ID: 1035339396

View in Genome Browser
Species Human (GRCh38)
Location 7:158150869-158150891
Sequence GATAATTCCACCAGCACGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035339396_1035339401 -1 Left 1035339396 7:158150869-158150891 CCCAACGTGCTGGTGGAATTATC 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1035339401 7:158150891-158150913 CCTACTGGTTTGCAGCAAATGGG 0: 1
1: 0
2: 0
3: 9
4: 74
1035339396_1035339399 -2 Left 1035339396 7:158150869-158150891 CCCAACGTGCTGGTGGAATTATC 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1035339399 7:158150890-158150912 TCCTACTGGTTTGCAGCAAATGG No data
1035339396_1035339404 23 Left 1035339396 7:158150869-158150891 CCCAACGTGCTGGTGGAATTATC 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1035339404 7:158150915-158150937 CCCACACAACACCGAGAAGCTGG No data
1035339396_1035339406 24 Left 1035339396 7:158150869-158150891 CCCAACGTGCTGGTGGAATTATC 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1035339406 7:158150916-158150938 CCACACAACACCGAGAAGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035339396 Original CRISPR GATAATTCCACCAGCACGTT GGG (reversed) Intronic
900468578 1:2838612-2838634 TGTAATTCCAGCAGCACTTTGGG - Intergenic
902055776 1:13599266-13599288 TGTAATCCCACCAGCACTTTGGG - Intronic
905846777 1:41241154-41241176 GATAATTTGACGAGCCCGTTTGG - Intronic
906198416 1:43944254-43944276 GCTCATGCCACCAGCACTTTGGG - Intergenic
916598711 1:166271817-166271839 GATCAATGCACCAGCAGGTTTGG + Intergenic
921153192 1:212417902-212417924 TATAATTCCCCCAGCACTTTGGG - Intergenic
1066324888 10:34348578-34348600 AATAATTCCACCAGCACACATGG - Intronic
1068379325 10:56229570-56229592 CATATTTCCACAAGCATGTTTGG + Intergenic
1068916184 10:62434151-62434173 GATATTTTAACCAGCACCTTGGG + Intronic
1072954320 10:99875329-99875351 TGTAATCCCACCAGCACTTTGGG - Intergenic
1073496402 10:103895415-103895437 GATGATTCTATCAGCATGTTTGG - Intronic
1076398690 10:130162237-130162259 TATAATCCCAGCAGCACTTTGGG - Intronic
1078538562 11:12195003-12195025 TATAATCCCAGCAGCACTTTGGG + Intronic
1081291550 11:41331850-41331872 AATAGTTCCATCAGCACGTGTGG - Intronic
1085602622 11:77868968-77868990 AACAATGCCAACAGCACGTTGGG + Intronic
1087965779 11:104413382-104413404 GATGAATCCACCATCATGTTTGG + Intergenic
1089126724 11:116181452-116181474 GATTACGCCACCAGCACCTTTGG + Intergenic
1090513400 11:127399153-127399175 GATAATTCCACCACCCCTTGAGG - Intergenic
1090575939 11:128103771-128103793 GATAATTCCACCAGCACACAGGG - Intergenic
1099311803 12:81035448-81035470 GATAATACAACCTGCACTTTAGG + Intronic
1100771893 12:97932638-97932660 GATAATTCGACCAGCTGATTAGG + Intergenic
1102473697 12:113175044-113175066 GCAAATTCCACCAGCAGTTTGGG + Exonic
1103598055 12:122036165-122036187 GTTAATCCCACCAGGACCTTGGG + Intronic
1103807334 12:123583748-123583770 TGTAATTCCAGCAGCACTTTGGG + Intergenic
