTACCAGGTTGGGTAGG - Intronic
1009245331 6:61230872-61230894 ATGCCACCACCGCCTTGGGTAGG - Intergenic
1012241000 6:96871958-96871980 ATTTCGACACCACGTTGGGTAGG + Intergenic
1013398538 6:109768592-109768614 ATTCTGCCAGCACGTGGGCTGGG - Intronic
1023018378 7:35987539-35987561 ATACCACAAGAACCTTGGGTGGG - Intergenic
1032863822 7:135906026-135906048 ATTCCACCAGCTCCTCGGCTTGG - Intergenic
1035339395 7:158150865-158150887 ATTCCACCAGCACGTTGGGTTGG - Intronic
1041060856 8:54033084-54033106 ATACAAGCAGCACGGTGGGTAGG + Intergenic
1044170832 8:89049950-89049972 CTTCCACCAGGGCTTTGGGTCGG - Intergenic
1048634406 8:136280226-136280248 ATTCAAGCATCCCGTTGGGTGGG - Intergenic
1052041713 9:23746661-23746683 ATTCCAGAAGCCAGTTGGGTGGG - Intronic
1187681438 X:21771117-21771139 TTTCCACTACCACGGTGGGTAGG - Intergenic
1190677954 X:52798134-52798156 ATTCTACCAGTATGTGGGGTGGG + Intergenic
1193643871 X:84043932-84043954 CTTCCACTAGCAGGGTGGGTAGG + Intergenic
1194120022 X:89950299-89950321 ATTCCACATGAACTTTGGGTGGG + Intergenic
1197722195 X:129752866-129752888 ATCCCACCAGCACTCTGGGATGG - Intronic
1200375514 X:155775686-155775708 ATTCCACTAGCATGCTGAGTAGG + Exonic
1200472885 Y:3607816-3607838 ATTCCACATGAACTTTGGGTGGG + Intergenic
1201284770 Y:12369548-12369570 ATCCCACCACCAGGTTGGGGCGG - Intergenic