ID: 1035342696

View in Genome Browser
Species Human (GRCh38)
Location 7:158174326-158174348
Sequence ATGGTGAAGATGATGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 852
Summary {0: 1, 1: 5, 2: 12, 3: 170, 4: 664}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035342696 Original CRISPR ATGGTGAAGATGATGGTGGT GGG (reversed) Intronic
900484423 1:2914686-2914708 ACAGTGACGATGATGGTGATGGG + Intergenic
900551882 1:3260692-3260714 TTGATGATGGTGATGGTGGTGGG + Intronic
900742093 1:4336679-4336701 ATGGTGATGATGGTGGTGATGGG + Intergenic
900747304 1:4369515-4369537 ATGATGATGATGATGATGATGGG + Intergenic
900747327 1:4369713-4369735 ATGGTGATGATGATAATGTTGGG + Intergenic
901194088 1:7430572-7430594 ATGGTGGAGGTGATGGTGACAGG + Intronic
901218477 1:7568177-7568199 ATGGTGATGTTGATGATGGATGG - Intronic
901218504 1:7568394-7568416 ATGGTGATGTTGATGATGGATGG - Intronic
901218542 1:7568718-7568740 ATGGTGATGTTGATGTTGGATGG - Intronic
901218552 1:7568792-7568814 ATGGTGATGTTGATGATGGATGG - Intronic
901218563 1:7568901-7568923 ATGGTGATGTTGATGATGGATGG - Intronic
901218597 1:7569216-7569238 ATGGTGATGATGATGGATGATGG - Intronic
901218605 1:7569293-7569315 ATGGTGATGTTGATGATGGTTGG - Intronic
901218614 1:7569368-7569390 ATGGTGATGTTGATGATGGTTGG - Intronic
902095565 1:13941750-13941772 GTGGTGGTGGTGATGGTGGTAGG - Intergenic
902231266 1:15029193-15029215 ATGGTGAGGAGGAGGGTGGATGG + Intronic
902551073 1:17219937-17219959 ATCGTGCAGATGATGGTGGCTGG + Intronic
902597932 1:17521829-17521851 ATGGTGAAGCTGAGGTTGGAAGG + Intergenic
902681875 1:18049441-18049463 ATGGTGATGGTGATGCTGCTGGG + Intergenic
902800318 1:18825532-18825554 ATGGTGATAATGACGGTGGTAGG - Intergenic
902800359 1:18825798-18825820 GTGGTGATAATGACGGTGGTAGG - Intergenic
902805401 1:18858237-18858259 ATGGTAGTGATGATGGTGATGGG - Intronic
903285519 1:22274527-22274549 ATGGTGATGATGATGGGTGCTGG + Intergenic
903476941 1:23626085-23626107 ATGGTGATGGTGATGATGATGGG + Intronic
903476959 1:23626190-23626212 ATGATGGGGATGATGATGGTGGG + Intronic
903476963 1:23626205-23626227 ATGGTGGGGATGATGGTGATGGG + Intronic
903476978 1:23626268-23626290 ATGATGGGGATGATGATGGTGGG + Intronic
903476982 1:23626283-23626305 ATGGTGGGGATGATGGTGATGGG + Intronic
903583075 1:24386992-24387014 ATGGTGATGATGATGATGGCGGG - Intronic
904324440 1:29718916-29718938 ATGGTGATGATGATGAAGGTGGG - Intergenic
904325097 1:29723220-29723242 ATGGTGATAATGGTGGTGGTGGG - Intergenic
904576635 1:31509243-31509265 ATGGTGTAGCAGATGGTGGCAGG - Intergenic
904645276 1:31961015-31961037 ATGTTAAAGATCATGGTGGAGGG - Intergenic
905066904 1:35192279-35192301 CTGGTGATGCTGCTGGTGGTAGG + Exonic
906076778 1:43057763-43057785 ATGGTAAGGATGGTGGTGGTGGG + Intergenic
906684709 1:47755926-47755948 ATGATGAAGATGAGGGAGGACGG - Intergenic
906932747 1:50185669-50185691 AGGATGAAGATGATGGTGAATGG + Intronic
907070140 1:51527098-51527120 ATGGTTAAGATGATGGACTTTGG + Intergenic
907637908 1:56155283-56155305 GTGGTGGAGGTGATGGTGTTGGG + Intergenic
907770051 1:57452587-57452609 GTGGTGCTGGTGATGGTGGTGGG + Intronic
908966667 1:69773337-69773359 TGGGTGCAGATGATGATGGTTGG + Intronic
909345301 1:74578299-74578321 ATGATGATGATGATGGTGATGGG + Intronic
909468893 1:76004171-76004193 TTGATGTAGATGATGGTGGGTGG - Intergenic
909520888 1:76566468-76566490 ACAGTGAAGATGCTGGAGGTAGG - Intronic
909732974 1:78918975-78918997 GGGGTGAAGATAATGGTGGAAGG + Intronic
910250147 1:85188810-85188832 GAGGTGAAGATGTTGGTGGCTGG + Intronic
911573629 1:99548311-99548333 ATGATGATGATGATGGTACTGGG + Intergenic
912228934 1:107769736-107769758 ATGGTGAAGATTACAGGGGTGGG - Intronic
912415064 1:109502481-109502503 GTGGTGAGGATGTGGGTGGTGGG + Intronic
912637393 1:111310274-111310296 AAGGTGGTGATGCTGGTGGTGGG + Intronic
912747641 1:112258754-112258776 ATAGTGATGATGGTGGTGGTGGG - Intergenic
913091208 1:115477923-115477945 ACTGTGTAGATGATGGGGGTGGG - Intergenic
913223308 1:116676820-116676842 GTGGTGATGATGGAGGTGGTGGG + Intergenic
913276172 1:117140341-117140363 ATGGTGATGGTGATGGTGCTAGG + Intergenic
913510704 1:119559031-119559053 ATGACCAACATGATGGTGGTAGG + Intergenic
913518344 1:119623621-119623643 ATGGTGGGCATGATGGGGGTGGG - Exonic
914442852 1:147722310-147722332 GTGGAGAAGGTGATGGGGGTGGG + Intergenic
914865889 1:151428296-151428318 GTGGTGAAGGTGTTGGTGGTGGG + Exonic
915075571 1:153306052-153306074 ATGGTGGAGGTGCTGGTGGCAGG + Intronic
916146500 1:161744822-161744844 ATGATGATGATGATGATGATTGG + Intergenic
916478897 1:165197424-165197446 ATGATGAAGGTGTTGGTGATAGG - Intergenic
916506604 1:165433795-165433817 ATGGTCCAGTTGATGGTGGGAGG - Intronic
916994823 1:170285174-170285196 ATGGTGATGGTCATGGTGGCAGG - Intergenic
917108798 1:171523328-171523350 ATGCTGAAGCTGATGAAGGTTGG + Exonic
917271381 1:173278483-173278505 ATGGCATAAATGATGGTGGTAGG - Intergenic
917670644 1:177270477-177270499 ATGATGAACAAGATGATGGTGGG + Intronic
917670647 1:177270480-177270502 ATGAACAAGATGATGGTGGGGGG + Intronic
919678300 1:200409265-200409287 GTGGTGGTGATGGTGGTGGTGGG + Exonic
919794093 1:201310786-201310808 AGGGTGTGGCTGATGGTGGTAGG + Intronic
920344029 1:205294414-205294436 ATGGTGAGGAGGATGGAGGCAGG + Intergenic
921168288 1:212523262-212523284 GTGGTGAGGGTGCTGGTGGTGGG + Intergenic
922000349 1:221471263-221471285 ATGGGGAGGGTGATGGTGGAAGG - Intergenic
922056311 1:222045536-222045558 AAGGGGGAGATGATGGTGTTAGG + Intergenic
922174677 1:223188172-223188194 ATGGAGAACAGGTTGGTGGTTGG + Intergenic
922878562 1:228960946-228960968 AGGGTGCAGATGAGGGTGGAGGG + Intergenic
923231913 1:231994654-231994676 ATGGTGATGATGGTGGTGCTGGG + Intronic
923334431 1:232954941-232954963 CTGGAGAAGATGATGTTGGAAGG + Intronic
923532054 1:234819379-234819401 ATGGTGGCGGTGGTGGTGGTGGG - Intergenic
924044463 1:240012793-240012815 AAACTGAAGATGGTGGTGGTGGG + Intergenic
924680212 1:246223315-246223337 CTGATGAAGGGGATGGTGGTAGG + Intronic
1063648354 10:7908530-7908552 ACGGTGACCATGATGGTGTTGGG - Intronic
1063730639 10:8693357-8693379 ATGATGACGGTGATGTTGGTAGG - Intergenic
1063740014 10:8807258-8807280 TTGGAGAAGTTGATGGTGCTTGG - Intergenic
1063905143 10:10773949-10773971 ATGGGGAAGATAATGATGGGAGG - Intergenic
1064028761 10:11869858-11869880 TTGGTGACGATGATGTTGCTGGG - Exonic
1064328607 10:14373500-14373522 CTGGGGCAGATGATGGAGGTGGG - Intronic
1065115599 10:22479870-22479892 ATGGTGATGGTGATGGTGATGGG - Intergenic
1065295428 10:24269945-24269967 CTGCTGCAGATGATGGTAGTGGG - Intronic
1065367608 10:24951632-24951654 ATGGTGGTGAGGATGGTGGGTGG - Intronic
1066467616 10:35667397-35667419 ATGGTGATGGTGGTGATGGTGGG - Intergenic
1066467646 10:35667563-35667585 ATGGTGGTGATGATGGTGGGGGG - Intergenic
1066467659 10:35667612-35667634 ATGGTGGTGGTGATGGTGGGGGG - Intergenic
1068632087 10:59308562-59308584 CTGGTGGTGGTGATGGTGGTTGG - Intronic
1068632094 10:59308590-59308612 GTGGTGATGGTGATGCTGGTTGG - Intronic
1068846267 10:61678406-61678428 ATCCTGATGATGGTGGTGGTAGG - Intronic
1070577392 10:77689525-77689547 ATGATGATGATGATGATGATAGG - Intergenic
1070740735 10:78901416-78901438 ATGATGGTGATGGTGGTGGTGGG - Intergenic
1070790062 10:79183825-79183847 CTGGTGATGATGATGATGATAGG - Intronic
1070796343 10:79219103-79219125 GGGGTGAGGATGATGGTGGCTGG + Intronic
1070906552 10:80078580-80078602 AGGGAGAAGATGGTGCTGGTTGG - Intergenic
1071158122 10:82715021-82715043 ATAGTGCTGATGATGGTGGGTGG - Intronic
1071451130 10:85792155-85792177 ATGGTGTAGATGATGGTTTCAGG - Intronic
1072060773 10:91808578-91808600 ATGCTGGAGGTGATAGTGGTTGG + Intronic
1072914463 10:99529089-99529111 ATGGTGGCGGTGGTGGTGGTGGG - Intergenic
