ID: 1035340522

View in Genome Browser
Species Human (GRCh38)
Location 7:158157774-158157796
Sequence TCTCCCAGGGGAGCAGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 308}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035340522_1035340530 26 Left 1035340522 7:158157774-158157796 CCTGCGCCTGCTCCCCTGGGAGA 0: 1
1: 0
2: 3
3: 29
4: 308
Right 1035340530 7:158157823-158157845 GTGCTGACACACAGGAAGAAAGG 0: 1
1: 0
2: 4
3: 32
4: 284
1035340522_1035340527 2 Left 1035340522 7:158157774-158157796 CCTGCGCCTGCTCCCCTGGGAGA 0: 1
1: 0
2: 3
3: 29
4: 308
Right 1035340527 7:158157799-158157821 GTGCGCTGCTGCTGACTCCACGG No data
1035340522_1035340528 18 Left 1035340522 7:158157774-158157796 CCTGCGCCTGCTCCCCTGGGAGA 0: 1
1: 0
2: 3
3: 29
4: 308
Right 1035340528 7:158157815-158157837 TCCACGGTGTGCTGACACACAGG 0: 1
1: 0
2: 0
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035340522 Original CRISPR TCTCCCAGGGGAGCAGGCGC AGG (reversed) Intronic
900083887 1:877601-877623 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
900156065 1:1203734-1203756 GCTGCCAGGGGAGCAGGGCCCGG + Exonic
900160130 1:1219417-1219439 TCCTCCAGAGGGGCAGGCGCGGG - Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900272006 1:1795424-1795446 TCACACAGGGGACCAGGCGGAGG + Intronic
900370726 1:2331042-2331064 CCTCCCAGGGCAGCAGGCGGCGG + Intronic
900412998 1:2521509-2521531 TCTCCCGGGGGAGCACAGGCGGG + Intronic
900599187 1:3495912-3495934 TCTCCCCGGGGGGCAGAGGCAGG + Exonic
900978718 1:6034316-6034338 CCTCCCAGGGGAGGAGGGGTTGG - Intronic
901324433 1:8358409-8358431 TCTCCAAGGGGTTCAGGCCCGGG + Exonic
901481618 1:9529141-9529163 CCTCCCAGGGGAGCTGGCTCCGG - Intergenic
902608313 1:17581814-17581836 TCTCCCAGGGGTGCAGGGCATGG - Intronic
902787174 1:18740201-18740223 TCTCCCAGGGGTGGAGCCGAGGG - Intronic
903004699 1:20290946-20290968 GCTGCCAGGGCAGCGGGCGCAGG + Exonic
904679520 1:32219286-32219308 CCTCCCAGGGGATGAGGAGCAGG - Intronic
907316218 1:53574440-53574462 TCTCCCAGGGGAGACTGCGTGGG - Intronic
909674158 1:78220534-78220556 TCTTCCAGGTGAGCCGGCTCTGG - Intergenic
912427129 1:109604165-109604187 TCTCCAAGGGGAACAAGAGCAGG - Exonic
914757002 1:150568516-150568538 TCTCCCACGGGAACAGGATCAGG + Intergenic
917732656 1:177891703-177891725 GATCTCAGGGGAGCAGGCGGGGG - Intergenic
919819665 1:201465230-201465252 TCTCCCAGGGTAGCAGGGGCAGG + Intergenic
920963280 1:210682536-210682558 TGTCCCAGAGGAGCAGGCTATGG + Exonic
922731165 1:227949377-227949399 TTTCCCAGGGAAGCAGGGCCGGG - Intergenic
922986642 1:229871235-229871257 TCTCCCAGGAGGGGAGGCCCAGG - Intergenic
923942580 1:238844390-238844412 TCCCCCAGGGGCTCAGGCCCAGG + Intergenic
924037138 1:239949224-239949246 TCTCGCAGAGGAGCAGGCCCGGG - Intergenic
924243849 1:242062940-242062962 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
1062763354 10:44334-44356 TGTCCTAGGGGAGCAAGCACAGG - Intergenic
1064255859 10:13742304-13742326 AATCCCAGGGAAGCAGGTGCAGG + Intronic
1066049061 10:31618623-31618645 TCACCCAGGGGAGCAGGGCTTGG - Intergenic
1067107575 10:43376213-43376235 CCTCCCAGGGGAGGAGGTGCTGG - Exonic
