ID: 1035339399

View in Genome Browser
Species Human (GRCh38)
Location 7:158150890-158150912
Sequence TCCTACTGGTTTGCAGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035339397_1035339399 -3 Left 1035339397 7:158150870-158150892 CCAACGTGCTGGTGGAATTATCC 0: 1
1: 0
2: 1
3: 5
4: 52
Right 1035339399 7:158150890-158150912 TCCTACTGGTTTGCAGCAAATGG No data
1035339396_1035339399 -2 Left 1035339396 7:158150869-158150891 CCCAACGTGCTGGTGGAATTATC 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1035339399 7:158150890-158150912 TCCTACTGGTTTGCAGCAAATGG No data
1035339391_1035339399 18 Left 1035339391 7:158150849-158150871 CCTCCTTTCTGTTCTTCCAACCC 0: 1
1: 1
2: 6
3: 79
4: 712
Right 1035339399 7:158150890-158150912 TCCTACTGGTTTGCAGCAAATGG No data
1035339392_1035339399 15 Left 1035339392 7:158150852-158150874 CCTTTCTGTTCTTCCAACCCAAC 0: 1
1: 1
2: 1
3: 26
4: 305
Right 1035339399 7:158150890-158150912 TCCTACTGGTTTGCAGCAAATGG No data
1035339395_1035339399 2 Left 1035339395 7:158150865-158150887 CCAACCCAACGTGCTGGTGGAAT 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1035339399 7:158150890-158150912 TCCTACTGGTTTGCAGCAAATGG No data
1035339390_1035339399 27 Left 1035339390 7:158150840-158150862 CCACTCTGGCCTCCTTTCTGTTC 0: 2
1: 3
2: 67
3: 373
4: 1388
Right 1035339399 7:158150890-158150912 TCCTACTGGTTTGCAGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035339399 Original CRISPR TCCTACTGGTTTGCAGCAAA TGG Intronic
No off target data available for this crispr