1073886982 10:108050629-108050651 ATGGTGATGTTGTTGATGGTAGG + Intergenic
1074134641 10:110615945-110615967 ATGGTGCTGAGGATGCTGGTGGG - Intergenic
1074379178 10:112964793-112964815 ATGGTGGTGGTGGTGGTGGTGGG + Intronic
1074936655 10:118188485-118188507 AGGGTAGAGATGATGGTGCTTGG + Intergenic
1074970571 10:118533147-118533169 ATTATGGTGATGATGGTGGTGGG + Intergenic
1075301911 10:121332537-121332559 ATGATGATGATAGTGGTGGTGGG + Intergenic
1075534119 10:123255762-123255784 ATGGTGATGGTAATGATGGTGGG - Intergenic
1075538691 10:123294345-123294367 ATGCTGAGGAAGATGGGGGTGGG - Intergenic
1075823700 10:125335671-125335693 ATGGTGTAGGTCATGTTGGTGGG + Intergenic
1075926700 10:126256927-126256949 ATGATGATGATGATGATGGAGGG + Intronic
1076005748 10:126947272-126947294 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005754 10:126947306-126947328 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005770 10:126947405-126947427 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005783 10:126947473-126947495 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005795 10:126947538-126947560 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005825 10:126947702-126947724 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005831 10:126947736-126947758 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005837 10:126947770-126947792 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005855 10:126947872-126947894 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005887 10:126948039-126948061 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005893 10:126948073-126948095 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005899 10:126948107-126948129 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005905 10:126948141-126948163 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005916 10:126948206-126948228 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005922 10:126948240-126948262 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005928 10:126948274-126948296 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005934 10:126948308-126948330 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005940 10:126948342-126948364 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076005946 10:126948376-126948398 TTGGTGGTGATGGTGGTGGTTGG + Intronic
1076098273 10:127752063-127752085 ATGGTGAAAGTGCTGGTAGTGGG + Intergenic
1076713240 10:132350584-132350606 ACGGGGAAGATGAGGGTGGAAGG + Intronic
1076720871 10:132392336-132392358 ATGGTGATAGTGATGGTGGTGGG + Intergenic
1076728783 10:132427388-132427410 ATAGTGATGATGATGATGATGGG - Intergenic
1077416996 11:2428644-2428666 ATAGTGATGGTGATGGTGGTGGG + Intergenic
1077417009 11:2428761-2428783 GTGATGATGATGATGGTGGTGGG + Intergenic
1077417016 11:2428795-2428817 GTGGTGGTGATGATTGTGGTGGG + Intergenic
1077810616 11:5632777-5632799 ATGGGGCAGAAGATGGTAGTTGG + Intronic
1078357419 11:10642728-10642750 ACGGTGAAAGTGGTGGTGGTGGG + Intronic
1078430923 11:11287891-11287913 ATGGATTAGATGATGGTAGTCGG - Intronic
1078639410 11:13081232-13081254 ATGGGGATGGTGATGATGGTAGG + Intergenic
1078798852 11:14622811-14622833 ATGGTGTAGGTGACAGTGGTGGG + Intronic
1078822506 11:14895925-14895947 GTGATGATGATGATGGTGGTGGG + Intergenic
1078873106 11:15367340-15367362 ATAGTGAAGATGATGCTTTTGGG + Intergenic
1079129937 11:17741470-17741492 ATGGTGAACATGGAGGTGGAGGG - Intronic
1080107998 11:28532078-28532100 CTGATGCTGATGATGGTGGTAGG - Intergenic
1080685112 11:34509010-34509032 ATGGTGATGATGATGGTGGTTGG - Intronic
1080749282 11:35138149-35138171 GTGGAGAAGAGGATGGTGGATGG + Intergenic
1080757256 11:35213716-35213738 ATGGTGATAATGATGGTGATGGG + Intronic
1081201454 11:40221429-40221451 ATGGTGAAGATGCTATTGGGAGG + Intronic
1081428116 11:42947515-42947537 ATGGGGATGATGATGGTGAAAGG + Intergenic
1081733847 11:45390210-45390232 ATGGTGTTGATGATGGTAGGAGG + Intergenic
1082177371 11:49076691-49076713 ATGCTAATGATGATGGTGGCTGG - Intergenic
1082766906 11:57176510-57176532 ATGGTGATGATGATGATGACAGG - Intergenic
1082768898 11:57190432-57190454 TTGGACAAGATGATGGCGGTGGG - Exonic
1084341558 11:68506709-68506731 ATGGGGAAGATGATGGTCAGGGG - Intronic
1084444331 11:69194807-69194829 ATGGTGATGATGATTATGGTAGG + Intergenic
1084444369 11:69195127-69195149 ATGGTGATGATGATGATGATGGG + Intergenic
1084686946 11:70701896-70701918 ATGGTGGTGATGATGGAGGGTGG - Intronic
1084687025 11:70702489-70702511 GTGGTGCTGATGATGGTGATGGG - Intronic
1084738807 11:71124247-71124269 ATGGTGATGATGTTGGTGAAGGG + Intronic
1085531170 11:77192895-77192917 ATGGTGTTGGTGATGGTGGAGGG + Intronic
1085574555 11:77590302-77590324 ATGATGCAGATGATGCTGGGGGG + Exonic
1085705240 11:78781309-78781331 AGGATGAAGATGATGGCAGTAGG + Intronic
1085754739 11:79193091-79193113 ATGGTGAGGTTGGTGCTGGTGGG - Intronic
1086634963 11:89070495-89070517 GTGGTGATGATGATGATGATGGG + Intergenic
1086688348 11:89759147-89759169 ATGCTAATGATGATGGTGGGTGG + Intergenic
1086717512 11:90080798-90080820 ATGCTAATGATGATGGTGGGTGG - Intergenic
1087260206 11:96002617-96002639 ATGGAGATGATGATGATGATGGG + Intronic
1088258764 11:107925739-107925761 GTGGTGAGGATGGTGGGGGTGGG + Intronic
1088425056 11:109693446-109693468 GTGCTGGAGGTGATGGTGGTGGG - Intergenic
1090328053 11:125905580-125905602 ATGATGAAGAAGATGTAGGTAGG + Exonic
1092829939 12:12433945-12433967 GTGGTGTGGATGTTGGTGGTTGG + Intronic
1093112289 12:15166481-15166503 ATGATGATGATGATGATGATGGG + Intronic
1093759392 12:22890411-22890433 GTGGTGATGTTGGTGGTGGTGGG + Intergenic
1093957102 12:25233113-25233135 ATGGTGGTGGTGGTGGTGGTAGG - Intronic
1094032911 12:26033998-26034020 CTGGTCGACATGATGGTGGTGGG - Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099573866 12:84357834-84357856 ATGGTGAAGCTGATGCTGCATGG + Intergenic
1099736511 12:86573563-86573585 ATGGTGGTGATGTTGGTGGTAGG - Intronic
1100331127 12:93583163-93583185 ATGATGATGATGATGATGGCTGG - Intronic
1100380232 12:94054942-94054964 GTGGTGGTGATGGTGGTGGTTGG - Intergenic
1101098519 12:101368623-101368645 AAGGTGATGATGATGATGATTGG - Intronic
1101265128 12:103076404-103076426 CTGGCCAACATGATGGTGGTAGG - Intergenic
1101716970 12:107319929-107319951 GTGGTGGTGATGGTGGTGGTTGG - Exonic
1101740670 12:107497491-107497513 GTGGTGATGATGATGGTGGTGGG - Intronic
1101744602 12:107529439-107529461 ATGGCAATGATGATGGTGATGGG + Intronic
1102281286 12:111620942-111620964 GTGGGGAGGATGATGGTGGTTGG - Intergenic
1102461230 12:113100786-113100808 ATGATGATGATGATGGTAGATGG - Intronic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102737716 12:115178221-115178243 ATGCTGATGGTGATGGTGATGGG - Intergenic
1102822342 12:115918417-115918439 ATGATGTAGAAGATGGTGGTGGG - Intergenic
1102845419 12:116176394-116176416 ATGATGATGATGATGATGATGGG - Intronic
1103059739 12:117848764-117848786 ATGGTGGTAATGATGGTGGTGGG + Intronic
1103158577 12:118708227-118708249 ATGGTAATGGTGATGGTGGTAGG + Intergenic
1103934406 12:124467740-124467762 GTGATGAAGATGAGGGTGATGGG - Intronic
1104030068 12:125058652-125058674 ATGCAAAAGATGATGGTGGCTGG - Intergenic
1104050414 12:125190550-125190572 ATGGTGATAGTGATGGTGATAGG + Intronic
1104050431 12:125190617-125190639 ATAGTGATGGTGATGGTGATGGG + Intronic
1104050552 12:125190968-125190990 GTGGTGATGGTGATGGTGATGGG + Intronic
1104050637 12:125191230-125191252 GTGGTGATGGTGATGGTGATGGG + Intronic
1104315524 12:127696656-127696678 TTGGTGGAGGTGATGGTGATGGG + Intergenic
1104421459 12:128639177-128639199 ATGGTGGTGATGGTGATGGTGGG + Intronic
1104503829 12:129311656-129311678 GTTGTGAAGAAGTTGGTGGTGGG + Intronic