1067146176 10:43695455-43695477 GCTCCCAGGGGTGCAGGTCCGGG + Intergenic
1067850580 10:49751439-49751461 TCCCCCAGGGCTGCAGGGGCTGG - Intronic
1068119889 10:52774637-52774659 TCTGCCACTGGAGCAGGAGCAGG - Intergenic
1069604690 10:69731899-69731921 GCCCCCAGAGGAGCAGGCCCTGG + Intergenic
1070111909 10:73495347-73495369 TGTCACCGGGGAGCAGGCGTGGG + Intronic
1070605026 10:77892579-77892601 TGTCCAAGGGGAGCAGGCTGGGG - Intronic
1070674930 10:78405986-78406008 TCTCCAAGGGGAGGAGACCCGGG + Intergenic
1070736164 10:78865229-78865251 TCCCCAAAGGGAGCAGGGGCAGG - Intergenic
1071506233 10:86233522-86233544 TCACCCAGGGGAGCTGCCGGAGG + Intronic
1072656268 10:97332708-97332730 TCTCCCAGAGAAGAAGCCGCTGG - Exonic
1072682691 10:97518041-97518063 TCTCCCTGGGAAGCAGGCCAAGG - Intronic
1072737535 10:97889187-97889209 ACTCCCAGTGGAGCTGGCGGAGG + Intronic
1075504506 10:123009673-123009695 CCGCCCAGGGGAGCCGGAGCCGG + Intronic
1075995511 10:126873468-126873490 TTCCCCAGGGGAGCAGGAGGGGG - Intergenic
1076241839 10:128914764-128914786 TCTCCCGGAGCAGCAGGCGGTGG + Intergenic
1076346817 10:129785003-129785025 TGTCCCAGGGCAGTAGGTGCTGG - Intergenic
1076366881 10:129926898-129926920 TGTCCCCCGGGAGCAGGCTCTGG - Intronic
1077421221 11:2450922-2450944 TCTCTCTGGGGAGCAGGCCCTGG + Intronic
1077545894 11:3169648-3169670 TCCCACAGGGGTGCAGGGGCTGG + Intergenic
1077917310 11:6619609-6619631 ATTCCCAGGGGACCAGGCTCAGG - Intergenic
1078064778 11:8071283-8071305 TCTCCCAGGGAAGTGGGAGCGGG + Intronic
1079133577 11:17763428-17763450 TCTCCCAGGGAACCAGGGTCTGG - Intronic
1079204701 11:18404377-18404399 TCACCCAGGCTAGCAGGCTCTGG - Intronic
1080036676 11:27719126-27719148 TCCCCCGGGGGTGCAGGCGGGGG + Intronic
1081594788 11:44451798-44451820 CCTCCACGGGGAGCAGGCTCTGG + Intergenic
1082004920 11:47414158-47414180 GTGCCCAGGGGAGCAGGCCCAGG - Intronic
1083173323 11:60935275-60935297 CATCCTGGGGGAGCAGGCGCTGG + Exonic
1083856688 11:65396512-65396534 TCTGCAAAGGAAGCAGGCGCAGG + Intronic
1083903322 11:65654475-65654497 GCCCCCAGTGGAGCAGGAGCTGG + Exonic
1084901381 11:72312468-72312490 TATTCCATGGGAGCAGGTGCTGG + Intronic
1085274898 11:75292083-75292105 GCTCCCAGGGGAGGTGGGGCGGG - Intronic
1085796040 11:79540865-79540887 TCTTCCAGGTGAGCAGCAGCTGG + Intergenic
1087137373 11:94734641-94734663 TCTCCCAGGGGAGCATGGGCAGG - Intronic
1089673446 11:120073095-120073117 TCTCCCAGGGGAGGGGACACAGG + Intergenic
1091203390 11:133800272-133800294 AATCCTAGGGGAGCAGGAGCAGG + Intergenic
1091302394 11:134515776-134515798 TCTCCAGGGGGAGGAGGCTCCGG - Intergenic
1092528121 12:9322818-9322840 TCTCCCATGGAAGCAGGTGTGGG + Intergenic
1092530388 12:9339322-9339344 AGCCCCAGGGGAGCAGGGGCTGG + Intergenic
1092539148 12:9408943-9408965 TCTCCCATGGAAGCAGGTGTGGG - Intergenic
1092961406 12:13599799-13599821 TCTCCCAGGTGGGGAGGAGCAGG - Intronic
1094813229 12:34162093-34162115 TGTCCTAGGGGAGCAAGCACAGG - Intergenic
1097179235 12:57161740-57161762 TCTGCCAGGGGAAGAGGAGCTGG - Intronic
1097794013 12:63843796-63843818 TTTCCTAGCGGAGCAGGGGCGGG + Intergenic
1100725687 12:97406122-97406144 TCCCCCAGGGAAGCAGGCGGGGG - Intergenic