1107833721 13:44397020-44397042 GCTAATTCCACCAGCAGTTAAGG - Intronic
1109900946 13:68769087-68769109 GATAATTGCCACAGCACGTGGGG - Intergenic
1116854018 14:49936241-49936263 TATAATCCCAGCAGCACTTTGGG + Intergenic
1125558641 15:40608484-40608506 TATAATCCCAGCAGCACTTTGGG + Intronic
1127705177 15:61539820-61539842 GCTCATGCCACCAGCACTTTGGG - Intergenic
1127927238 15:63558613-63558635 TGTAATCCCACCAGCACTTTGGG + Intronic
1128365039 15:66993461-66993483 TGTAATTCCAGCAGCACTTTGGG + Intergenic
1129050318 15:72776041-72776063 GAAAATTCCACCCACACGTAAGG - Intronic
1130069184 15:80631936-80631958 TATATTTCCACCAGCACTGTAGG - Intergenic
1134814174 16:17192356-17192378 TGTAATGCCACCAGCACTTTGGG - Intronic
1137446869 16:48537270-48537292 GATAATAACAGCAGCACTTTAGG + Intergenic
1138242060 16:55435350-55435372 GGAACTTCCATCAGCACGTTGGG + Intronic
1138666036 16:58569379-58569401 TATAATCCCAGCAGCACTTTGGG - Intronic
1139699206 16:68697063-68697085 TGTAATCCCACCAGCACTTTGGG + Intronic
1140860376 16:79012894-79012916 GAAAATGCCACCAGCAGGCTGGG + Intronic
1142071832 16:88094784-88094806 AATAATCCCACCAGCACTTTGGG + Intronic
1145232834 17:21187194-21187216 TGTAATCCCACCAGCACTTTGGG + Intronic
1146734791 17:35229315-35229337 GGTAATCCCAGCAGCACTTTGGG - Intergenic
1149952198 17:61000811-61000833 GATAATACTACCATCACTTTTGG - Intronic
1155408870 18:25519874-25519896 TGTAATCCCACCAGCACTTTAGG - Intergenic
1158204804 18:54980763-54980785 TGTAATTCCAGCAGCACTTTGGG - Intergenic
1163562637 19:18029312-18029334 TATAATCCCAGCAGCACTTTGGG + Intergenic
928148475 2:28804939-28804961 TATAATTCTCCCAGCACTTTGGG - Intronic
931403470 2:61953267-61953289 TGTAATCCCAGCAGCACGTTGGG - Intronic
936542133 2:113361283-113361305 GACAACTCCACCAGCACAGTGGG + Intergenic
939314848 2:140534930-140534952 GCTAATTACACTAGCAGGTTTGG + Intronic
947027287 2:225750603-225750625 GATATTCCAACCAACACGTTGGG - Intergenic
1171496237 20:25557694-25557716 GACAATTCCACAAGCATATTTGG + Intronic
1174292202 20:49517165-49517187 GAGAGTTCCACCAGCACCTCAGG + Intronic
1179111967 21:38455015-38455037 GAGAATACCAACAGCACGCTGGG - Intronic
950209553 3:11111834-11111856 GATAAATCTACCATCATGTTTGG - Intergenic
951999369 3:28768219-28768241 GATAAAGACACCAGCAGGTTTGG + Intergenic
952907230 3:38149015-38149037 TATAATCCCAGCAGCACTTTGGG - Intergenic
953937171 3:47055751-47055773 AGTAATCCCACCAGCACTTTGGG + Intronic
956593723 3:70944432-70944454 GTTTATTACACCAACACGTTTGG + Intergenic
959511673 3:107219927-107219949 GTTAATCCCAGCAGCACTTTGGG + Intergenic
962785562 3:138765068-138765090 TATAATCCCACTAGCACTTTGGG + Intronic
964229540 3:154448074-154448096 GATAATTTCATCTGCACATTAGG - Intergenic
966180955 3:177188287-177188309 TGTAATCCCACCAGCACTTTGGG + Intronic
966850985 3:184164915-184164937 GATGACTCCACCAGCAGGTGGGG + Exonic