1104663129 12:130626769-130626791 ATGGTGATGATTTTGGTGGTAGG - Intronic
1105527359 13:21188296-21188318 ATGGGGATGATGATGGAGGAGGG - Intergenic
1105583860 13:21725914-21725936 ATGGTGATGGTGATGGTTGGTGG - Intergenic
1106356622 13:28989652-28989674 ATGGGGAGGATGAGGGTGGACGG + Intronic
1106693798 13:32147951-32147973 ATGGAGAAGATTCCGGTGGTGGG + Intronic
1107354801 13:39555840-39555862 ATGTTGAAGATGTTGCAGGTGGG + Intronic
1107400354 13:40063341-40063363 ACGGTGCAGATGATGCTGATTGG - Intergenic
1107725297 13:43293026-43293048 ATGGTGAAGGTGGCTGTGGTGGG - Intronic
1107725344 13:43293314-43293336 GTGGTGAAGATGGCCGTGGTGGG - Intronic
1107986947 13:45783917-45783939 GTGGTGAAGGTGGTGGGGGTGGG + Exonic
1108063284 13:46553473-46553495 ATGGTGGTGGTGGTGGTGGTGGG - Exonic
1108468272 13:50740997-50741019 ATGGGGAAGCAGGTGGTGGTAGG - Intronic
1110128142 13:71974314-71974336 ATGCTGATGATGATGCTGGTGGG + Intergenic
1110356151 13:74570150-74570172 AAGGTGTAGATCATGGAGGTAGG + Intergenic
1111915329 13:94354840-94354862 GCTGTGATGATGATGGTGGTGGG + Intronic
1112739249 13:102454970-102454992 ATAGTGAAGTAGATGGTGATGGG - Intergenic
1113259769 13:108548609-108548631 ATGGTGTGGATGATGATGATAGG + Intergenic
1113659083 13:112092351-112092373 ATATTGAAGTTAATGGTGGTAGG + Intergenic
1114301904 14:21385835-21385857 ATGGTGATGGTGGTGATGGTGGG + Exonic
1114301908 14:21385841-21385863 ATGGTGGTGATGGTGGGGGTGGG + Exonic
1115423038 14:33220207-33220229 CTGCTGAGGATGATGGAGGTAGG - Intronic
1115578587 14:34735971-34735993 CTGGTGAGGGGGATGGTGGTAGG - Intergenic
1117805999 14:59491283-59491305 ATAGAGAAGACGATGCTGGTGGG + Intronic
1118813084 14:69289591-69289613 ATGGTGGTGATAGTGGTGGTGGG + Intronic
1119188316 14:72660758-72660780 ATGGTGATGGTGATGGTGATGGG + Intronic
1119627594 14:76193347-76193369 ATGGTGAAAATGATGGATGGGGG + Intronic
1121418495 14:93795848-93795870 ATGGTGTACATGATGGAGGCCGG - Intergenic
1121439390 14:93939268-93939290 ATGGCGAACATGATGGTGGCGGG + Exonic
1121554406 14:94825367-94825389 ATGGGGAAGATGAATGGGGTGGG + Intergenic
1121586537 14:95066835-95066857 ATGGTGATCATAATGGTGGTTGG - Intergenic
1122688209 14:103519943-103519965 CTGGTGCAGATGGTGGTGGACGG - Exonic
1123058607 14:105584245-105584267 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1123082938 14:105704479-105704501 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1123186366 14:106521215-106521237 GTAGTGAAGATGAGGGAGGTGGG - Intergenic
1124430170 15:29600435-29600457 ATGATGATGATGATGATGGTGGG - Intergenic
1124466991 15:29949031-29949053 GTGGCGGAGGTGATGGTGGTGGG - Intronic
1126330594 15:47526689-47526711 TTGGTGGTGGTGATGGTGGTTGG + Intronic
1126492497 15:49253836-49253858 ATGATGATGATGATGATGCTTGG - Intronic
1126870451 15:52981481-52981503 GTAGTGATGATGATGGAGGTGGG - Intergenic
1126905156 15:53357088-53357110 ATGATGCAGATGCTGCTGGTGGG + Intergenic
1126910934 15:53416218-53416240 ATGCTGAAGGTGATGGTATTTGG + Intergenic
1128270986 15:66309411-66309433 ATGGTGATGATGATGATAATAGG + Intronic
1128285244 15:66431026-66431048 ATGGTGAATGTGATGGAGGTTGG + Intronic
1128606888 15:69043254-69043276 ATGGTGATGATGATGATGAGGGG - Intronic
1128774959 15:70313350-70313372 GTGGTCATGATGAGGGTGGTGGG - Intergenic
1129113981 15:73354777-73354799 ATGATGATGATGATGATGATGGG - Intronic
1129184289 15:73896503-73896525 AAGATGAAGATGATGGTGGGGGG + Intergenic
1129330920 15:74826713-74826735 ATGGTGAAGACCATGGTGGGCGG + Exonic
1130863855 15:87915078-87915100 TTGGTGATGATGCTGGTGATGGG + Intronic
1130978757 15:88797831-88797853 GTGGTTGTGATGATGGTGGTGGG + Intergenic
1130996566 15:88907587-88907609 GTGGTGAGGATGAGGGGGGTGGG + Intronic
1131356623 15:91750953-91750975 GTGGTGGAGGTGGTGGTGGTAGG + Intergenic
1131356634 15:91750995-91751017 GTGGTGGAGGTGGTGGTGGTAGG + Intergenic
1131356645 15:91751037-91751059 GTGGTGGAGGTGGTGGTGGTAGG + Intergenic
1132196492 15:99917930-99917952 ATGGTGAATATGAGGGATGTGGG + Intergenic
1132292029 15:100710521-100710543 ATGGTGGAGGTGGAGGTGGTGGG + Intergenic
1132578082 16:673084-673106 TGGGTGAAGATGGTGGTGCTGGG - Exonic
1133313679 16:4868499-4868521 ATGGTGTAGTTGATGGTGTATGG + Intronic
1133401113 16:5487826-5487848 ATGATGAAGTTGGTGGTCGTGGG + Intergenic
1133401231 16:5488758-5488780 ATGGTGATGATGATGATTATGGG + Intergenic
1133471625 16:6081452-6081474 GAGCTGAAGATGAAGGTGGTTGG + Intronic
1133595736 16:7289660-7289682 ATTGTGATAATGATGATGGTGGG - Intronic
1133613460 16:7454322-7454344 CTGGTGAAGTAGATGGGGGTGGG + Intronic
1133732954 16:8591542-8591564 TTGGTGGTGATGGTGGTGGTTGG - Intergenic
1134630306 16:15751457-15751479 ATGATGATGATGATGATGGCCGG - Intronic
1135009552 16:18862653-18862675 ATGGTGAAGAGACTGGAGGTGGG - Intronic
1135804733 16:25532671-25532693 CTGTTGGAGATGGTGGTGGTAGG + Intergenic
1136002564 16:27306135-27306157 ACGGTGATGATGGTGATGGTGGG - Intergenic
1136002593 16:27306306-27306328 ATGGTGATGATGGTGATGGTGGG - Intergenic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136313258 16:29430283-29430305 ATGGTGAAGAGACTGGAGGTGGG - Intergenic
1137310981 16:47258145-47258167 AAGGTTAACATCATGGTGGTAGG + Intronic
1137793386 16:51194347-51194369 ATGGTGATGATGATGGCAGTAGG + Intergenic
1138116727 16:54366844-54366866 ATGATGAGGATGATGGTATTTGG + Intergenic
1138563802 16:57817921-57817943 ATGGTGATGATGATGGTGATGGG - Intronic
1139718653 16:68834908-68834930 ATGCTGAGGATGATTGAGGTGGG + Exonic
1140027236 16:71301732-71301754 ATGGAGAAGAGGAGGCTGGTAGG + Intergenic
1140431995 16:74912217-74912239 ATGGTGGATGTGATGGTTGTGGG + Exonic
1140911058 16:79453267-79453289 ATGGTGAATATGATACTGGCAGG - Intergenic
1140913079 16:79471018-79471040 ATGGTGAAGACTAGGGTGGGAGG - Intergenic
1140984740 16:80147407-80147429 ATGGTGATGGTGAAGGTTGTTGG - Intergenic
1141361212 16:83396758-83396780 ATGATGATGATGATGATGATAGG + Intronic
1141429560 16:83964700-83964722 ATGAGGAAGATGTTGGTGGCAGG - Intronic
1141813637 16:86393828-86393850 ATGATGATGATGATGGGGATGGG - Intergenic
1141817145 16:86419321-86419343 ATGGTGATGGTGATGATGATGGG + Intergenic
1141817216 16:86419792-86419814 ATGGTGGCGATGATGATGATTGG + Intergenic
1141823694 16:86464676-86464698 ACAGTGATGATGATAGTGGTTGG + Intergenic
1141887305 16:86901396-86901418 AGTGTGAAAATGATGGTAGTGGG + Intergenic
1142087752 16:88193186-88193208 GTGGTGGTGGTGATGGTGGTGGG + Intergenic
1142087760 16:88193210-88193232 ATGGTGGTGATGGTGGTGGTGGG + Intergenic
1142087779 16:88193279-88193301 GTGGTGGAGATGGTGGTGGTGGG + Intergenic
1142099974 16:88265876-88265898 TTGGTTTAGATGAAGGTGGTTGG + Intergenic
1142261779 16:89046010-89046032 ATGATGATGATGGTGATGGTGGG - Intergenic
1143272408 17:5685525-5685547 ATGGTGAAGAGGAGGCTGGAGGG + Intergenic
1143632293 17:8146209-8146231 AAGGGGAAGGGGATGGTGGTAGG + Intronic
1144215592 17:13052371-13052393 ATGCCCAAGATGATGGTGTTTGG + Intergenic
1144626905 17:16848592-16848614 AGGGTGAAGAGCATGGTGGGTGG - Intergenic
1144879534 17:18424120-18424142 AGGGTGAAGAGCATGGTGGGTGG + Intergenic
1145065546 17:19759189-19759211 ATGGTTAGAATGATGGTTGTTGG + Intergenic
1145125286 17:20294657-20294679 AAGGTACTGATGATGGTGGTGGG + Intronic
1145152706 17:20520267-20520289 AGGGTGAAGAGCATGGTGGGTGG - Intergenic
1146089441 17:29861550-29861572 AAGAAGAAGATTATGGTGGTGGG - Intronic
1146564492 17:33900728-33900750 ATGTTGAAGAAGTTGGAGGTGGG + Intronic
1147575794 17:41598438-41598460 ATGGTGGGGGTGATGGTGGTGGG + Intergenic
1147575812 17:41598519-41598541 ATGGTAGTGATGGTGGTGGTGGG + Intergenic
1147575826 17:41598557-41598579 ATGGTGGGGATGATGGTGGTGGG + Intergenic
1147575865 17:41598717-41598739 ATGGTGGGGGTGATGGTGGTGGG + Intergenic