1101537716 12:105634587-105634609 TTTCCCAGGGGAACAGGCTCAGG + Intergenic
1102058654 12:109915596-109915618 AGGCCCAGGGGAGCAGGGGCCGG - Intronic
1103925961 12:124423453-124423475 TCTGGCTGGGAAGCAGGCGCGGG - Intronic
1104765583 12:131328090-131328112 GCTCCCTGGGGAGCAGTGGCAGG + Intergenic
1104813740 12:131633962-131633984 GCTCCCTGGGGAGCAGTGGCAGG - Intergenic
1104834179 12:131776676-131776698 TCTCCCCGGGGAGCAGCTGGGGG + Intronic
1106117317 13:26829067-26829089 TCTCCCTGGAGAGCAGGGGTAGG + Intergenic
1107113015 13:36718051-36718073 TCTGCCAGGGGAGCTGGGGAAGG - Intergenic
1109184384 13:59251844-59251866 GCACGCAGGTGAGCAGGCGCAGG + Intergenic
1112299512 13:98217397-98217419 CCCCCCAGGAGAGCAGGGGCAGG + Intronic
1112591041 13:100763214-100763236 TCTTCCAGGGGAGGTGGCCCAGG + Intergenic
1113523012 13:110953913-110953935 ACTCCCAGGGCAGGAGGCGGGGG - Intergenic
1113702357 13:112396896-112396918 ACTCCCAGGGCAGGAGGCGGGGG + Intronic
1118771943 14:68948086-68948108 TCTCCCAGGGGAGTAGGGCTTGG + Intronic
1119126784 14:72134788-72134810 TATCCCAGGGGAGGAGGAGGTGG + Intronic
1119716279 14:76861806-76861828 ACTACCTGGGGAGCAGGCGTGGG + Intronic
1120493447 14:85204959-85204981 GCGCACAGGGGAGCAGGTGCAGG - Intergenic
1122038087 14:98962750-98962772 CAGCCCAGGGGAGCACGCGCGGG + Intergenic
1122444343 14:101758352-101758374 TGTCCCAGAGGAGCAGGGGTTGG + Intergenic
1122977234 14:105175854-105175876 TCTCCCAGTGGAGCGGGCCCTGG + Intronic
1123149277 14:106165719-106165741 TCTCCCAGGGCTGCAGGGTCAGG + Intergenic
1123172749 14:106389906-106389928 TCTCCCAGGGCTGCAGGGTCAGG + Intergenic
1123186200 14:106519099-106519121 TCTCCCAGAGCAGCAGGGTCAGG + Intergenic
1124040302 15:26095886-26095908 TCTCTCAGGGCAGCAGGGGGCGG - Intergenic
1124515583 15:30364707-30364729 CCTCCCAGGAGAGCTGGCTCAGG - Intronic
1124727338 15:32166017-32166039 CCTCCCAGGAGAGCTGGCTCAGG + Intronic
1127774429 15:62254210-62254232 GCTCTGAGGGGAGCAGGCGGAGG - Intergenic
1128309507 15:66621666-66621688 TCTCCGAGGAGAGCTGGGGCCGG + Intronic
1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG + Exonic
1129844110 15:78760387-78760409 CCTCCCTGGGGAGGAGGAGCAGG + Intronic
1130682055 15:86005615-86005637 CCTCCCAGGGGAGGAGGAGGAGG + Intergenic
1131563297 15:93462854-93462876 TCTGCCAAGGTAGCAGGCCCTGG - Intergenic
1132478296 16:153455-153477 CCTCCCAGGGGATCAGATGCTGG - Intronic
1132480381 16:164045-164067 CCTCCCAGGGGATCAGATGCTGG - Intronic
1132600148 16:769553-769575 TCCCCCAGTGCAGCAGGCACAGG + Exonic
1132600218 16:769767-769789 GGTCCCAGGAGAGCAGCCGCAGG - Intronic
1132776446 16:1597420-1597442 TCTCCCAGGAGAGCACGGCCAGG - Intronic
1132788075 16:1669195-1669217 TTTTCCAGGGCAGCAGGGGCTGG + Intronic
1136873233 16:33827123-33827145 TCTCCCAGAGGTGCAGGGTCAGG - Intergenic
1136926125 16:34376136-34376158 GCTCCCAGGGAAACAGGCCCAGG + Intergenic
1136978449 16:35035671-35035693 GCTCCCAGGGAAACAGGCCCAGG - Intergenic
1138691524 16:58773296-58773318 TCTCTAAGGAGAGCAGGAGCAGG - Intergenic
1139322799 16:66129078-66129100 TCCCCCAGGGGATCAGGCTGAGG - Intergenic
1139650311 16:68359080-68359102 CCTCCCGGGGCAGCAGGCGTGGG - Exonic