967063251 3:185891290-185891312 GATAATTCCACCCTTATGTTGGG - Intergenic
967897313 3:194408275-194408297 TGTAATCCCACCAGCACTTTGGG - Intronic
971322754 4:25618535-25618557 TGTAGTTCCAGCAGCACGTTGGG + Intergenic
971341735 4:25775730-25775752 GCTAACTCCACCAGAAGGTTAGG + Intronic
972576662 4:40358159-40358181 TATAATCCCAGCAGCACTTTGGG + Intergenic
974387316 4:61218586-61218608 GCTTATGCCACCAGCACTTTGGG - Intronic
981349699 4:143715111-143715133 GATATTTCCTCCAGCACATTTGG - Intergenic
981634100 4:146855171-146855193 TATAATCCCAGCAGCACTTTGGG + Intronic
992554481 5:77889864-77889886 GAAAATACCACCAGGAAGTTTGG - Intergenic
996043547 5:118844030-118844052 GATAGTTCCTCCATCAGGTTGGG + Intronic
997184639 5:131869507-131869529 CATAGTTCCCCCAGCAGGTTAGG + Intronic
1001819425 5:174698453-174698475 GATAATTACACCAGCCCCTCGGG + Intergenic
1007328047 6:41078270-41078292 ATTAATTCCACCAGCATGTGTGG + Intronic
1011645766 6:89456408-89456430 ATCAATTCCACCAGCACCTTGGG - Intronic
1014311472 6:119808039-119808061 GTTGATTGCACCAGCACTTTGGG + Intergenic
1015445295 6:133296937-133296959 GATAAATCCACCATCACAGTGGG - Intronic
1017489234 6:154930096-154930118 GATAAATCCACCATCACAGTTGG + Intronic
1017799093 6:157876190-157876212 TGTAATCCCACCAGCACTTTGGG + Intronic
1018385181 6:163296550-163296572 TGTAATTCCACCAGCACTTTTGG - Intronic
1023623040 7:42091959-42091981 GAGAATACCACCAGCACTTGAGG + Intronic
1026573272 7:71550638-71550660 TGTAATCCCACCAGCACTTTGGG - Intronic
1029256825 7:99274931-99274953 TATAATCCCAGCAGCACTTTGGG - Intergenic
1029365651 7:100114458-100114480 TGTAATCCCACCAGCACTTTGGG + Intronic
1031846733 7:126814023-126814045 GTTATTTCCACCAGCACTTATGG + Intronic
1033092253 7:138396723-138396745 AATAATTACACTAGCAGGTTGGG - Intergenic
1035339396 7:158150869-158150891 GATAATTCCACCAGCACGTTGGG - Intronic
1036989186 8:13572346-13572368 AATAATTCCTCCAGCACTTTGGG - Intergenic
1047067557 8:121302508-121302530 TTTAATTCAACGAGCACGTTTGG - Intergenic
1049837860 8:144750479-144750501 GATAAAAACACCAGCAGGTTAGG + Intronic
1050542401 9:6681586-6681608 GATAGTTGCACCAGCACATGAGG - Intergenic
1057736825 9:97670172-97670194 TATAATCCCAGCAGCACTTTGGG - Intronic
1057744294 9:97739325-97739347 GTTAATTCCCCCAGCACATCTGG - Intergenic
1058723844 9:107783841-107783863 TGTAATTTCACCAGCACTTTAGG + Intergenic
1058835702 9:108857000-108857022 TGTAATCCCACCAGCACTTTGGG + Intergenic
1059546865 9:115184847-115184869 GATAACTCCACCATCACCTGGGG + Intronic
1193812804 X:86071401-86071423 GATAATTCCACAAGCATAGTTGG - Intergenic
1194150097 X:90314221-90314243 GATAAATCCATCATCACGGTGGG - Intergenic
1195274823 X:103271618-103271640 GACAATTCCACCAGCAGTGTAGG - Intergenic
1195580527 X:106496031-106496053 GATAATTCAACCAGAATATTTGG + Intergenic
1198161769 X:134015303-134015325 GCTCATGCCACCAGCACTTTGGG - Intergenic
1200496524 Y:3891300-3891322 GATAAATCCATCATCACGGTGGG - Intergenic