1147575918 17:41598930-41598952 ATGGTGGGGGTAATGGTGGTGGG + Intergenic
1147576000 17:41599325-41599347 ATGTTGGTGGTGATGGTGGTGGG + Intergenic
1147669944 17:42171140-42171162 GTGGTGAGGATGGTGGTTGTGGG + Intronic
1148375027 17:47135430-47135452 ATGATGATGATGATGATGATGGG + Intronic
1148852878 17:50563178-50563200 AAGGTGTAGAGGATGGGGGTGGG - Intronic
1149456538 17:56792879-56792901 GTGGTGGTGGTGATGGTGGTGGG + Intronic
1149602272 17:57900631-57900653 ATGGTGATGATGATGGTGGAAGG - Intronic
1150169779 17:62981271-62981293 TTGGTAAAGATGCAGGTGGTGGG - Intergenic
1151035022 17:70788900-70788922 ATAGTGGAAATGATGGTGATGGG + Intergenic
1151293532 17:73166791-73166813 TTGGTGAAGGTGGTGGAGGTGGG - Intronic
1151307592 17:73273171-73273193 AAGGTCAGGATGTTGGTGGTGGG - Intergenic
1151921986 17:77163902-77163924 AGGGTGAAGATGATACTGCTTGG + Intronic
1151976104 17:77484264-77484286 ATGGTGGTGGTGATAGTGGTGGG + Intronic
1151981126 17:77509694-77509716 ATGGTGATGATGATAATGATGGG - Intergenic
1151981158 17:77509982-77510004 ATGGTGACATTGATGGTGCTAGG - Intergenic
1152025776 17:77808230-77808252 ATGATGATGATGATGATGATGGG + Intergenic
1152315933 17:79580219-79580241 ATGGAGATGATAATGATGGTGGG - Intergenic
1152360221 17:79829707-79829729 ATGGTGAAGATGAATTGGGTTGG - Intergenic
1152599316 17:81253636-81253658 ATGGTGATGTTGATGGTGGTAGG - Intronic
1152599323 17:81253678-81253700 ATGATGGTGATGTTGGTGGTAGG - Intronic
1152599333 17:81253735-81253757 ATGATGATGGTGATGGTGGTAGG - Intronic
1152599342 17:81253786-81253808 ATGATGATGGTGATGGTGGTAGG - Intronic
1152599354 17:81253858-81253880 ATGATGATGGTGATGGTGGTAGG - Intronic
1152634440 17:81424858-81424880 TTGGTGGTGATGATGATGGTAGG + Intronic
1153025331 18:667259-667281 ATGGAGATGGTGATGGTGATGGG + Intronic
1153025388 18:667597-667619 ATGGTGATGGTGATGGAGATGGG + Intronic
1155546538 18:26921670-26921692 ATGATGATGATGATGATGATGGG - Intronic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155928250 18:31680422-31680444 ATGGTGGAGCTGATGGCGATGGG - Intronic
1156755583 18:40520731-40520753 AGGTTGGAGATGATGGGGGTTGG - Intergenic
1157305811 18:46516829-46516851 ATGATGATGTTGATGATGGTAGG - Intronic
1157305818 18:46516871-46516893 ATGGTAGTGATGATGGTGATAGG - Intronic
1158098478 18:53802853-53802875 ATGTTGGTGAGGATGGTGGTGGG - Intergenic
1160257249 18:77258470-77258492 TTGGTGGTGGTGATGGTGGTGGG + Intronic
1160257464 18:77259492-77259514 GTGGTGGTGGTGATGGTGGTGGG + Intronic
1161899394 19:7106804-7106826 ATGATGATGGTGATGGTGATAGG + Intergenic
1161929797 19:7331181-7331203 GTGGTGATGATTATGATGGTAGG - Intergenic
1162183539 19:8887226-8887248 ATGATGATGATGATGGTAGTGGG - Intronic
1162183587 19:8887666-8887688 ATGATGATGATGGTGGTGGCAGG - Intronic
1162184425 19:8893918-8893940 ATTGTGATGATGATGATGATGGG - Intronic
1162185596 19:8902180-8902202 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1162185974 19:8905027-8905049 ATGGTGAAGTTGAGGGTGAACGG + Exonic
1162186700 19:8910460-8910482 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1162187310 19:8915597-8915619 ATGGTGAAGTTGAGGGTGAACGG + Exonic
1162187335 19:8916022-8916044 ATGATGTCGGTGATGGTGGTGGG - Intronic
1162187350 19:8916180-8916202 ATGATGCTGGTGATGGTGGTGGG - Intronic
1162188151 19:8923016-8923038 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1163195392 19:15716077-15716099 ATGGTGGTGGTGGTGGTGGTGGG + Intergenic
1163208978 19:15826410-15826432 ATGGTGGTGGTGGTGGTGGTTGG - Intergenic
1164441476 19:28283340-28283362 GTGGGAAAGATGATGGTGGGGGG - Intergenic
1164478526 19:28593643-28593665 GTGGTGATGGTGATAGTGGTGGG - Intergenic
1164528674 19:29030376-29030398 ATGGTGATGGTGATGATGGTGGG + Intergenic
1164536603 19:29090499-29090521 ATGGTGATTATGAAGATGGTGGG + Intergenic
1165065008 19:33223921-33223943 ATGGTAGAGGTGGTGGTGGTGGG - Intronic
1165324390 19:35105855-35105877 GTAATGATGATGATGGTGGTAGG - Intergenic
1165410794 19:35659966-35659988 ATGCTGATCATGATGGTAGTTGG + Intergenic
1165748290 19:38244152-38244174 ATTCTGAAGATGGTGGTGGGGGG + Intronic
1165850903 19:38849851-38849873 ATGGTGAAGATGGCGGCGGCGGG - Exonic
1166441572 19:42819870-42819892 CTGTTGAGGATGGTGGTGGTGGG + Intronic
1166773376 19:45297908-45297930 TTGGTGAAGAGGTTGGTGGTGGG - Exonic
1167458178 19:49609627-49609649 ATGGAGAAGAGTATGGTGTTGGG + Intronic
1167835425 19:52064558-52064580 AAGGTTAAAATGATGGTGGGAGG + Exonic
1168361781 19:55746961-55746983 ATGGTGATGATGGTGATGATGGG + Intergenic
1168430340 19:56274051-56274073 ATGGGTCAGATGCTGGTGGTTGG + Intronic
925366450 2:3315175-3315197 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366463 2:3315212-3315234 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366475 2:3315249-3315271 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366487 2:3315286-3315308 ATGGTGGTGAGGATGGTGGTAGG - Intronic
925366499 2:3315323-3315345 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366512 2:3315360-3315382 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366525 2:3315397-3315419 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366538 2:3315434-3315456 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366550 2:3315471-3315493 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366563 2:3315508-3315530 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366576 2:3315545-3315567 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366589 2:3315582-3315604 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366601 2:3315619-3315641 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366615 2:3315657-3315679 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366628 2:3315694-3315716 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366641 2:3315731-3315753 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366664 2:3315802-3315824 ATGGTGGTGAGGATGGTGGTAGG - Intronic
925366676 2:3315839-3315861 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366689 2:3315876-3315898 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366702 2:3315913-3315935 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366715 2:3315950-3315972 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366727 2:3315987-3316009 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366740 2:3316024-3316046 ATGGTGGTGATGGTGGTGGTAGG - Intronic
925366751 2:3316060-3316082 ATGGTGGTGAGGATGGTGGTGGG - Intronic
925366763 2:3316096-3316118 ATGGTGGTGAGGATGGTGGTGGG - Intronic
925366775 2:3316132-3316154 ATGGTGGTGGTGATGGTGGTGGG - Intronic
925600347 2:5602591-5602613 AATGTGAAGATGAAGGAGGTAGG - Intergenic
925836890 2:7954931-7954953 ATGCTGATGATGATGGTGGCTGG + Intergenic
926132395 2:10312169-10312191 ATGGTGATGGTGATGATGGTGGG - Intronic
926132430 2:10312564-10312586 ATGGTGATGATGATGAGGATGGG - Intronic
926132444 2:10312697-10312719 ATGGTGATGATGATGGGGATGGG - Intronic
926820651 2:16848101-16848123 ATGGTCAAGATGAAAGAGGTGGG + Intergenic
926920173 2:17932209-17932231 TTGTTGAAGATGATGGTGATGGG - Exonic
927056793 2:19372992-19373014 AAGGGGAAGAAGAAGGTGGTTGG - Intergenic
927371556 2:22361468-22361490 ATGGGGATGGTGATGATGGTGGG - Intergenic
927740880 2:25568788-25568810 ATGGTGCCGGTGATGGTTGTGGG - Intronic
927756729 2:25714365-25714387 GTGGTGAAGATGGAGGTGGTGGG + Intergenic
928123685 2:28602004-28602026 ATGGTGAGGGTGAAGGTGGATGG + Intronic
928399284 2:30966246-30966268 AAGGTGATGATGATGCTAGTGGG + Exonic
928585812 2:32756885-32756907 ATGGTGGACATGGTGGTGGGAGG + Intronic
930491849 2:52083691-52083713 ATGCTGAAGAAGGTGGGGGTGGG - Intergenic