1140031715 16:71344592-71344614 TCTCCCACAGGAGCAGGCTGGGG - Intergenic
1140469616 16:75206818-75206840 GCTCTCAGGGGAGGAGGCGGGGG - Intronic
1140895131 16:79317850-79317872 TCTCCAAATGGAGCAGGGGCTGG - Intergenic
1141135773 16:81464195-81464217 TCTCCCAGGGGAAGTGGCGTGGG + Intronic
1141354613 16:83333445-83333467 TCTCCCAGAAGAGCAGGGGGAGG - Intronic
1141515056 16:84538286-84538308 TCTCCCAGGGCAGCAGCCAAGGG - Intronic
1141576379 16:84966585-84966607 CCTCCCAGGGAAGGAGGGGCTGG + Intergenic
1142066655 16:88066832-88066854 TCTCCCAAGGGAGCACGAGAGGG - Intronic
1142070773 16:88090441-88090463 TCTCCCGGGGGCACAGGCCCTGG + Intronic
1142211164 16:88809273-88809295 TCTTCTAGGGGAGCAAGCGAGGG - Intergenic
1142220225 16:88850643-88850665 TCAGCCAGGGGAGAAGGTGCGGG + Intronic
1142412323 16:89923083-89923105 TCTCCCAGAGGAGCTGGCTGTGG - Intronic
1203098939 16_KI270728v1_random:1288932-1288954 TCTCCCAGAGGTGCAGGGTCAGG + Intergenic
1143096540 17:4481287-4481309 CCTCCCAGCAGAGCAGGGGCAGG + Intronic
1143587219 17:7856318-7856340 TCCCCAAGGGGAGCAGCGGCAGG - Intergenic
1144547943 17:16215274-16215296 GCTCCCGGGGCAGCAGCCGCTGG - Intronic
1144728532 17:17513745-17513767 CATCACAGGGGAGCGGGCGCTGG + Intronic
1145023795 17:19452694-19452716 TCTCCCAGGTGAACAGCCTCTGG + Intergenic
1145939763 17:28737229-28737251 TATCCCAGGAGACCAGGGGCTGG + Intronic
1146399410 17:32491657-32491679 TCTCCCAGGCCAGCAGGGGTGGG + Intergenic
1147387523 17:40090991-40091013 CCTCCCATGGGAGCAGGAGGTGG + Intronic
1147443626 17:40462085-40462107 TCCCCCAGGAGAGGAGGCGGGGG + Intergenic
1148335157 17:46835958-46835980 TCTCCCAGGGGCCCAGAGGCAGG - Intronic
1148479404 17:47950202-47950224 TCACCCTGGGGGCCAGGCGCTGG - Intergenic
1148734566 17:49858230-49858252 TCCCACAGGGAAGCAGGGGCTGG + Intergenic
1151655430 17:75493677-75493699 TCTGCCAGGGAAGCAGGCGGAGG - Exonic
1152178249 17:78801932-78801954 TCACCCAAGGGAGCAGACTCGGG + Intronic
1152261857 17:79271666-79271688 TCACCCAGGGAAGTAGCCGCAGG - Intronic
1152276725 17:79362427-79362449 TCACCCAGGGGACCAGGGGGTGG + Intronic
1152357257 17:79813305-79813327 CCTCCCGGGGGAGCGGGCGGGGG - Intergenic
1152609927 17:81310397-81310419 TCTGCCTGGGGAGCAAGCGGAGG - Intergenic
1152701450 17:81821856-81821878 CCTCCCCGGGGAGGAGGAGCAGG - Intergenic
1152741851 17:82021898-82021920 TCACCCAAGGCAGCAGGCGTGGG - Intronic
1152956264 18:44665-44687 TGTCCTAGGGGAGCAAGCACAGG - Intergenic
1153779271 18:8479695-8479717 GCTCACAGGAGAGAAGGCGCTGG - Intergenic
1153805215 18:8705060-8705082 GCGCCCTTGGGAGCAGGCGCAGG - Intergenic
1154218075 18:12430006-12430028 CCTCCCCGGGGATCAGGCCCTGG - Intronic
1154255791 18:12779840-12779862 TCTTCCTGCGGAGGAGGCGCGGG - Intergenic
1154343758 18:13525719-13525741 TCTCCCTGGGACCCAGGCGCAGG - Intronic
1156721120 18:40071097-40071119 TCTCACATGTGAGCAGGAGCAGG - Intergenic
1157188774 18:45562788-45562810 TCTCCCTGGGGGGAAGGGGCTGG + Intronic
1157571556 18:48715717-48715739 GCTCCCTGGGAAGCAGGCTCTGG + Intronic
1158393027 18:57058999-57059021 TGACCCAGGAGAGCAGGCGCTGG - Intergenic
1159607272 18:70487859-70487881 ACTCCCAAGGGAGTAGGGGCAGG + Intergenic
