ID: 1035339397

View in Genome Browser
Species Human (GRCh38)
Location 7:158150870-158150892
Sequence GGATAATTCCACCAGCACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 52}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035339397_1035339406 23 Left 1035339397 7:158150870-158150892 CCAACGTGCTGGTGGAATTATCC 0: 1
1: 0
2: 1
3: 5
4: 52
Right 1035339406 7:158150916-158150938 CCACACAACACCGAGAAGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1035339397_1035339401 -2 Left 1035339397 7:158150870-158150892 CCAACGTGCTGGTGGAATTATCC 0: 1
1: 0
2: 1
3: 5
4: 52
Right 1035339401 7:158150891-158150913 CCTACTGGTTTGCAGCAAATGGG 0: 1
1: 0
2: 0
3: 9
4: 74
1035339397_1035339404 22 Left 1035339397 7:158150870-158150892 CCAACGTGCTGGTGGAATTATCC 0: 1
1: 0
2: 1
3: 5
4: 52
Right 1035339404 7:158150915-158150937 CCCACACAACACCGAGAAGCTGG No data
1035339397_1035339399 -3 Left 1035339397 7:158150870-158150892 CCAACGTGCTGGTGGAATTATCC 0: 1
1: 0
2: 1
3: 5
4: 52
Right 1035339399 7:158150890-158150912 TCCTACTGGTTTGCAGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035339397 Original CRISPR GGATAATTCCACCAGCACGT TGG (reversed) Intronic
906198417 1:43944255-43944277 GGCTCATGCCACCAGCACTTTGG - Intergenic
917728465 1:177850196-177850218 GGTTAACTCCACAAGCACTTTGG + Intergenic
921153193 1:212417903-212417925 CTATAATTCCCCCAGCACTTTGG - Intergenic
1065429786 10:25641571-25641593 GCATAATTCCCCCAGCACAAAGG + Intergenic
1071837029 10:89428361-89428383 GGATTCATCCACCTGCACGTGGG + Intergenic
1075453501 10:122569643-122569665 TGATAATCCAACCAGCAAGTGGG + Intronic
1077711317 11:4540048-4540070 GGATAATTCAACAAGTACGTTGG + Intergenic
1088447382 11:109946694-109946716 GGATAATTCTATCAGTAAGTAGG + Intergenic
1090575940 11:128103772-128103794 GGATAATTCCACCAGCACACAGG - Intergenic
1099367525 12:81786677-81786699 GGATAATAAAACCATCACGTTGG + Intergenic
1102473696 12:113175043-113175065 GGCAAATTCCACCAGCAGTTTGG + Exonic
1108504185 13:51095721-51095743 GGATAATTCCAGCAGAAAGATGG - Intergenic
1109900947 13:68769088-68769110 AGATAATTGCCACAGCACGTGGG - Intergenic
1110731991 13:78889409-78889431 ACATAATTCCACCAGCCCCTGGG + Intergenic
1116266034 14:42691601-42691623 GGATACTTCCACCTACCCGTGGG - Intergenic
1121080175 14:91101520-91101542 TGACATTTCCACCAGGACGTTGG + Intronic
1127705178 15:61539821-61539843 GGCTCATGCCACCAGCACTTTGG - Intergenic
1128365038 15:66993460-66993482 GTGTAATTCCAGCAGCACTTTGG + Intergenic
1137611642 16:49822071-49822093 GGTGAATTCCAACAGCACGTGGG + Intronic
1140740400 16:77936467-77936489 GGAGAAGTCCCCCAGCACTTGGG - Intronic
1142071831 16:88094783-88094805 AAATAATCCCACCAGCACTTTGG + Intronic
1144068931 17:11649829-11649851 GGGTACTTCCACTAGCAAGTGGG - Intronic
1151313430 17:73308276-73308298 GGAAAAATCCTCCAGTACGTAGG + Intronic
1158226819 18:55209878-55209900 GGACAATTTCACCACCATGTAGG - Intergenic
1159775756 18:72601597-72601619 GGAAAATTCCACCAGGGCGTGGG + Intronic
1160457138 18:79009258-79009280 GGATAATTCAACTAACACGCAGG - Intergenic
926888462 2:17618906-17618928 AGAAAATTCCCCCAGCACTTTGG + Intronic
936542132 2:113361282-113361304 GGACAACTCCACCAGCACAGTGG + Intergenic
938919384 2:135980816-135980838 GGATAATTTTACTAGCACTTTGG + Intronic
940981327 2:160007183-160007205 GGAAAATTACAACAGCATGTAGG - Intronic
1170848011 20:19978481-19978503 GGATAGTGACACCAGCACATGGG - Intronic
1181449502 22:23009400-23009422 GGGTAATTGCCCCAGCACCTGGG + Intergenic
958476309 3:94587984-94588006 TGATAATTCCACAATCACATTGG - Intergenic
959716443 3:109438763-109438785 GGATAATTCCTCCTGCAAGGAGG - Intergenic
962790092 3:138803560-138803582 GGATATATGCAGCAGCACGTGGG + Intronic
964302851 3:155308811-155308833 AGATGATTCCACCAGCACAGTGG + Intergenic
966850984 3:184164914-184164936 GGATGACTCCACCAGCAGGTGGG + Exonic
967063252 3:185891291-185891313 GGATAATTCCACCCTTATGTTGG - Intergenic
971322753 4:25618534-25618556 GTGTAGTTCCAGCAGCACGTTGG + Intergenic
973048788 4:45568812-45568834 GAATAATTCTACCAGCATGTAGG - Intergenic
974206224 4:58706012-58706034 GGATCCTTCCCACAGCACGTGGG - Intergenic
974387317 4:61218587-61218609 GGCTTATGCCACCAGCACTTTGG - Intronic
990644910 5:57833158-57833180 GGGTAATTCCATCATCACATGGG + Intergenic
998785924 5:145708897-145708919 GGAAAATTCCCCCAGCAAGCTGG + Intronic
1001819424 5:174698452-174698474 TGATAATTACACCAGCCCCTCGG + Intergenic
1005236602 6:23770257-23770279 GTATAATTCCACCAACTTGTGGG - Intergenic
1014311471 6:119808038-119808060 GGTTGATTGCACCAGCACTTTGG + Intergenic
1018085263 6:160295940-160295962 GGATAAATCCACCACCATCTCGG - Intergenic
1018877923 6:167842074-167842096 GGATAATTCCTGCAGTAAGTTGG - Intronic
1019407420 7:890988-891010 GGAATACTCCACCAGCATGTTGG - Exonic
1021663622 7:22948694-22948716 AAATAATTACACCAGCATGTTGG - Intronic
1023282522 7:38585686-38585708 GGAAAATTCCACTGGCACGGTGG - Intronic
1027766476 7:82350052-82350074 GAATAATTCCACCAGCCAGGTGG + Intronic
1032137869 7:129297879-129297901 GGATTAGTCCACCACCATGTCGG - Intronic
1035339397 7:158150870-158150892 GGATAATTCCACCAGCACGTTGG - Intronic
1036989187 8:13572347-13572369 AAATAATTCCTCCAGCACTTTGG - Intergenic
1039860651 8:41454394-41454416 GAGTAATTCAACCAGCACGATGG + Intergenic
1059546864 9:115184846-115184868 TGATAACTCCACCATCACCTGGG + Intronic
1198161770 X:134015304-134015326 GGCTCATGCCACCAGCACTTTGG - Intergenic