930565830 2:53019561-53019583 GTGGTGATGGTGATGGTGGTGGG + Intergenic
932837590 2:75051650-75051672 ATGGTGATGATGCTGGTTTTGGG - Intronic
934477634 2:94603877-94603899 AAGGTGAAGATGCTGGGGGGCGG - Exonic
934994372 2:98943617-98943639 ATGATGTGGATGATGGTGGTAGG - Intergenic
935420508 2:102864239-102864261 TTGGTGATGATGATCTTGGTTGG - Intergenic
935622975 2:105144579-105144601 ATGGTGATGGTGGTGGTGGTTGG - Intergenic
935774417 2:106459820-106459842 ATGATGATGATGATGATGTTTGG - Intronic
935905652 2:107836092-107836114 ATGATGATGATGATGATGTTTGG + Intronic
935992130 2:108728623-108728645 ATGATGATGATGATGATGTTTGG + Intronic
936127448 2:109801336-109801358 ATGATGATGATGATGATGTTTGG + Intronic
936217249 2:110570149-110570171 ATGATGATGATGATGATGTTTGG - Intronic
936426389 2:112424732-112424754 ATGATGATGATGATGATGTTTGG - Intronic
936462592 2:112723737-112723759 CTGGGGAAGATGAAGGAGGTTGG + Exonic
936811616 2:116409032-116409054 ATGGCCAAGATGACAGTGGTAGG + Intergenic
937435996 2:121881668-121881690 TTGGTGAAGATGATGGCCATGGG + Intergenic
937836132 2:126471949-126471971 ATGGGGAAGATGAGGATGGGGGG - Intergenic
938076299 2:128340476-128340498 ATGGTGCTGGTGCTGGTGGTGGG + Intergenic
939918603 2:148080126-148080148 AAGGTGAAGGTGATGTTGGAAGG + Intronic
940608122 2:155953779-155953801 ATGATGATGATGATAATGGTAGG + Intergenic
941271864 2:163440102-163440124 ATTGTGAAGGTGGTGGAGGTTGG - Intergenic
941650068 2:168082923-168082945 CTGGTGAACATGATGGCAGTGGG - Intronic
942506416 2:176646164-176646186 ATGGGGTAGGTGGTGGTGGTTGG + Intergenic
944544892 2:200789428-200789450 ATGGTGAAGATGATTGAGTCAGG + Intergenic
944867334 2:203875559-203875581 ATGGAGATGATGATGAAGGTTGG - Intergenic
946706919 2:222467312-222467334 TTGATGACGATGATGATGGTGGG - Intronic
946868615 2:224065527-224065549 ATGGTGGTGGTGGTGGTGGTTGG + Intergenic
947291202 2:228576467-228576489 ATGGTGGAAATGATTGGGGTAGG + Intergenic
947382925 2:229562922-229562944 ATGTTGATGATGATGGTGATGGG - Intronic
947382928 2:229562951-229562973 ATGATGATGATGATGGTGGTGGG - Intronic
947382934 2:229562980-229563002 ATGTTGATGATGATGTTGATGGG - Intronic
947382937 2:229563009-229563031 AGGATGATGATGATGGTGGTGGG - Intronic
947382944 2:229563038-229563060 ATGTTGATGATGTTGGTGATGGG - Intronic
947382950 2:229563073-229563095 ATGTTGATGATGATGGTGATGGG - Intronic
947382964 2:229563157-229563179 ATGTTGATGATGATGGTGATGGG - Intronic
947382978 2:229563241-229563263 ATGTTGATGATGATGGTGATGGG - Intronic
947382986 2:229563299-229563321 ATGTTGATGATGATGGTGATGGG - Intronic
947382994 2:229563357-229563379 AGGATGATGATGATGGTGATGGG - Intronic
947382999 2:229563383-229563405 GTGATGATGATGATGGTGATGGG - Intronic
947383003 2:229563406-229563428 ATGATGATGATGATGGCGATGGG - Intronic
947383008 2:229563435-229563457 ATGAAGATGATGATGGTGATGGG - Intronic
947383019 2:229563519-229563541 GTGATGACGATGATGGTGATGGG - Intronic
947383023 2:229563542-229563564 ATGATGACGATGATGGTGATGGG - Intronic
947383032 2:229563600-229563622 GTGATGATGATGATGGTGATGGG - Intronic
947383036 2:229563623-229563645 ATGTTGATGATGTTGGTGATGGG - Intronic
947383040 2:229563655-229563677 ATGTTGATGATGATGGTGATGGG - Intronic
947383050 2:229563713-229563735 GTGATGATGATGATGGTGATGGG - Intronic
947383054 2:229563736-229563758 AGGATGATGATGATGGTGATGGG - Intronic
947383060 2:229563765-229563787 ATGTTGATGATGATGGAGATGGG - Intronic
947383068 2:229563817-229563839 GTGATGATGATGATGGTGATGGG - Intronic
947383072 2:229563840-229563862 AGGATGATGATGACGGTGGTGGG - Intronic
947383083 2:229563892-229563914 AGGATGATGATGATGGTGATGGG - Intronic
947383094 2:229563947-229563969 ATGAGGATGATGATGGTGATGGG - Intronic
947383098 2:229563970-229563992 ATGATGATGATGATGGTGATGGG - Intronic
947383103 2:229564002-229564024 AGGATGATGATGATGGTGATGGG - Intronic
947383108 2:229564028-229564050 GTGTTGATGATGATGGTGATGGG - Intronic
947383113 2:229564057-229564079 AGGATGATGATGATGGTGATGGG - Intronic
947383118 2:229564083-229564105 ATGTTGATGATGATGGTGATGGG - Intronic
947383122 2:229564112-229564134 AGGATGATGATGATGGTGATGGG - Intronic
947383127 2:229564138-229564160 ATGTTGATGATGATGGTGATGGG - Intronic
947383131 2:229564167-229564189 ATGCTGATGATGATGTTGATGGG - Intronic
947383134 2:229564196-229564218 AGGATGATGATGATAGTGGTGGG - Intronic
947383156 2:229564332-229564354 ATGATGATGATGATGGTGATGGG - Intronic
947383161 2:229564361-229564383 ATGATGATGATGATGGTGATGGG - Intronic
947383165 2:229564387-229564409 ATGTTGATGATGATGGTGATGGG - Intronic
947383185 2:229564523-229564545 ATGATGATGATGATGGTGATGGG - Intronic
947383190 2:229564552-229564574 ATGTTGATGATGATGGTAATGGG - Intronic
947383194 2:229564581-229564603 ATGATGATGATGATGGTGATGGG - Intronic
947383208 2:229564662-229564684 ATGATGATGATGATGGTGACGGG - Intronic
947383213 2:229564691-229564713 ATGTTGATGATGATGGTGATGGG - Intronic
947383217 2:229564720-229564742 ATGATGATGATGATGGTGATGGG - Intronic
947619359 2:231578843-231578865 ATGGTGATGATGATGGTGATGGG - Intergenic
948031714 2:234823185-234823207 ATGGTGATAATGAAGGTGCTGGG + Intergenic
948183149 2:235998938-235998960 ATGGTGGTGATGATGGTGAGAGG + Intronic
948183174 2:235999081-235999103 ATGGTGGTGATGATGGTGAGAGG + Intronic
948183193 2:235999216-235999238 ATGGTGGTGATGATGGTGAGAGG + Intronic
948183217 2:235999381-235999403 ATGGTGGTGATGATGGTGAGAGG + Intronic
948183248 2:235999580-235999602 ATGGTGGTGATGATGGTGAGAGG + Intronic
1168863423 20:1062992-1063014 ATGGTGATGATGCTGGTCCTGGG + Intergenic
1169470548 20:5881595-5881617 ATGATGCAGGTGATGGTGTTGGG - Intergenic
1169488048 20:6049857-6049879 ATGGTGATGATGAAGGCTGTTGG - Intronic
1169640692 20:7747532-7747554 TTGTTGAAGATGAGGCTGGTGGG + Intergenic
1170075424 20:12413576-12413598 ATGGAAAAGATAATGGTGTTGGG + Intergenic
1170116131 20:12862059-12862081 ATGATGATGATGATGATCGTGGG - Intergenic
1170253975 20:14319128-14319150 ATGGAGAAGATGATGGGATTAGG - Intronic
1170580606 20:17696964-17696986 ATGGTGATGATGATGATAATGGG + Intronic
1171986812 20:31666435-31666457 ATGGGGGAGATGATGGTGCAGGG + Intronic
1172012781 20:31856116-31856138 ATGGTTAAGCTGAGGATGGTGGG + Intronic
1172013070 20:31857708-31857730 ATGGTTAAGCTGAGGATGGTGGG - Intronic
1172504363 20:35450483-35450505 ATGGAGAGGAAGATGGGGGTGGG + Intronic
1172897979 20:38314068-38314090 TTGATGATGATGATGGTGATGGG + Intronic
1172898041 20:38314415-38314437 ATGATGATGATGGTGATGGTGGG + Intronic
1172898069 20:38314568-38314590 ATGGTGGTGATGATGATGGTGGG + Intronic
1172898082 20:38314631-38314653 ATGGTGGTGATGGTGATGGTGGG + Intronic
1172898095 20:38314694-38314716 ATGGTGGTGATGGTGATGGTGGG + Intronic
1173028218 20:39329618-39329640 TCACTGAAGATGATGGTGGTAGG - Intergenic
1173449185 20:43147387-43147409 AGGATGATGATGATGATGGTTGG - Intronic
1173703722 20:45095075-45095097 TTGTTGAAGATGATGGTGATGGG + Exonic
1174893521 20:54424068-54424090 ATGGCGATCATAATGGTGGTGGG - Intergenic
1175670171 20:60895667-60895689 ATGATAGAAATGATGGTGGTAGG + Intergenic
1175764975 20:61586101-61586123 ATGGTGATGATTGTGGTGATAGG + Intronic
1175788492 20:61726640-61726662 ATGGTCATGATGGTGGTGATGGG - Intronic
1175898282 20:62349825-62349847 ATGGTGGGGGTGATGATGGTGGG + Intronic
1175933494 20:62504432-62504454 ATGGTGATGGTGATGATGGTGGG - Intergenic
1176057358 20:63155752-63155774 AAGGGGAAGATGCTGCTGGTGGG - Intergenic
1176247822 20:64105639-64105661 ATGGTGGATGTGATGGGGGTGGG + Intergenic
1176969995 21:15253987-15254009 TTGGTGTGGAGGATGGTGGTAGG - Intergenic
1177905099 21:26965427-26965449 GTGGTGAAGGTGGTGGTGCTAGG - Exonic
1177930290 21:27273198-27273220 ATGGTGGTGATGTTGATGGTGGG - Intergenic