1159928669 18:74291343-74291365 GCTCCCAGGTGTGCACGCGCAGG + Intronic
1160228939 18:77032071-77032093 TGTCCCACTGGAGAAGGCGCCGG + Intronic
1161499743 19:4607301-4607323 TCTGCCGTGGGCGCAGGCGCTGG + Intergenic
1161506762 19:4648373-4648395 TCTCCCAGGGGAACAGGCCGAGG - Intronic
1162566611 19:11448343-11448365 ACTCCCAGGGGAGCTGGTGATGG + Intronic
1162573230 19:11484244-11484266 TCTCCCAGGACTGCAGGTGCAGG + Intronic
1163028388 19:14527692-14527714 ATTCACAGGGGAGCAGGCGGAGG - Intronic
1163314005 19:16530656-16530678 TCTCCCAGAGCTGCAGGAGCTGG + Exonic
1163861848 19:19747021-19747043 TGGCCCAGGGGAGGAGGGGCAGG - Intergenic
1164838853 19:31377334-31377356 TTCCCCAGGGGAGGAGGTGCTGG + Intergenic
1165304639 19:34996034-34996056 TCTCCCAAGGCATCAGGGGCAGG - Intronic
1165894185 19:39131631-39131653 CATCCCAGGGGAGCCAGCGCTGG + Intronic
1165914012 19:39247168-39247190 GCTCCCACGTGAGCAGGCGCAGG + Intergenic
1165916849 19:39265760-39265782 GCTCCCACGTGAGCAGGCGCAGG - Intergenic
1166213970 19:41323895-41323917 TCTGCTGGGGGAGCAGGAGCCGG - Exonic
1166518562 19:43464442-43464464 TCCCCCAGGAGCGCAGGCCCTGG - Exonic
1166871357 19:45872866-45872888 GCTCCCAGGGGAGCTGAAGCTGG + Exonic
1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG + Intronic
1168353200 19:55687927-55687949 TCTCCCTGACGAGCAGGCCCTGG - Intronic
925173436 2:1766765-1766787 GCTCCCAGAGGAGCAGGTGCAGG + Intergenic
927697886 2:25250560-25250582 TCTCGTAGGGGAGGAGGCGATGG - Intronic
928494040 2:31813520-31813542 GCACACAGGTGAGCAGGCGCAGG + Intergenic
928596238 2:32861855-32861877 ACTTCCAGGGGAGCAGCCCCTGG + Intergenic
932331659 2:70901372-70901394 TTGCCCAGGGGAGACGGCGCGGG + Intronic
932428511 2:71659057-71659079 TCCCCCAGAGTAGCAGGCTCAGG + Intronic
937993037 2:127674815-127674837 TCGCCCAGAGGAAGAGGCGCGGG + Intronic
938407270 2:131039591-131039613 TTTCCCAGGGGATCTGGGGCAGG - Intronic
939505269 2:143038350-143038372 TCTCCCAGAGGAGCAGGGACAGG - Intronic
944605435 2:201347863-201347885 CCCCTCAGGGGAGCAGGGGCGGG - Intronic
946161035 2:217836197-217836219 CCTCCCAGGGGTACAGGCTCGGG - Exonic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
947791700 2:232872504-232872526 TGACCCAGGGAAGCAGGGGCTGG - Intronic
948447211 2:238042300-238042322 TCTCCCAGGACAGCAGGGTCTGG - Exonic
948543038 2:238703504-238703526 TCTCCCAGGTGTGCAGGAACAGG + Intergenic
948710239 2:239820796-239820818 CCTCCCAGGGAATCAGGAGCAGG + Intergenic
948879970 2:240851617-240851639 TCTCCCAGGGGCTCAGACGTTGG + Intergenic
948886637 2:240888185-240888207 TCTCCCAGGTCAGCAGCCCCAGG - Intronic
948902242 2:240962691-240962713 TGTCCCAGAGGAGGAGGCGGAGG - Intronic
949026401 2:241768302-241768324 GCGGCCTGGGGAGCAGGCGCTGG + Exonic
1169115194 20:3059867-3059889 TCTCCCAGAGGCCCAGGCACTGG + Intergenic
1169695736 20:8385172-8385194 TCTCCCTGGGGCTCAGGCCCAGG + Intronic
1170433135 20:16295233-16295255 TCTCCATGGGGAGCAGGCCACGG + Intronic
1171499905 20:25585440-25585462 CCTCCCAGGTGAGCCGGCCCGGG - Exonic
1171961333 20:31497048-31497070 TCTCCCAGGAGACCTGGCCCTGG - Intergenic
1173006687 20:39145171-39145193 TCTCTCAGGGGTGCAGGAGCAGG + Intergenic
1173139606 20:40470696-40470718 ACTCCCAGGGGGGCAGGCGCTGG - Intergenic
1173248781 20:41353710-41353732 GCTCCCAGAGGGGCAGGTGCAGG - Intronic
1173407010 20:42774984-42775006 TCTCCCAGAGCAGCAGATGCTGG - Intronic
1175384167 20:58583696-58583718 TACCCCAGGGGAGCAGGAGCAGG + Intergenic
1176119900 20:63449706-63449728 TCTCCCAGGAGCTCAGACGCTGG - Intronic
1178512390 21:33216364-33216386 TCTCCCAGGGGGTCAGGGGAAGG - Intergenic
1178975679 21:37219379-37219401 TCTCACAGGTGAGCAGGCTGAGG - Intergenic
1179002729 21:37478235-37478257 TTTCTCAGGGGAGCAGTTGCTGG - Exonic
1180649780 22:17368891-17368913 TCTCCGAGGGAAGAAGGCGGTGG - Intronic
1181001888 22:19991650-19991672 AGCCCCAGGGGAGCAGGCGGGGG + Intronic
1181007963 22:20023165-20023187 TGCACCAGGGGAGCAGCCGCTGG - Intronic
1181107093 22:20581974-20581996 TCTCCCAGGGGCGCTGGTGTGGG + Intronic
1182043085 22:27253583-27253605 ACACCCAGGGGAGCAGGGGTGGG + Intergenic
1182475779 22:30575535-30575557 TCTCCCGGGGCTGCAGGCTCTGG + Intergenic
1182586664 22:31347302-31347324 TCTCACAGGGCTGCGGGCGCTGG - Intergenic
1183451589 22:37898896-37898918 TCACCCAGGCGGGCAGGGGCGGG + Intergenic
1184109533 22:42386974-42386996 TCTCCCAGGTACACAGGCGCTGG - Exonic
1184892562 22:47388920-47388942 GCCCCCAGGGCAGCAGGCCCGGG + Intergenic
1185107921 22:48884922-48884944 ACTCACAGGGGAGGAGGAGCTGG - Intergenic
1185127454 22:49019044-49019066 TCTCCCAGTGCAGCAGACACTGG - Intergenic
950096961 3:10336061-10336083 GCTCCCAGGCGGGCAGGGGCTGG - Intronic
950553653 3:13682462-13682484 TCTCCCTGTGGGGCAGGCCCAGG - Intergenic
952598160 3:35044206-35044228 TCTCCCATGTGAGGAGGCCCTGG + Intergenic
954628013 3:52033251-52033273 TCTCCCAGCCGTGCAGGCCCAGG - Intergenic
955291058 3:57692850-57692872 TGTCCCAGCGCAGCAGGCCCCGG + Exonic
961006643 3:123410081-123410103 TCTCCCACATGAGCAGGTGCTGG + Intronic
963547023 3:146672213-146672235 AATCCCAGGGGAGCAGGCTAGGG + Intergenic
966421527 3:179739157-179739179 TCTGCCAGTGGAGAAGGCTCAGG - Intronic
966775155 3:183537148-183537170 TCTCCCAGAGGAGCAGCAGGAGG - Intronic
967915935 3:194578207-194578229 TGTCCCAGCCGAGCAGGGGCTGG - Intergenic
968358073 3:198123576-198123598 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
968468406 4:764690-764712 TCTGCAGGGGGTGCAGGCGCAGG - Intronic
968551617 4:1226339-1226361 TCTCCCTGGGGAGGAGGAGGGGG + Intronic
969036209 4:4255943-4255965 ACTCCCAGGGGAGCAGCAGCAGG + Intergenic
970332422 4:15001417-15001439 TCTCCCTGGGGGGAAGGGGCGGG + Intergenic
970494243 4:16609334-16609356 ACTCCCAGGGGAGGGGGCGGGGG + Intronic
971264871 4:25088595-25088617 TCTCCCACGCAGGCAGGCGCCGG + Intergenic
974894843 4:67926714-67926736 GCTCCCAGGGTGGCAGGCTCTGG - Intronic
980990477 4:139735019-139735041 TCTGCGAGGGGAGGGGGCGCGGG - Intronic
981152510 4:141395728-141395750 TCTCCCAGGAAAGCAGTCCCTGG - Intergenic
983000581 4:162409154-162409176 GCTCCCAAGGTAGCAGGCGCTGG + Intergenic
983656821 4:170091657-170091679 TCCCCCAGTGGAGCCGGCACTGG - Intronic
985111898 4:186555153-186555175 TGGCCCAGGGGAGGCGGCGCGGG + Intronic
985164794 4:187081966-187081988 CCTCCCAAGGGAGCAGGAACTGG - Intergenic