1178531852 21:33382538-33382560 ATGATGCTGATGGTGGTGGTGGG - Intergenic
1178698104 21:34811367-34811389 AAGGTGAAGAGGATGCAGGTAGG - Intronic
1178976936 21:37228137-37228159 ATGGTTAAGAGGATGCTGGGGGG - Intronic
1179710949 21:43262650-43262672 GTGGTGATGGTGGTGGTGGTGGG + Intergenic
1179724876 21:43336518-43336540 ATGGTGATGGTGGTGGTGGTGGG - Intergenic
1181054231 22:20252592-20252614 GTGGTGATGAAGATGGGGGTGGG - Intronic
1181448259 22:22996669-22996691 TTGGTGGTGATGATGGTGGCAGG - Intergenic
1181532750 22:23526313-23526335 ATGATGGAGGTGATGGTGGTTGG + Intergenic
1182012494 22:27012288-27012310 AGGATGAAGATGATGGTGGGTGG + Intergenic
1182099095 22:27645433-27645455 GTGGTGATGATGGTGGTTGTGGG - Intergenic
1184502930 22:44884851-44884873 ATGGTGATGATAGTGGTGATGGG - Intronic
1184666924 22:45994188-45994210 ATGGTGGTGATGATGGAGGTAGG + Intergenic
1184783204 22:46659283-46659305 AGGCTGAAGATGATGCTGGGGGG - Intronic
1184870768 22:47236892-47236914 ATGGTGATGATCATGGTTGATGG + Intergenic
1185137605 22:49081493-49081515 CGGGTGTGGATGATGGTGGTGGG + Intergenic
1185200522 22:49500997-49501019 ATGGTGGTGATGATGGTGATGGG - Intronic
1185215252 22:49595546-49595568 ATGGTGATGATGGTGGTGATGGG + Intronic
1185414414 22:50701981-50702003 ACGGTTAAGAAGATGATGGTGGG - Intergenic
949412213 3:3778371-3778393 ATGGTGTTGATGATGGGGATGGG - Intronic
949775693 3:7630189-7630211 CTGGGGATGGTGATGGTGGTGGG + Intronic
949941017 3:9154445-9154467 ATGGTGAACTTGATGGGGGGTGG - Intronic
951109159 3:18781256-18781278 ATGGTGGTGGTGATGGTAGTTGG + Intergenic
952556942 3:34542395-34542417 ATGGTATGGATGATGGTGGATGG + Intergenic
953701389 3:45198553-45198575 GTGGTCAAGATGATGGGGCTTGG + Intergenic
953732835 3:45464848-45464870 TTGGTGATGATGATGCTGCTTGG + Intronic
954113229 3:48447390-48447412 ATGGTTCTGATGGTGGTGGTAGG - Intronic
954418615 3:50406633-50406655 ATGGTGGAGCTGATGGTGATGGG - Intronic
954472286 3:50708077-50708099 ATGCTGACAGTGATGGTGGTGGG + Intronic
954637949 3:52081679-52081701 AGGGTGAAGATGAAGCTGCTAGG - Intronic
954692697 3:52404161-52404183 ATGGAGGAGATGTGGGTGGTGGG - Intronic
955198724 3:56830244-56830266 ATGGTGGAGGTGGTGCTGGTGGG + Intronic
955666552 3:61355383-61355405 AGGATGCAAATGATGGTGGTGGG - Intergenic
956128937 3:66037310-66037332 ATGACGATGATGGTGGTGGTGGG + Intronic
956159664 3:66335879-66335901 ATGGGAAAGTTGGTGGTGGTGGG + Intronic
956544956 3:70390688-70390710 ATGGTGGAGGTGATGGAGGTGGG - Intergenic
956787051 3:72651569-72651591 GTAGTGGAGATGATGGTAGTAGG - Intergenic
958771802 3:98434313-98434335 AGGGCCAAGATCATGGTGGTTGG + Intergenic
959226905 3:103598363-103598385 AGGGTGAAGGTTATTGTGGTGGG - Intergenic
960175343 3:114511008-114511030 AAAGTGAACATGATGGTGGTGGG + Intronic
960438623 3:117658869-117658891 ATGGTGCAGGTGGTGGTGATGGG - Intergenic
961656592 3:128445786-128445808 GTGGTGGTGATGATGGTGGTGGG + Intergenic
961656684 3:128446233-128446255 ATGGTGATGATGGTGATGGTGGG + Intergenic
961854411 3:129855075-129855097 ATAGTGAAGATCATGGTGATAGG - Intronic
962379507 3:134886249-134886271 TTGGGGCAGATGATGGTGCTGGG - Intronic
962407228 3:135110679-135110701 ATCGTGGCGATGATGGTGATTGG + Intronic
962611341 3:137079136-137079158 ATGCTGATGATGATGCTGGTTGG - Intergenic
963525064 3:146406753-146406775 ATTGTGAGGATGATGGTGTGAGG + Intronic
965676269 3:171200264-171200286 AAGGTCAAGTTGAAGGTGGTTGG + Intronic
966173545 3:177111144-177111166 ATGGTGATGGTGATGATAGTAGG - Intronic
966327767 3:178776283-178776305 AGAGTGAAGATGATGGAGGGAGG - Intronic
967117532 3:186355357-186355379 GTGGTGATGATCATGGTGGTAGG - Intronic
967117547 3:186355435-186355457 GTGGTGATGATCATAGTGGTGGG - Intronic
967117609 3:186355733-186355755 GTGGTGGTGATGCTGGTGGTAGG - Intronic
967344644 3:188441268-188441290 ATGGTGAAGATTACTGTTGTAGG - Intronic
967518988 3:190405595-190405617 TTGGTGGAGTTGGTGGTGGTGGG - Intronic
967872876 3:194246734-194246756 CTGGTGATGGTGATGGTGGAGGG - Intergenic
968231348 3:197006574-197006596 ACGGTGAAGATGTTGGTGTCGGG + Exonic
968592886 4:1468049-1468071 ATGGTGATGACGATGATGGTAGG + Intergenic
968592926 4:1468465-1468487 ATGGTGGTGATAATGTTGGTGGG + Intergenic
969208791 4:5670480-5670502 ATGGTGGTGATGGTGATGGTGGG - Intronic
969208801 4:5670540-5670562 AATGTGAAGATGATGGTGATGGG - Intronic
969208842 4:5670885-5670907 ATGGTGAAGATGATGGTGATGGG - Intronic
969208849 4:5670963-5670985 ATGATGGTGTTGATGGTGGTGGG - Intronic
969234602 4:5856857-5856879 GTGGTGATGGTGATGATGGTGGG - Intronic
969234621 4:5856957-5856979 ATGGTGGTGATGATAGTGGATGG - Intronic
969234627 4:5856995-5857017 ATGGTGGTGATGATAGTGGATGG - Intronic
969281151 4:6171401-6171423 GTGGTGATGATGGTGGTGGTTGG - Intronic
969347716 4:6579724-6579746 GTGGTGATGATGATTGTGGAGGG - Intronic
969466940 4:7362999-7363021 ATGGTGATGATGATAGCAGTAGG - Intronic
969529801 4:7724363-7724385 ATGGTGATGATGGTGGTGATAGG + Intronic
969710903 4:8842818-8842840 GTGGTAGAGATGATGGTGGTGGG + Intergenic
970926628 4:21459837-21459859 ATGGTGATGGTGAAAGTGGTTGG - Intronic
971422707 4:26488801-26488823 AGGGTGAGGATGATGGAGGAGGG - Intronic
971895318 4:32585632-32585654 ATGATGATGATAATGATGGTAGG + Intergenic
972365844 4:38373417-38373439 ACAGTGAAGATGGTGATGGTTGG - Intergenic
972404470 4:38733318-38733340 GTGGTGATGATCATGGTTGTTGG + Intergenic
972905960 4:43747375-43747397 ATGGTGGTGGTGGTGGTGGTGGG + Intergenic
972971266 4:44579127-44579149 ATGATGGAGATGGAGGTGGTTGG - Intergenic
973965218 4:56155028-56155050 ATGATGATGATGATGATGATTGG - Intergenic
976349529 4:84044981-84045003 ATGGTAAAACTGGTGGTGGTGGG + Intergenic
976492423 4:85687101-85687123 ATGATGATGATGATGATGGATGG + Intronic
978127617 4:105152940-105152962 TTGGTGATGGTGATGATGGTAGG + Intronic
978342010 4:107728924-107728946 AGGGTGAACAGGATGATGGTGGG + Intergenic
979548676 4:121965469-121965491 ATCGTTATGATGATGGTTGTGGG - Intergenic
981934189 4:150221289-150221311 AAGGAGAAGAGGATGGTGGTGGG - Intronic
981997866 4:150994187-150994209 GTGGTGGTGGTGATGGTGGTGGG - Intronic
982066629 4:151660135-151660157 ATGGAGAATTTGATGGTGCTTGG + Intronic
982221592 4:153129707-153129729 ATGGTGTTGATGGTGGTGGGGGG - Intergenic
982221615 4:153129797-153129819 ATGGTGGTGATGGTGGTGGTGGG - Intergenic
982221637 4:153129883-153129905 ATGGTGTTGATGGTGGTGGTGGG - Intergenic
982221656 4:153129955-153129977 ATGGTGGTGATGGTGGTGGTGGG - Intergenic
982276249 4:153639715-153639737 ACTGTGGAGATGATGGAGGTTGG + Intergenic
982941609 4:161565222-161565244 ATGATGATGATGATGATGATAGG - Intronic
983752119 4:171287417-171287439 ATGTTGAAGCCCATGGTGGTAGG - Intergenic
984819337 4:183866510-183866532 ATGAAGAAGAGGATGGTGGAGGG + Intronic
984830414 4:183967476-183967498 AAGGGGAACATGATGGTGTTTGG + Intronic
985091647 4:186369200-186369222 CTGATGAAGGTGATGATGGTGGG + Intergenic
985857318 5:2439932-2439954 ATGGTGATGGTGATGATGATAGG - Intergenic
986221300 5:5771156-5771178 ATGATGATGGTGATGGTTGTGGG + Intergenic
986400171 5:7372104-7372126 GTGGTGATGAAGGTGGTGGTAGG - Intergenic
986436737 5:7741559-7741581 ATGGTGATGGTGATGGTGATAGG - Intronic
986436742 5:7741583-7741605 ATGGTGATGGTGATGGTGATAGG - Intronic
986470282 5:8066939-8066961 TTGGAGAAGGTGCTGGTGGTGGG + Intergenic
986736345 5:10670369-10670391 ATGGTGGTGATGATGGTGATGGG + Intergenic
986981120 5:13449037-13449059 ATGGTGATGATGATGATGAATGG - Intergenic
987579807 5:19775179-19775201 ATGGTGAAGATGAGGATGCTTGG + Intronic
987996125 5:25282065-25282087 ATAGTGGTTATGATGGTGGTGGG - Intergenic
988696383 5:33626383-33626405 ATGGTAGTGGTGATGGTGGTGGG + Intronic
988696568 5:33627364-33627386 GTGGTGTTGATGGTGGTGGTGGG + Intronic
988984108 5:36600153-36600175 AGGGTCCAGATGCTGGTGGTTGG + Intergenic