985552152 5:539238-539260 CCTCCCAGGCGAGCTGACGCAGG - Intergenic
985580498 5:693263-693285 TCTCCAAGGTAAGCGGGCGCGGG - Exonic
985595156 5:784653-784675 TCTCCAAGGTAAGCGGGCGCGGG - Intergenic
985716482 5:1466089-1466111 GCTCCCAGGGCTGCAGGCCCTGG - Intronic
985769002 5:1797434-1797456 TCTCCAGGGGGAGCAGACGCCGG - Intergenic
985967277 5:3347352-3347374 TCCCCCAGGGAAGCTGGCGCTGG - Intergenic
987217560 5:15753114-15753136 CCTCCCTAGGGAGCAGGCGGGGG + Intronic
990008716 5:50969994-50970016 TCGCCCAGAGGAGCAGCCTCAGG - Intergenic
990594303 5:57297722-57297744 CCTCCCAGGTGAGCAGGAGATGG + Intergenic
992399960 5:76403159-76403181 TCCCCCGGGGGAGAAGGGGCGGG + Intergenic
993556170 5:89342109-89342131 TCTCCCAGGGCAGCAGTAGCTGG - Intergenic
996713659 5:126568477-126568499 TGTCCCAGGGGAGCAAGGGAAGG + Intronic
997584872 5:135038261-135038283 TCTCCCATGAAAGCAGCCGCTGG - Intronic
999143815 5:149379703-149379725 TCTCCCAGGGAAACAGCCTCAGG + Intronic
1000041212 5:157486480-157486502 AGTCCCAGGGGTGCAGGTGCAGG + Intronic
1000343919 5:160298511-160298533 AGGCCCAGGGGAGCAGGCGCTGG - Intronic
1001281779 5:170391212-170391234 TCCCCCAGGGAAGCAGGAGGGGG - Intronic
1001555235 5:172632565-172632587 GCTCCCTGGGGAGTAGACGCAGG - Intergenic
1003687071 6:8314982-8315004 CCTCCTAGGGGATCAGGCCCAGG + Intergenic
1003812599 6:9801445-9801467 TCTCACGGTGGAGCAGGCGTGGG + Intronic
1006369596 6:33635773-33635795 TCCCCCAGGGGAGTGGGCACTGG - Intronic
1006408758 6:33859942-33859964 TCTGCCATGGGAGCAGGCCCCGG - Intergenic
1006451018 6:34105710-34105732 TAGCCCAGGGGAGCAGCAGCTGG - Intronic
1007427384 6:41756439-41756461 CCTCTCAGGGGAGCAGACCCAGG - Intergenic
1007504998 6:42328860-42328882 TCTCTCAGGTGAGCATGAGCTGG - Intronic
1007731657 6:43951225-43951247 TCTCCCAGGGCAGGAGGCATGGG + Intergenic
1010804868 6:80223829-80223851 TCTTCCAGGGGAGCTTGGGCTGG + Intronic
1011701762 6:89961760-89961782 TCTGCCAGGGGTGTAGTCGCAGG - Intronic
1014465265 6:121749111-121749133 TCTCCCATGGGAGCAGCGGTTGG + Intergenic
1015492122 6:133838100-133838122 AGCCCCCGGGGAGCAGGCGCGGG - Intergenic
1017103099 6:150865740-150865762 CGTGCCAGGGGAGCAGGCGGCGG - Exonic
1017446034 6:154508779-154508801 TCTCCCAGAGGAGCAGGAAATGG + Intronic
1017665918 6:156720108-156720130 CCTCCCCGGGGAGCGGGTGCGGG - Intergenic
1017962495 6:159233855-159233877 TCTCCCACAGGCGCAGGGGCAGG + Exonic
1018031513 6:159845296-159845318 CCTCCCAGGAGAGCCGGCACTGG - Intergenic
1019345169 7:526241-526263 GCTCCCAGGGAAACAGGCCCCGG - Intergenic
1019662614 7:2233041-2233063 TCTCCCAGGGGTGGCGGCTCCGG - Exonic
1020373752 7:7461989-7462011 TCACCCACTGGAGCAGGCGCTGG + Intronic
1021097085 7:16547225-16547247 GCTCCCAGGGTGGCAGGCTCTGG - Intronic
1022831965 7:34076816-34076838 TCTCAGTGGGGAGCAGGCACAGG - Intronic
1025943011 7:66087396-66087418 TCTCCCTGGGGAGGAGGGGCAGG - Intronic
1029570025 7:101363151-101363173 GCTGCCAGGGGAGCCGGCGCCGG - Exonic
1029647630 7:101868371-101868393 CAGCCCAGGGGAGGAGGCGCTGG - Intronic
1031528539 7:122850244-122850266 GCCCCCAGTGGAGCAGGAGCTGG - Intronic
1032078383 7:128846737-128846759 TCTCTCAGGGGAGCGGGCACCGG + Exonic
1032501850 7:132405553-132405575 CCTCCCAGGGGAGGAGGTGTCGG + Intronic
1032525695 7:132577077-132577099 CCTCCCCGGGGAGCAGCCGGCGG - Exonic
1033245612 7:139714393-139714415 TCTCCCAGGGAAGGAGGGCCTGG + Intronic
1034210566 7:149358875-149358897 GCTCCCAGGGCAGCAGGCTCCGG + Intergenic
1034324614 7:150219786-150219808 TCTCCCGCGGGCGCTGGCGCTGG - Intergenic
1034327290 7:150248143-150248165 TGTCCCAGGGAAGCAGGCCATGG + Intronic
1034765919 7:153721314-153721336 TGTCCCAGGGAAGCAGGCCATGG - Intergenic
1034768580 7:153749445-153749467 TCTCCCGCGGGCGCTGGCGCTGG + Intergenic
1034983203 7:155491350-155491372 GCTACCAGGCGACCAGGCGCAGG + Intronic
1035340522 7:158157774-158157796 TCTCCCAGGGGAGCAGGCGCAGG - Intronic
1035574859 8:697853-697875 TCTCCCAGGGGCTCAAGCCCAGG - Intronic
1036034453 8:5003973-5003995 CCTCCCCAGGGAGCAGGCCCAGG + Intergenic
1037258610 8:16982295-16982317 TCATGCAGGTGAGCAGGCGCAGG - Intergenic
1043359295 8:79452074-79452096 ACTACCTGGGGAGCAGGAGCAGG + Intergenic
1046497842 8:115037103-115037125 CCTGCCAGGGCAGCAGGCGGAGG - Intergenic
1048112928 8:131487454-131487476 TCACCCAGTGGATCAGGCACCGG - Intergenic
1048579703 8:135720716-135720738 TCTCACAGCAGAGCAGGAGCAGG - Intergenic
1049086150 8:140480111-140480133 TTTCCCTGGGGAGGAGGGGCTGG - Intergenic
1049170661 8:141158790-141158812 TCTCCCTGGGCAGCAGGGGTAGG + Intronic
1049391660 8:142374837-142374859 TCAGCCTGGGGAACAGGCGCTGG + Intronic
1049496642 8:142938792-142938814 TCTCCCAGGGCAGCCGGTGATGG - Intergenic
1049746422 8:144265131-144265153 CCGCCCAGGGGAGCAGGTGAGGG + Intronic
1050151152 9:2621234-2621256 TCTCTCAGGGGCGCAGGAGAGGG + Intergenic
1053019487 9:34685015-34685037 TCTCCCAAGGGGCCAGGGGCAGG - Intergenic
1053135987 9:35650528-35650550 TGTCCCAGTGGACCAGGGGCCGG - Exonic
1053433504 9:38059420-38059442 TCTCCAAGGGGAGCTGTCTCTGG - Intronic
1056214318 9:84393447-84393469 TCTGCAAGGGGCACAGGCGCTGG + Intergenic
1057310570 9:93940552-93940574 TCTCCTAGGGAAGCTGGTGCCGG - Intergenic
1059347061 9:113636238-113636260 TCTCCGTGGGGACCAGGCCCTGG - Intergenic
1060154607 9:121310638-121310660 TAGCCCAGGGGAGAAGGCCCAGG - Intronic
1060410041 9:123394325-123394347 TCTCCGAGAGGGGCAGGCACAGG + Intronic
1060412337 9:123408103-123408125 TGGCCCAGGGTAGCAGGGGCTGG - Intronic
1061288096 9:129635677-129635699 TCTCGCAGGAGAGCAGGGTCTGG - Exonic
1061677962 9:132229076-132229098 ACTCCCAGGGAAGCAGGAGGTGG - Intronic
1061974166 9:134060007-134060029 TCTCCCAGAGGAGGGGGCGGAGG + Intronic
1062085453 9:134645810-134645832 TCTCCCCGGGGAGAAGGCCAGGG + Intronic
1062478596 9:136741449-136741471 GGTCCCACGGGAGCAGGGGCGGG - Intronic
1062741940 9:138180111-138180133 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
1185791816 X:2932934-2932956 ACTCCCAGGGGAGAATGTGCTGG + Intergenic
1186509076 X:10117147-10117169 TGTCCTCGGGGAGCAGCCGCGGG + Exonic
1187446975 X:19369014-19369036 CCTCCTCTGGGAGCAGGCGCTGG - Intronic
1189407102 X:40735309-40735331 GCTCCCGGGGGAGGAGGGGCTGG + Exonic
1193185606 X:78508281-78508303 CCTCCCACCGGAGCAGGTGCTGG + Intergenic
1195084524 X:101401735-101401757 ACTCCCAGGGAAGCCTGCGCAGG + Exonic