991085701 5:62646815-62646837 ATGGTGAGGAGCATGGTGATTGG - Intergenic
992539318 5:77746839-77746861 ATGTTGAAGAAAATGTTGGTTGG - Intronic
993845423 5:92936387-92936409 ATGATGATGATGATTGTGGTGGG - Intergenic
993892513 5:93490920-93490942 GTGGTGGTGATGGTGGTGGTGGG + Intergenic
994102889 5:95913153-95913175 ATGATAAAAATGATGGGGGTCGG + Intronic
994707302 5:103222502-103222524 ATGGTCAAGTTGTTGGTGGAGGG - Intergenic
994777417 5:104051597-104051619 CTGATGATGATGATGGAGGTGGG - Intergenic
995024832 5:107408188-107408210 ATGGTGATGGTGATGGTGATGGG - Intronic
995288834 5:110425697-110425719 ATGGTGGAGATGAAGGTAATTGG - Intronic
998655285 5:144171571-144171593 GTGGTGATGGTGGTGGTGGTTGG - Intronic
998799187 5:145851599-145851621 GTGGTAATGATGATGGTGGTGGG - Intergenic
999120103 5:149202834-149202856 ATGGTGAAGGTTGTGGTGGTGGG - Intronic
1000244956 5:159441655-159441677 AGGGTGAAGCTGGTGGTGCTTGG + Intergenic
1000274138 5:159717788-159717810 ATGGTTAAGATGATTATGATTGG + Intergenic
1000684292 5:164228198-164228220 AGGGTGAAGATGATAAAGGTTGG - Intergenic
1001086364 5:168702698-168702720 ATGATGATGATGATGATGCTTGG + Intronic
1001285668 5:170421683-170421705 ATCATGAAGATGATGGTGTTGGG - Intronic
1001482636 5:172099160-172099182 ATGGTGATGATAGTGGTGATGGG - Intronic
1001748346 5:174109229-174109251 ATGGGGAAGATGCTGGGGGTGGG + Intronic
1002794713 6:463238-463260 AGGGTGAAGTTGATGATGGGTGG + Intergenic
1004548439 6:16622366-16622388 ATGGTGGTGGTGGTGGTGGTTGG + Intronic
1005384462 6:25272357-25272379 GTGGTAACTATGATGGTGGTGGG - Intergenic
1006155360 6:32010443-32010465 GTGGTGAAGGTGATGCTGGCTGG + Intergenic
1006161666 6:32043177-32043199 GTGGTGAAGGTGATGCTGGCTGG + Exonic
1006368315 6:33628996-33629018 ATGATGATGATGATGGCAGTGGG + Intronic
1006421870 6:33939633-33939655 ATGGTGAACTTGATGATCGTAGG - Intergenic
1006901819 6:37507732-37507754 ATGGTGATGGGGATGGGGGTAGG + Intergenic
1007074640 6:39058640-39058662 ATGATGATGATGATGATGATAGG - Intronic
1007202147 6:40118731-40118753 TTGGTCATGATGATGGTGGAAGG - Intergenic
1007512759 6:42386963-42386985 ATGGTGGTGATGATGGTAGGGGG - Intronic
1007763676 6:44148883-44148905 ATGGTGGTGATGATGATGGCTGG - Exonic
1007960228 6:45952123-45952145 GTGGTGATGGTGGTGGTGGTGGG + Intronic
1008193701 6:48492392-48492414 ATGATGATGATGATGATGATAGG + Intergenic
1009460718 6:63909576-63909598 ATCTTGAAGTTGATTGTGGTTGG + Intronic
1011385382 6:86791862-86791884 CTGGTGATGGTGATGGGGGTAGG - Intergenic
1011587702 6:88944555-88944577 ATGCTGAAGATGTTGGGGGTGGG - Intronic
1011925222 6:92634518-92634540 ATGGTGCAGATGGTTGTGGGTGG - Intergenic
1012215449 6:96577160-96577182 TTGTTGATGATGTTGGTGGTGGG - Intronic
1012854105 6:104480846-104480868 CTGTTGAACAAGATGGTGGTGGG - Intergenic
1014166888 6:118234898-118234920 ATGGTGAAGATTATAGTTGTTGG + Intronic
1014221430 6:118802876-118802898 ATGGTGAAGATGTGGGAGGGTGG - Intergenic
1014799223 6:125759309-125759331 GTGGAGCGGATGATGGTGGTGGG - Exonic
1015425246 6:133057476-133057498 TTGGTGGTGATGATGGTGGGGGG + Intergenic
1017724970 6:157270411-157270433 GTGGTCATGATGGTGGTGGTAGG - Intergenic
1017983750 6:159424809-159424831 ATGGAGAAGATGAGGCTGTTTGG - Intergenic
1018103433 6:160461733-160461755 ATGGTGATGAGGATGATGATGGG - Intergenic
1018124476 6:160668673-160668695 ATGATGATGATGGTGGTGGTGGG + Intergenic
1018131539 6:160736502-160736524 ATGGTGATGATGATGATTATGGG + Intronic
1018132872 6:160749308-160749330 GTGGTGGTGATGATGTTGGTGGG - Intronic
1018132949 6:160749794-160749816 ATGGTGACGGTGATGGTGGTGGG - Intronic
1018699585 6:166416084-166416106 ATGGTGGAGGTGATGGAGGAAGG - Intronic
1018699639 6:166416318-166416340 ATGGCAGAGATGATGGTGGAGGG - Intronic
1018913716 6:168119814-168119836 ATGTTGAAGATAGTGGTGATGGG - Intergenic
1018961045 6:168448604-168448626 ATGGGGAGGAGGATGGTGATGGG + Intronic
1019632003 7:2054360-2054382 AGTGTGAAGATGATGAAGGTTGG - Intronic
1019820021 7:3235499-3235521 GTGGTGGAGATGATGGTGGTAGG + Intergenic
1020227226 7:6289811-6289833 ATTGTGATGGTGATGGTGATGGG - Intergenic
1020435030 7:8152769-8152791 ATGGTGATGGTGATAGTGGTGGG - Intronic
1021612620 7:22472925-22472947 ATGGAGAGGATGATGATGGCGGG + Intronic
1021817453 7:24461615-24461637 TTGGAGAAGATAATGGTGGCAGG - Intergenic
1022317876 7:29262768-29262790 ATGGTGAAGATGGGGGTGCAGGG + Intronic
1022589251 7:31645606-31645628 ATAATGATGATGGTGGTGGTGGG - Intronic
1022859678 7:34354840-34354862 ATGGTGATGAGGGTGATGGTGGG + Intergenic
1023310610 7:38882616-38882638 AGGGTGAAAATAGTGGTGGTGGG - Intronic
1023624655 7:42103942-42103964 ATGGTGCTGATGATGATGTTAGG + Intronic
1024863829 7:53880311-53880333 ACAGTGAAGGTGGTGGTGGTGGG - Intergenic
1026428312 7:70318580-70318602 ATGGGGCAGAAGGTGGTGGTAGG - Intronic
1029196800 7:98811039-98811061 GTGGTGGAGGTGGTGGTGGTTGG + Intergenic
1029196909 7:98811514-98811536 ATGGTGGTGGTGATGGTAGTGGG + Intergenic
1029200321 7:98835082-98835104 ATGATGATGATGATGATGATAGG - Intergenic
1030202049 7:106915608-106915630 ATGATGATGATGATGGTGGAAGG + Intergenic
1030682266 7:112446558-112446580 AGGGTGGAGGTGCTGGTGGTAGG + Intronic
1030700392 7:112631960-112631982 ATACTGAAAATAATGGTGGTTGG + Intergenic
1030865655 7:114699070-114699092 GTGGTGATGATGATGGTGAAGGG - Intergenic
1031101737 7:117489309-117489331 ATGCTGAAGAAGAAAGTGGTAGG + Intronic
1031454027 7:121957318-121957340 ATGGTGGCGGCGATGGTGGTGGG + Intronic
1031482459 7:122295570-122295592 ATCCTGAATATGATGGTGTTTGG + Intergenic
1031485956 7:122324551-122324573 CAGGTGATGATGATAGTGGTAGG + Intronic
1031938447 7:127761107-127761129 ATGGCCAAGATGATAGAGGTAGG - Intronic
1033304149 7:140212172-140212194 ATGGTGATGATGATGATGATGGG + Intergenic
1033363346 7:140653380-140653402 AAGGGGAAGATGGTGGAGGTGGG - Intronic
1033513487 7:142083689-142083711 GTGATGGTGATGATGGTGGTAGG + Intronic
1033519718 7:142148385-142148407 ATGATGGTGATGGTGGTGGTAGG - Intronic
1033608885 7:142946758-142946780 AGGATAAAGGTGATGGTGGTAGG - Intronic
1034049432 7:147966712-147966734 ATGATGGTGATGATGGTTGTGGG - Intronic
1034400870 7:150860689-150860711 ATGGTGATGAGGATGGTCCTGGG - Intronic
1035035483 7:155891582-155891604 ATGGTGAAGGGGATGGGGGTAGG + Intergenic
1035107035 7:156449670-156449692 ACAGTGATGATGATGGTCGTGGG + Intergenic
1035323313 7:158048541-158048563 ATGGTGATGATGGTGCTGGTGGG - Intronic
1035323341 7:158048786-158048808 ATGGTGGTGATGGTAGTGGTGGG - Intronic
1035323376 7:158049068-158049090 ATGCTGATGATGGTAGTGGTGGG - Intronic
1035342425 7:158172462-158172484 ATGGTGAGGGTGATGATGGTAGG - Intronic
1035342434 7:158172515-158172537 ATGGTGGAAGTGATGATGGTGGG - Intronic
1035342457 7:158172666-158172688 ATGGTGAAGATGATGATGGTGGG - Intronic
1035342476 7:158172782-158172804 ATGGTGAAGATGATGATGGTGGG - Intronic
1035342485 7:158172835-158172857 ATGGTGAAGTTGATGATGGTGGG - Intronic
1035342499 7:158172924-158172946 ATGGTGGAAGTGATGATGGTGGG - Intronic
1035342511 7:158172997-158173019 ATGGTGAAGATGATATTGGTGGG - Intronic
1035342696 7:158174326-158174348 ATGGTGAAGATGATGGTGGTGGG - Intronic
1035342706 7:158174376-158174398 ATGGTGAAGATGATGATGGTGGG - Intronic
1035342722 7:158174474-158174496 CTGCTGATGATGATGATGGTGGG - Intronic
1035381005 7:158440935-158440957 GTGGTGGTGATGATGGTGATGGG + Intronic
1035484102 7:159208967-159208989 ATGTTGTACATGATGGTGTTCGG - Intergenic
1035639600 8:1174257-1174279 ATGGTGGTGATGGTGGTGATGGG - Intergenic
1035659663 8:1337462-1337484 ATGGTGAGGATGATGGGGATGGG + Intergenic
1036599770 8:10249625-10249647 CTGGTGCAGAAGCTGGTGGTGGG - Intronic
1037444060 8:18947008-18947030 ATGGGGAAGATGCTCGTGCTTGG + Intronic
1037904748 8:22709557-22709579 ATGGTGATGATGATGGTAATGGG - Intergenic
1038012220 8:23484108-23484130 TTGGTAATGATGATGGTGATGGG + Intergenic
1038180351 8:25221640-25221662 ATGGAGATGATGATGATGGTAGG - Intronic
1038180355 8:25221669-25221691 ATGATGATGATGATGATGATGGG - Intronic
1038369219 8:26970782-26970804 ATGGTGAAAGTGATACTGGTGGG - Intergenic
1038379500 8:27079315-27079337 AGGGTGAAGAAGGTGGAGGTGGG - Intergenic
1038962983 8:32542337-32542359 ATGATGATGATGATGGTACTGGG - Intronic
1039308648 8:36292445-36292467 ATGGTGAAGATGATAGATGCAGG + Intergenic
1039711815 8:40062397-40062419 ATTGTTAAGATGCTGGTAGTGGG - Intergenic
1039922103 8:41900545-41900567 ATGGTGATGATGATGATGATGGG - Intergenic
1040419013 8:47221867-47221889 ATGGTGATGATGCTGGTGATGGG - Intergenic
1040952101 8:52947740-52947762 ATAGTGAAGATTTTGGGGGTGGG + Intergenic
1043496776 8:80809986-80810008 ATGGTGAGGATAAAGCTGGTAGG - Intronic
1045149725 8:99390645-99390667 ATGGTGAATCTGGTGGCGGTTGG - Intronic
1045416590 8:101973621-101973643 AAGGAGAAGAAGCTGGTGGTGGG + Intronic
1045467276 8:102481926-102481948 GTGGTGATGATGACGGTGGTTGG - Intergenic
1045485252 8:102626251-102626273 ATGATGAAGATTATGATGATTGG + Intergenic
1045635115 8:104176393-104176415 ATGATGATGTTGATAGTGGTAGG - Intronic
1045723994 8:105149522-105149544 ATTGTGATGATGATTGTGGATGG - Intronic
1046966047 8:120166923-120166945 GTGGTGATGATGGTGGTGGTGGG + Intronic
1047217641 8:122889821-122889843 TTGGTATAGATGATGGAGGTTGG + Intronic
1047487089 8:125341273-125341295 ATAATGAAGATGATGCTGTTGGG - Intronic
1047495446 8:125405553-125405575 ATGCTGATGATGAAGGTGTTTGG + Intergenic
1047547002 8:125827942-125827964 AAGGAGAAGTTGGTGGTGGTTGG + Intergenic
1048007153 8:130428661-130428683 ATGGTGATGATGATGGTGGGGGG - Intronic
1048070355 8:131014429-131014451 ATTGTGAACAGGATGGTGTTAGG - Intronic
1048092642 8:131258268-131258290 AAGGTGAAGATGTTGATGGGAGG - Intergenic
1048439805 8:134451467-134451489 ATGGGGCAGATGCTGGTGGCAGG - Intergenic
1048898771 8:139018251-139018273 ACGGTGATGATGATGATGTTGGG + Intergenic
1048898781 8:139018306-139018328 ATCGTGATGATGAGGGTGATGGG + Intergenic
1048898788 8:139018367-139018389 ATGGCGATGATGAAGGTGATGGG + Intergenic
1049369365 8:142256297-142256319 GTGGTGATGATGGTGGTGGTGGG - Intronic
1049417516 8:142502035-142502057 GTGGTGGTGGTGATGGTGGTCGG + Intronic
1049417578 8:142502329-142502351 ATGGTGATGGTGGTGGTGATGGG + Intronic
1049695395 8:143981975-143981997 ATGGTGGTGGTGATGGTGATGGG + Intronic
1050230951 9:3525780-3525802 GTGATGGAGATGGTGGTGGTGGG + Exonic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1050703021 9:8362663-8362685 ATGATTATGATGATGGTGATTGG - Intronic
1051201077 9:14624663-14624685 ATGGGGAAGAGGATGGTCGATGG + Intronic
1051874514 9:21777252-21777274 AGGGTGAACATGATGGGGTTGGG + Intergenic
1051901024 9:22040456-22040478 ATAGTGGAGATGTGGGTGGTGGG + Intergenic
1052223315 9:26054197-26054219 ATGGTGAAGATGGAGGTGGAGGG - Intergenic
1052735916 9:32342431-32342453 ATGGTGGTGGTGGTGGTGGTGGG - Intergenic
1053148779 9:35729998-35730020 ATGCTGGTGATGATGGTGTTTGG + Intronic
1054845438 9:69791616-69791638 ATGGTTGTGATGATGGTGGTTGG + Intergenic
1054985009 9:71251851-71251873 AAGGTGGAGAGGATGGTGGGAGG - Intronic
1055450672 9:76428586-76428608 AGGATGAAGATGGTGGTGGGAGG - Intronic
1055514143 9:77020085-77020107 GTGGTGATGATGGTGGTGGTGGG - Exonic
1055779139 9:79800354-79800376 CTGTGGAAGCTGATGGTGGTGGG + Intergenic
1055841702 9:80512904-80512926 ATGGAGATGAGAATGGTGGTTGG - Intergenic
1056521369 9:87404764-87404786 ATGGAGCAGATGATGGAGTTAGG - Intergenic
1056566662 9:87778629-87778651 ATGGTGATGATGGTGATGATAGG - Intergenic
1056680338 9:88712016-88712038 ATGGTGGTGATGATGATGATGGG + Intergenic
1057031296 9:91777409-91777431 ATGATGATGATGATGATGATGGG - Intronic
1057862333 9:98650990-98651012 ATGGTGATGGTGGTGATGGTTGG + Intronic
1058125110 9:101183495-101183517 ATGGTGAAGGAGTTGATGGTGGG + Intronic
1058598880 9:106647333-106647355 CTGGTGTTGATGGTGGTGGTGGG - Intergenic
1059385659 9:113962321-113962343 AGGGAAAAGATGATGGTGGCAGG - Intronic
1059419771 9:114183572-114183594 AGGGTGGAAAGGATGGTGGTGGG + Intronic
1059579055 9:115523704-115523726 ATCGTGAAATTGATTGTGGTGGG - Intergenic
1059742025 9:117161170-117161192 ATGATGATGATGGTGGTGGTGGG + Intronic
1060019249 9:120115047-120115069 AAAATGAAGATGATAGTGGTGGG - Intergenic
1060200294 9:121648520-121648542 AGGGTAAAGGTGCTGGTGGTGGG + Intronic
1060279937 9:122209024-122209046 ATAGTGCAGATGAAGGTGGATGG - Intronic
1060289905 9:122292177-122292199 TTGGTAAGGATGATGGTGGCAGG + Intronic
1060940631 9:127541124-127541146 ATGATGGAGATGGTGGTGCTTGG - Intronic
1061492710 9:130955082-130955104 ATGGTGGTGATGAAGATGGTAGG - Intergenic
1061492729 9:130955223-130955245 ATGGTGGTGATGAAGATGGTAGG - Intergenic
1061691316 9:132334076-132334098 ATGATGAAAAAGTTGGTGGTAGG - Intronic
1062631818 9:137466528-137466550 ATGGTGGAGATGGTGGTGGGAGG - Intronic
1062631868 9:137466724-137466746 TTGGTGGAGATGGTGGTGGGAGG - Intronic
1062631920 9:137466920-137466942 ATGGTGGAGACGGTGGTGGGAGG - Intronic
1062631933 9:137466969-137466991 ATGGTGGAGACGGTGGTGGGAGG - Intronic
1203792117 EBV:157339-157361 ATGCTGGACATGACGGTGGTTGG + Intergenic
1185689002 X:2137607-2137629 ATGGTGATCATGATGATGATGGG - Intergenic
1185689006 X:2137641-2137663 ATGGTGATGATGATGATGGGGGG - Intergenic
1185930129 X:4193508-4193530 ATGGTAATGATGGTGATGGTGGG + Intergenic
1185977281 X:4735585-4735607 ATGGTGATGATGATAGTGATGGG - Intergenic
1186828990 X:13371561-13371583 AAGGTGGAGATTATGGTGTTTGG - Intergenic
1186845327 X:13525104-13525126 CTGATGAAGATGGTGGTGTTTGG + Intergenic
1187241694 X:17519814-17519836 ATGATGACGATGATGATGATGGG - Intronic
1187280346 X:17853808-17853830 ATTGTGATGATGGTGGGGGTAGG + Intronic
1187373091 X:18726555-18726577 ATGGAGATGATGATGCTTGTGGG + Intronic
1187654450 X:21454229-21454251 ATTGTGAATAATATGGTGGTAGG - Intronic
1188528939 X:31116198-31116220 ATGGTGGAGGTGCTGTTGGTTGG + Intronic
1188911722 X:35856706-35856728 ATGGTGATGGTGGTGGTAGTTGG - Intergenic
1190301064 X:49057863-49057885 GTGGTGATGGTGGTGGTGGTGGG + Intronic
1192268444 X:69556283-69556305 ATGGTTTGGATGATGGTGGTGGG + Intergenic
1192859275 X:75048475-75048497 ATGCTGAAGATGATGGGGATAGG - Intergenic
1193898675 X:87147924-87147946 ATGTTAAAGTTGATGGTGGAAGG - Intergenic
1193926375 X:87490735-87490757 ATGATGATGATGATGGAGGGAGG + Intergenic
1195899382 X:109781548-109781570 ATGGTGAGAAAGATGGTGGGTGG - Intergenic
1196592959 X:117509331-117509353 TTGGTTAAGATGATGATTGTCGG - Intergenic
1199708976 X:150454701-150454723 ATGGTGTTGATGAGGGTGTTGGG - Intronic
1199963805 X:152801295-152801317 ATGCTGGAGATGGTGGAGGTAGG + Intergenic
1200034947 X:153321014-153321036 ATGTTACAGATGATGGTGGGAGG - Intergenic
1200101484 X:153690902-153690924 CTGGTGTTGATGGTGGTGGTGGG - Intronic
1200152264 X:153957009-153957031 TTGGTGGTGATGATGGTGATGGG + Exonic
1200152366 X:153957451-153957473 GTGGTAGTGATGATGGTGGTGGG + Exonic
1200366236 X:155667607-155667629 ATGGTGGTAGTGATGGTGGTGGG + Intronic
1201143530 Y:11048128-11048150 ATGTTGATGATGTTGGTGATGGG + Intergenic
1201143559 Y:11048384-11048406 ATGGTGATGATGTTGGTGATGGG + Intergenic
1201143610 Y:11048824-11048846 ATGGTGATGATGTTGGTGATGGG + Intergenic
1201560432 Y:15310425-15310447 ATGATGGTGATAATGGTGGTTGG + Intergenic
1201614112 Y:15876996-15877018 ATGGTGATGATGATGATGATGGG + Intergenic
1201616256 Y:15902781-15902803 ATGGTGATGATGATGATGATGGG - Intergenic
1202377419 Y:24250262-24250284 ATGGAGCAGAGGATGGAGGTGGG - Intergenic
1202493361 Y:25419859-25419881 ATGGAGCAGAGGATGGAGGTGGG + Intergenic